Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election of species in the reply filed on October 17, 2024, is acknowledged.
Applicant elected the following species:
An HRE as the alternative regulatory element
An interleukin as the alternative therapeutic payload
A LILRB receptor as the alternative extracellular binding domain
An IgG4 hinge domain as the spacer domain
A CD28 transmembrane domain as the alternative transmembrane domain
CD3ξ and 4-1BB domains as the alternative intracellular signaling domain
Glioblastoma as the alternative cancer
Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
DETAILED ACTION
The amended claims filed on March 31, 2026, have been acknowledged. Claims 1-56, 59-62, 67, 71, 77, and 79 were cancelled. Claim 57 was amended. Claims 57-58, 63-66, 68-70, 72-76, 78, and 80-82 are pending and examined on the merits.
Priority
The applicant claims domestic priority from U.S. provisional application No. 62/800,049, filed on February 1, 2019. Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Claims 57-58, 63-66, 68-70, 72-76, 78, and 80-82 receive domestic benefit from U.S. provisional application No. 62/800,049, filed on February 1, 2019.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 57-58, 63-66, 73-75, 78, and 80 are rejected under 35 U.S.C. 103 as being unpatentable over Kim et al. (Molecular Therapy 16: 599-606. 2008), Willam et al. (Eur J Physiol 451: 534–543. 2006), Li et al. (ACS Nano 10: 6753−6761. 2016), Clambey et al. (PNAS 109: E2784-E2793. 2012), Wang et al. (Biochemical and Biophysical Research Communications 490: 480-485. 2017), Fujita et al. (FASEB J. 28: 2455–2465. 2014), and Geng et al. (Gene Therapy 21: 444-449. 2014). This is a new rejection that is substantially similar to a previous rejection of record made in response to Applicant’s amendment to claim 57. Any aspect of Applicant’s traversal that is relevant to the new rejection of record is addressed below.
Regarding claims 57 and 80, Kim teaches a genetically modified T cell comprising a lentiviral vector encoding a bidirectional vascular endothelial growth factor (VEGF) hypoxia-inducible responsive element (HRE), which drives the hIL-2 gene and a marker gene (renilla luciferase). Hypoxia induces transgene expression of the luciferase and hIL-2 in vitro and in vivo. Kim teaches that they administered their modified T cells to tumor bearing mice and found that they caused complete and rapid tumor eradication and prolong survival in the mice. Kim teaches that hypoxia occurs in many tumors and reduces the effectiveness of radio- and chemotherapy. Hypoxia also impedes immune responses to tumors, reducing T lymphocyte production of cytokines such as interleukin-2 (IL-2) and interferon gamma, as well as the survival and proliferation of these cells (Abstract, page 605, column 1, paragraph 4, and Figures 2-3 and 5-6).
Kim does not teach wherein the first nucleic acid comprises a minimal thymidine kinase promoter nor an HRE with a nucleotide sequence having 90% sequence identity to SEQ ID NO: 44.
However, Willam teaches a nucleic acid construct 6HRE/PGK-TK-Luc luciferase comprising six repeats of the PGK hypoxia response element and a minimal thymidine kinase promoter (page 536, column 1, paragraph 2). Figure 3 shows that the 6HRE/PGK-TK-Luc has higher gene expression under pH 7.0 conditions than pH 7.4 conditions while EPO HREs with an SV40 promoter did not show the same significant increase in expression under acidic conditions.
Li teaches that the pH of blood is 7.4 and the pH of the tumor microenvironment is (6.5-7.0 Scheme 1).
Clambey teaches that mouse and human T cells increase expression of HIF1α and PGK under hypoxic conditions (Figures 1 and 2).
Wang teaches that VEGF is activated by HIF2 and to lesser extent by HIF-1 and inhibited by CFNOA, while PGK1 is almost exclusively a HIF-1 responsive gene. Wang teaches that while both HIF-1α and HIF-2α can mediate the cellular response to hypoxia, they differ in their responsiveness to other cellular signals and cell types in which they are expressed. HIF-2α expression and LOX are important in oncogenesis and especially the process of metastases. Several specific small-molecule inhibitors of HIF-2α have been described, and it is possible that these may be useful in the prevention or treatment of cancer metastases. A potential advantage of specific HIF-2 inhibitors is that they would not block the general response of cells to hypoxia mediated by HIF-1 (page 484, column 2, paragraph 1-page 485, column 1, paragraph 3)
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the VEGF HREs and CMV promoter with the six repeats of the PGK hypoxia response element and a minimal thymidine kinase promoter of Willam to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to substitute with a reasonable expectation of success because Kim teaches that their modified T cells can be used for treating cancer and the tumor microenvironment is known to be associated with more acidic pH and hypoxia, as identified by Li and Kim. Willam teaches that the combination of six repeats of the PGK hypoxia response element and a minimal thymidine kinase promoter showed improved gene expression under pH 7.0 hypoxic conditions compared to pH 7.4 hypoxic conditions while other HRE- promoter combinations (EPO HRE-SV40 promoter) did not. Furthermore, Clambey teaches that T cells increase expression of HIF1α and PGK under hypoxic conditions and Wang teaches that VEGF is activated by HIF2 and to lesser extent by HIF-1 and inhibited by CFNOA, while PGK1 is almost exclusively a HIF-1 responsive gene and that small-molecule inhibitors of HIF-2α may be useful in the prevention or treatment of cancer metastases. Therefore, it would have been obvious to substitute the VEGF HRE elements of Kim with the PGK HRE and thymidine kinase promoter of Willam as the VEGF would prevent the use of the HIF-2α inhibitors for the treatment of cancer metastases in combination with modified T cells. Furthermore, it has already been shown that PGK HREs are active in T cells and undergo induced expression during hypoxic conditions and the PGK HRE and a minimal thymidine kinase promoter provides the potential for increased expression from the acidic tumor microenvironment as well, as it has already been shown in one cancer cell line. The tumor microenvironment has a more acidic pH (6.5-7.0) than the blood (7.4). This would help localize the expression of the transgene to the tumor microenvironment while limiting expression in non-target tissues and improve transgene expression within the tumor to improve the efficacy of the treatment. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
The teachings of Kim, Willam, Li, Clambey, and Wang are as discussed above.
Willam is silent as to the sequence of the PGK HRE.
However, Fujita teaches they cloned 3x Pgk1 HRE-Luc into a plasmid wherein the HRE sequence (Top row) is 100% identical to SEQ ID NO: 44 (Bottom row) of the instant application, as shown below (page 2456, column 2, paragraph 2):
1 TGTCACGTCCTGCACGACTCTAGT 24
||||||||||||||||||||||||
1 TGTCACGTCCTGCACGACTCTAGT 24
Fujita teaches that the Pgk1 HRE sequence was obtained from Addgene and was functional (page 2456, column 2, paragraph 2 and Figure 3).
As the Pgk1 HRE sequence is known within the art and was already cloned into a plasmid, it would have been obvious that one could choose this as the sequence for the Pgk HRE of Willam. Furthermore, the successful cloning and sequencing of the nucleic acid sequence encoding a known regulatory element is obvious, and thus unpatentable, if (1) there was some suggestion or motivation in the prior art to clone the DNA, and (2) there was a “reasonable expectation of success,” based on "detailed enabling methodology" in the prior art. Ex parte Kubin, 83 U.S.P.Q.2d (BNA) 1410 (B.P.A.I. 2007), aff'd, 561 F.3d 1351 (Fed. Cir. 2009). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
The teachings of Kim, Willam, Li, Clambey, Wang, and Fujita are as discussed above.
The combined teachings of Kim, Willam, Li, Clambey, Wang, and Fujita do not teach using VPX as part of their lentiviral packaging.
However, Geng teaches that lentiviruses are critically limited in their ability to infect resting T cells in the peripheral blood and lymphoid tissues due to the expression of SAMHD1. Through its phosphohydrolase activity, SAMHD1 decreases dexoxynucleotide triphosphate pools in quiescent CD4 T cells and greatly slows the kinetics of reverse transcription, often resulting in incomplete viral transcripts. To relieve the SAMDH1-mediated resistance of primary T cells to HIV LV infection, the accessory lentiviral gene product protein X (Vpx) can be included as part of the packaged viral particle as it induces polyubiquitylation and proteasomal degradation of SAMHD1 in non-permissive human myeloid and resting T cells thereby alleviating the restriction block. As can be seen in Figure 1, the addition of Vpx led to a significant increase in the number of T cells that were successfully transduced by the lentiviral vector (page 444, column 1, paragraph 2-column 2, paragraph 3 and Figure 1).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the genetically modified T cell of the combined teachings of Kim, Willam, Li, Clambey, Wang, and Fujita by incorporating VPX into the lentiviral particle encoding the polynucleotide comprising the HRE element, as identified by Geng, to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to modify with a reasonable expectation of success because Kim teaches that they are genetically modifying T cells for treating cancer and Geng teaches that VPX significantly increases the transduction efficiency of the lentiviral particle in T cells. Therefore, it would have been obvious to use a lentiviral particle comprising VPX to deliver the HRE element into the T cells as this would improve the transduction efficiency and the efficacy of the treatment method as more T cells would be transduced and can be used for treating the cancer. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Regarding claim 58, Kim teaches that they implanted EBV-LCL tumor cells in Matrigel subcutaneously into the flanks of irradiated severe combined immunodeficient mice and allowed the tumors to grow. Kim administered the HRE-IL-2 CTLs to tumor bearing mice and found that the HRE-IL-2 CTLs were present in the hypoxic region of the tumors, where they produced IL-2.
Regarding claim 63, Kim teaches that the transgene is IL-2 (a cytokine) (Figure 2).
Regarding claim 64, Figure 2 of Kim teaches that the HREs are linked to CMV promoters (a constitutive promoter). As Kim teaches that they used a bidirectional lentiviral vector comprising two CMV, promoters driving the renilla luciferase gene and the hIL-2 gene, the thymidine kinase promoter could replace the promoter for the hIL-2 gene for the potential additional increase in gene expression from the acidic tumor microenvironment while maintaining the CMV promoter for the renilla luciferase gene as this is a reporter gene and not a therapeutic gene.
Regarding claims 65-66, Kim teaches that the polynucleotide is comprised within a lentiviral vector (Figure 2).
Regarding claim 73, Kim teaches that the genetically modified cell is a T cell (abstract).
Regarding claims 74-75, Kim, as stated supra, teaches that they administered the HRE-IL-2 CTLs to solid tumor bearing mice and found that the HRE-IL-2 CTLs promotes complete and rapid tumor eradication and prolonged survival (Figure 6 and page 602, column 1, paragraph 2-column 2, paragraph 1).
Regarding claim 78, Kim teaches that the lentiviral vector construct comprises five HREs (Figure 2), Willam teaches that their construct comprises six HREs (page 536, column 1, paragraph 2), and Fujita teaches that their construct comprises three HREs (page 2456, column 2, paragraph 2).
Response to Arguments
Applicant's arguments filed March 31, 2026, are acknowledged.
Applicant argues that the cited references, whether considered individually or in combination, fail to render the claims obvious at least because: (1) the cited references do not disclose or suggest all of the limitations of the claims; (2) the Office Action does not establish a reasonable expectation of success for the proposed combinations; (3) the proposed modifications would alter the primary references' intended purpose and principle of operation; (4) the cited references affirmatively teach away from the proposed combinations (page 5, paragraph 3-page 6, paragraph 1).
Regarding Applicant’s first argument, Applicant argues the cited prior art does not teach that the polynucleotide is "comprised in a lentiviral vector packaged with viral protein X (VPX)." (page 6, paragraph 3-page 7, paragraph 1).
Applicant's arguments have been fully considered but they are not persuasive.
As identified in the rejection above, the rejection has been modified to incorporate the teachings of Geng which render obvious that the polynucleotide can be comprised in a lentiviral vector packaged with viral protein X (VPX). Specifically, Kim teaches that they are genetically modifying T cells for treating cancer and Geng teaches that VPX significantly increases the transduction efficiency of the lentiviral particle in T cells. Therefore, it would have been obvious to use a lentiviral particle comprising VPX to deliver the HRE element into the T cells as this would improve the transduction efficiency and the efficacy of the treatment method as more T cells would be transduced and can be used for treating the cancer.
Regarding Applicant’s second argument, they argue that the prior art fails to teach or suggest the claimed invention with a reasonable expectation of success. Specifically, Applicant argues against the rationale asserted for substituting Kim's VEGF HRE/minCMV system with Willam’s PGK HRE/minimal TK (PGK HRE/miniTK) system in engineered immune cells. Willam teaches that pH effects on HIP-driven reporter output are inconsistent and cell-type dependent, undermining any reasonable expectation that the asserted "acidic tumor pH" advantage would occur in engineered immune cells. Willam reports that for the 6HRE/PGK-TK-Luc reporter, Hep3B cells did not show increased reporter activity under hypoxia at pH 7.0 compared to pH 7.4; specifically, "in Hep3B cells acidosis led to increased reporter gene activity only in normoxia, but not in hypoxia ... " See Willam at Fig. 3. Thus, Willam does not provide a predictable, generalizable teaching that PGK HRE/miniTK increases expression under hypoxic acidic conditions. Moreover, Willam's experiments were performed in HeLa and Hep3B cell lines using transient transfection reporter constructs, see Willam at page 536 and Fig. 3, and the Office Action does not identify any teaching that the reported pH behavior translates to immune cells generally, or to adoptively transferred engineered immune cells in vivo. In view of Willam’s express teaching of inconsistency and celltype dependence, there is no reasonable expectation that swapping to PGK HRE/miniTK would perform in the context as outlined by the examiner.
Furthermore, the Applicant argues that the asserted HIF-2a inhibitor compatibility rationale is also not taught or suggested by the cited references. The Office Action does not identify a disclosure in Kim that contemplates co-administering HIF-2a inhibitors with engineered T-cell therapy or that flags the VEGF HRE as a barrier to any such combination regimen, such that Kim would be motivated to make such a change. Absent such a teaching, the asserted need to redesign Kim's regulatory choice around a hypothetical HIF-2 inhibitor combination is not an articulated motivation grounded in the prior art. Further, if a skilled artisan were concerned that HIF-2a inhibitors might interfere with hypoxia-responsive regulation, that concern would discourage reliance on an HRE-based hypoxia transcriptional control scheme, rather than specifically motivate selection of Willam’s PGK HRE/miniTK configuration, especially when viewed in light of Willam’s teaching of inconsistent effects. See Willam at Abstract and Fig. 3.
Additionally, Kim already demonstrates robust hypoxia-inducible IL-2 expression m engineered tumor-specific T cells and improved anti tumor efficacy using its VEGF HRE/minCMV configuration, which further undercuts any need to modify Kim as alleged. Kim reports hypoxia inducible transgene expression in tumor-specific CTLs and rapid, complete tumor regression and survival benefits in vivo. Thus, the cited record provides no affirmative reason to abandon Kim's working VEGF HRE/minCMV system in favor of a significantly different approach using the Willam-derived PGK HRE/miniTK system that was tested as a reporter in non-immune cell lines and shown by Willam to have inconsistent and celldependent behavior under hypoxia/acidosis (page 7, paragraph 2-page 9, paragraph 1).
Applicant's arguments have been fully considered but they are not persuasive.
Regarding the lack of a reason to substitute, as stated supra, it would have been obvious to substitute the VEGF HRE elements of Kim with the PGK HRE and thymidine kinase promoter of Willam as the VEGF would prevent the use of the HIF-2α inhibitors for the treatment of cancer metastases in combination with modified T cells. Wang specifically teaches that VEGF is activated by HIF2 and to lesser extent by HIF-1 and inhibited by CFNOA, while PGK1 is almost exclusively a HIF-1 responsive gene. Wang teaches that while both HIF-1α and HIF-2α can mediate the cellular response to hypoxia, they differ in their responsiveness to other cellular signals and cell types in which they are expressed. HIF-2α expression and LOX are important in oncogenesis and especially the process of metastases. Several specific small-molecule inhibitors of HIF-2α have been described, and it is possible that these may be useful in the prevention or treatment of cancer metastases. A potential advantage of specific HIF-2 inhibitors is that they would not block the general response of cells to hypoxia mediated by HIF-1 (page 484, column 2, paragraph 1-page 485, column 1, paragraph 3).
Furthermore, it has already been shown that PGK HREs are active in T cells and undergo induced expression during hypoxic conditions and the PGK HRE and a minimal thymidine kinase promoter provides the potential for increased expression from the acidic tumor microenvironment as well, as it has already been shown in one cancer cell line. The tumor microenvironment has a more acidic pH (6.5-7.0) than the blood (7.4). This would help further localize the expression of the transgene to the tumor microenvironment while limiting expression in non-target tissues and improve transgene expression within the tumor to improve the efficacy of the treatment. As such, it would have been reasonable to substitute the VEGF HRE elements of Kim with the PGK HRE and thymidine kinase promoter of Willam.
Therefore, the teachings of Wang alone provide motivation for substituting the VEGF HRE elements with the PGK HRE elements as Wang specifically identifies that VEGF HRE elements limit the potential for co-administration of additional anti-cancer agents whereas the PGK HRE element does not have the same issue. It is well understood that co-administration of additional anti-cancer agents may improve the efficacy of the anti-cancer treatment. Therefore, it would have been obvious to make the substitution to maintain the option of using additional anti-cancer agents that target HIF-2α to increase the efficacy of the anti-cancer treatments.
Furthermore, regarding Applicant’s arguments against the teachings of Willam specifically, it is worth pointing out that although there may be inconsistent results regarding the increased expression under acidic conditions of their PGK HRE elements, Willam identifies that even if no increased expression occurs under more acidic conditions, expression does not decrease in response to a change in pH (Figures 1 and 3). Therefore, Willam shows that the PGK HRE elements can lead to an increase in expression that would be beneficial in treating cancer or no change in expression under hypoxic conditions which would not negatively impact the treatment of cancer. As such, one would weigh the potential benefits of increased expression against the fact that there are no reductions in expression in cells where it doesn’t increase expression under more acidic conditions and come to the conclusion that the potential benefit of increased expression is worth substituting the HRE elements.
Moreover, absolute predictability is not a necessary prerequisite to a case of obviousness. Rather, a degree of predictability that one of ordinary skill would have found to be reasonable is sufficient. The Federal Circuit concluded that “[g]ood science and useful contributions do not necessarily result in patentability.” Id. at 1364, 83 USPQ2d at 1304.
Regarding Applicant’s third argument, they argue that the modification changes the primary reference’s intended purpose and principal of operation. Specifically, Applicant argues Kim and William are directed to different purposes. Kim is directed to improving the performance of tumor-specific cytotoxic T lymphocytes (CTLs) in hypoxic tumor regions by using a hypoxia-responsive expression system to restore/support T-cell survival and proliferation under low oxygen and Willam is directed to basic mechanistic physiology, studying how acidosis, or low extracellular pH, affects HIF-la/HIF-2a and HIF target gene expression, and evaluates these effects using HIP-driven luciferase reporter constructs in tumor cell lines. Accordingly, the cited references have materially different intended purposes and focus as Kim addresses therapeutic transgene control in engineered CTLs in vivo, whereas Willam reports cell-type-specific, inconsistent acidosis effects on an experimental reporter system in non-immune tumor cell lines. Accordingly, the Office Action's substitution rationale to support its finding of obviousness improperly relies on importing a reporter-system observation from HeLa/Hep3B cells into a therapeutic CTL vector context without a reliable basis or reasonable expectation of success to achieve Kim's intended purpose. To the extent the Office Action relies on Clambey as indicating that PGK is induced in T cells under hypoxia, Applicant notes that such evidence concerns endogenous PGK regulation, not the performance of Willam's synthetic 6HRE/PGK-TK regulatory cassette in immune cells.
Additionally, the Office Action's proposed substitution of Kim's VEGF HRE/minimal CMV system with Willam's PGK HRE/minimal thymidine kinase (TK) promoter system would have been disfavored by a person of ordinary skill in the art because it risks rendering the Kim system unsatisfactory for its intended purpose. Kim's intended purpose is not merely to achieve generic "hypoxia responsiveness," but rather to functionally rescue engineered CTLs under severe hypoxia by ensuring robust hypoxia-induced IL-2 expression sufficient to support T-cell survival and proliferation while sustaining effector function. Willam's teaching that the pH-related "benefit" may be absent under hypoxia depending on the cell type directly undermines the alleged rationale for substitution See Willaim at Abstract and Fig. 3. Moreover, Willam does not evaluate the 6HRE/PGK-TK system in immune cells, so the references do not provide a reliable basis to extrapolate the purported pH benefit to engineered CTLs, or other immune cell types), in vivo. Substituting a regulatory system that Willam characterizes as inconsistent and cell-type dependent risks undermining Kim's core objective. Kim's therapeutic effect depends on strong and predictable hypoxia-driven IL-2 induction to support CTL survival and proliferation under low oxygen. See Kim at Abstract. If the substituted Willam system behaves in engineered immune cells as it does in Hep3B cells under hypoxia, with no meaningful acidosis enhancement in hypoxia, then the substitution provides no reliable "acidic TME" advantage and can reduce the likelihood of achieving Kim's functional rescue purpose. Willam does not provide a reliable expectation that replacing Kim's regulatory system with PGK HRE/minTK would preserve functional hypoxia-selective control in the engineered immune-cell setting that Kim is designed to address (page 9, paragraph 3-page 12, paragraph 1 and page 12, paragraph 3-page 13, paragraph 1).
Applicant's arguments have been fully considered but they are not persuasive.
Regarding Applicant’s argument that Kim and William are directed to different purposes, it is worth noting that Kim and William are not the only references cited in the above rejection. Instead, the rejection is based on all of the teachings of Kim, Willam, Li, Clambey, Wang, and Fujita. As stated supra, it would have been obvious to substitute the VEGF HRE elements of Kim with the PGK HRE and thymidine kinase promoter of Willam as the VEGF would prevent the use of the HIF-2α inhibitors for the treatment of cancer metastases in combination with modified T cells. Wang specifically teaches that VEGF is activated by HIF2 and to lesser extent by HIF-1 and inhibited by CFNOA, while PGK1 is almost exclusively a HIF-1 responsive gene. Wang teaches that while both HIF-1α and HIF-2α can mediate the cellular response to hypoxia, they differ in their responsiveness to other cellular signals and cell types in which they are expressed. HIF-2α expression and LOX are important in oncogenesis and especially the process of metastases. Several specific small-molecule inhibitors of HIF-2α have been described, and it is possible that these may be useful in the prevention or treatment of cancer metastases. A potential advantage of specific HIF-2 inhibitors is that they would not block the general response of cells to hypoxia mediated by HIF-1 (page 484, column 2, paragraph 1-page 485, column 1, paragraph 3).
Furthermore, it has already been shown that PGK HREs are active in T cells and undergo induced expression during hypoxic conditions and the PGK HRE and a minimal thymidine kinase promoter provides the potential for increased expression from the acidic tumor microenvironment as well. As such, it would have been reasonable to substitute the VEGF HRE elements of Kim with the PGK HRE and thymidine kinase promoter of Willam.
Therefore, although Kim and Willam are directed to different purposes, the combined teachings of Kim, Willam, Li, Clambey, Wang, and Fujita provide motivation for substituting the VEGF HRE elements of Kim with the PGK HRE and thymidine kinase promoter of Willam to allow for additional anticancer treatments to be used to treat/prevent cancer metastasis which Kim identifies as a possible target for their modified CTLs (see Figure 5). Therefore, the combined teachings of Kim, Willam, Li, Clambey, Wang, and Fujita provide a clear nexus between the work of Kim and Willam and a clear motivation for making the substitution.
Regarding Applicant’s arguments that substitution of Kim's VEGF HRE/minimal CMV system with Willam's PGK HRE/minimal thymidine kinase (TK) promoter system risks rendering the Kim system unsatisfactory for its intended purpose, none of the cited data from Willam supports this argument. Willam identifies that even if no increased expression occurs under more acidic conditions in Hep3B cells, expression still increases under hypoxic conditions in both pHs tested and does not decrease in response to a change in pH (Figures 1 and 3). Therefore, Willam shows that the PGK HRE elements can lead to an increase in expression that would be beneficial in treating cancer or no change in expression under hypoxic conditions which would not negatively impact the treatment of cancer. As such, Willam does show that their PGK HRE elements lead to increased expression under hypoxic conditions which is consistent with what would be expected from using HRE elements. Therefore, the PGK HRE elements would not reduce the likelihood of achieving Kim's functional rescue purpose as Willam does show hypoxia selective control of their reporter gene.
Moreover, absolute predictability is not a necessary prerequisite to a case of obviousness. Rather, a degree of predictability that one of ordinary skill would have found to be reasonable is sufficient. The Federal Circuit concluded that “[g]ood science and useful contributions do not necessarily result in patentability.” Id. at 1364, 83 USPQ2d at 1304.
Applicant further argues that the Office Action's proposed substitution of Kim's regulatory system with Willam's regulatory system is not a simple exchange of one HRE/promoter for another, but instead would require a substantial reconstruction and redesign that changes the principle of operation of Kim's vector. Kim's disclosed regulatory architecture is a bidirectional system in which HREs are flanked by two minimal CMV promoters that coordinately drive expression of two genes (including IL-2 and a marker gene) in response to hypoxia. By contrast, Willam's relevant construct is a single luciferase reporter cassette, 6HRE/PGK-TK-Luc, comprising six repeats of the PGK HRE operably linked to a minimal thymidine kinase promoter, used in transient transfection assays in HeLa and Hep3B cell lines to measure HIF transcriptional activity. Thus, achieving Kim's bidirectional dual-gene expression behavior using Willam's single-promoter reporter configuration is not a simple swap in as it requires re-architecting how two genes are coordinately controlled (page 12, paragraph 2-page 13, paragraph 1).
Applicant's arguments have been fully considered but they are not persuasive.
Applicant is reminded that a 35 U.S.C. § 103(a) based test for obviousness is not whether the features of a secondary reference may be bodily incorporated into the structure of the primary reference; nor is it that the claimed invention must be expressly suggested in any one or all of the references. Rather, the test is what the combined teachings of the references would have suggested to those of ordinary skill in the art. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981). In the instant case, one of ordinary skill in the art would understand that they could modify the bidirectional system of Kim to incorporate the PGK HREs and minimal thymidine kinase promoter. As identified above, there is a clear motivation to switching to the PGK HRE elements to allow for additional anti-cancer drugs to be administered in combination with the modified immune cells and for the potential of increased expression under more acidic conditions. Furthermore, in order to complete the art of record and rebut Applicant’s arguments, Fitzsimons et al. (Gene Therapy 8: 1675–1681. 2001) evidences that minimal thymidine kinase promoters have been used as part of bidirectional promoter systems to drive expression of genes in an inducible manner (whole document). Therefore, it would be well understood in the art how to make the substitution. Furthermore, it is worth noting that the bidirectional promoter drives expression of a luciferase reporter gene (Renilla-Luc) and IL-2 (the therapeutic gene). One of ordinary skill in the art would identify that the bidirectional reporter is not required for the CTLs of Kim to perform their intended anti-cancer function as the luciferase is just a reporter gene and has no therapeutic effect. Therefore, it would have been well understood that the bidirectional promoter is not an integral part of the vector of Kim as a unidirectional promoter driving expression of IL-2 alone would also have a similar function.
Regarding Applicant’s fourth argument, they argue that the cited references teach away from the proposed combination. Specifically, Applicant argues the cited references teach away from the Examiner's proposed expectation that Willam's PGK HRE/minimal thymidine kinase (miniTK) regulatory system would be a predictable, generally applicable substitute for Kim's immune-cell hypoxia system, or that it would be a predictable regulator for hypoxia-controlled CAR expression in immune cells. Neither Willam nor Ede demonstrates that a PGK HRE/miniTK system functions in immune cells. Willam's 6HRE/PGK-TK-Luc construct is evaluated as a luciferase reporter in non-immune tumor cell lines (HeLa and Hep3B), see William at page 536, and Willam emphasizes that acidosis effects on HIF driven readouts are inconsistent and cell-type dependent. Ede expressly emphasizes that core promoter choice is critical to achieving stringent hypoxia control and identifies a synthetic core promoter (YB_ TATA) as providing low basal expression with high induced expression, and applies this quantitative promoter selection to engineer hypoxia-inducible CAR expression. See Ede at pages 397-400. The emphasis on promoter choice with Ede's deli berate use of YB_ TAT A rather than mini TK for hypoxia-inducible CAR control teaches away from that miniTK is a universally reliable suitable core promoter for hypoxia-controlled immune-cell CAR expression (page 13, paragraph 2-page 14, paragraph 1).
Applicant's arguments have been fully considered but they are not persuasive.
Regarding Applicant’s arguments that neither Willam nor Ede demonstrates that a PGK HRE/miniTK system functions in immune cells, as stated in the rejection above, Clambey teaches that mouse and human T cells increase expression of HIF1α and PGK under hypoxic conditions (Figures 1 and 2). Therefore, it would be well understood that the PGK HRE elements of Willam would also show increased expression under hypoxic conditions in immune cells, such as T cells.
Regarding Applicant’s argument that Ede identifies a synthetic core promoter (YB_ TATA) as providing low basal expression with high induced expression, and applies this quantitative promoter selection to engineer hypoxia-inducible CAR expression, Ede specifically teaches that on the basis of the promoter properties quantified in their study, informed decisions can be made in the selection of core promoters during the construction of future mammalian synthetic biology circuits. Strategies such as adjusting the number, sequence, and spacing of response elements coupled to the core promoter can be combined with the choice of core promoter to further refine the expression level and inducibility of transcription units, thus enabling the development of robust mammalian systems for diverse applications ranging from metabolic engineering to cell-based therapy (page 400, column 2, paragraph 6-page 401, column 1, paragraph 1). Therefore, Ede identifies that the core promoter choice is dependent on the expression level and inducibility of transcription units required for a specific purpose. Furthermore, MPEP 2145,X(D1) states that "the prior art’s mere disclosure of more than one alternative does not constitute a teaching away from any of these alternatives because such disclosure does not criticize, discredit, or otherwise discourage the solution claimed…." In re Fulton, 391 F.3d 1195, 1201, 73 USPQ2d 1141, 1146 (Fed. Cir. 2004). In affirming the Board’s obviousness rejection, the court held that the prior art as a whole suggested the desirability of the combination of shoe sole limitations claimed, thus providing a motivation to combine, which need not be supported by a finding that the prior art suggested that the combination claimed by the applicant was the preferred, or most desirable combination over the other alternatives. Id. See also In re Urbanski, 809 F.3d 1237, 1244, 117 USPQ2d 1499, 1504 (Fed. Cir. 2016). In the instant case, none of the cited prior art criticize, discredit, or otherwise discourage the use of the miniTK promoter. Instead, the combined teachings of Kim, Willam, Li, Clambey, Wang, and Fujita provide motivation for using the PGK HRE element with miniTK promoter of Willam, as identified above. Therefore, one of ordinary skill in the art would understand that the PGK HRE element with miniTK promoter of Willam would be a viable option for inducing expression of a transgene of interest in an immune cell.
Claims 57-58, 65-66, 68-69, and 73-74 are rejected under 35 U.S.C. 103 as being unpatentable over Kim et al. (Molecular Therapy 16: 599-606. 2008), Willam et al. (Eur J Physiol 451: 534–543. 2006), Li et al. (ACS Nano 10: 6753−6761. 2016), Clambey et al. (PNAS 109: E2784-E2793. 2012), Wang et al. (Biochemical and Biophysical Research Communications 490: 480-485. 2017), Fujita et al. (FASEB J. 28: 2455–2465. 2014), and Geng et al. (Gene Therapy 21: 444-449. 2014) as applied to claim 57 above, and further in view of John et al. (Molecular Therapy 26: 2487-2495. 2018), Drolle et al. (Leukemia Research 39: 779–785. 2015), and Ede et al. (ACS Synth. Biol. 5: 395−404. 2016). This is a new rejection that is substantially similar to a previous rejection of record made in response to Applicant’s amendment to claim 57. Applicant’s traversal has been addressed above.
The teachings of Kim, Willam, Li, Clambey, Wang, Fujita, and Geng are as discussed above. Kim teaches that although they examined their construct in EBV-associated lymphoma, the same approach may be applicable to T cell therapies for other malignancies (page 605, column 1, paragraph 1).
The combined teachings of Kim, Willam, Li, Clambey, Wang, Fujita, and Geng do not teach wherein the genetically modified cell further comprises a CAR.
Regarding claim 57, John teaches that they generated a novel anti-LILRB4 CAR-T cell that displays high antigen affinity and specificity. These CAR-T cells display efficient effector function in vitro and in vivo against LILRB4+ AML cells. Furthermore, they demonstrate anti-LILRB4 CAR-T cells are not toxic to normal CD34+ umbilical cord blood cells in colony-forming unit assays, nor in a humanized hematopoietic-reconstituted mouse model. Their data demonstrate that anti-LILRB4 CAR-T cells specifically target monocytic AML cells with no toxicity to normal hematopoietic progenitors, thus offering a new treatment strategy to improve outcomes for monocytic AML, with the potential for elimination of leukemic disease while minimizing the risk for on-target off-tumor toxicity (abstract). Anti-LILRB4 CAR-T cells demonstrated significantly increased effector cytokine release of both IFN-γ and TNF-α when activated by MV4-11 AML cells, compared with control T cells (Figure 3C) (page 2490, column 1, paragraph 1 and Figure 3C). John teaches that the CAR construct comprises a CD8a leader, humanized anti-LILRB4 scFv, CD8α hinge and transmembrane domain, intracellular 41BB co-stimulatory domain, and intracellular CD3ζ activation domain.
Drolle teaches that acute myeloid leukemia cells are in a hypoxic environment in the bone marrow with approximately 6% O2 (page 784, column 1, paragraph 1).
Ede teaches that they constructed a hypoxia-inducible chimeric antigen receptor (CAR) expression system to restrict antigen-responsive T-cell activation to hypoxic environments (page 400, column 1, paragraph 1-column 2, paragraph 1 and Figure 7). By placing CAR expression under the control of YB_TATA coupled to hypoxia-responsive elements, they successfully engineered human Jurkat T cells to respond to antigen stimulation only when the antigen is present in a hypoxic environment. Such a conditional T-cell activation system could increase the specificity of adoptive T-cell therapy against tumors, which are frequently characterized by hypoxic growth (page 400, column 2, paragraph 5).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the modified T cell of Kim, Willam, Li, Clambey, Wang, Fujita, and Geng with a LILRB CAR T-cell with the HREx4 YB_TATA hypoxia-responsive regulator of CAR expression to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to combine with a reasonable expectation of success because Kim, Wang, John, and Ede are both interested in improving the efficacy of treating cancer while minimizing off-target effects and John and Ede teach that their LILRB CAR and HREx4 YB_TATA hypoxia-responsive regulator of CAR expression, respectively, increases the specificity of adoptive T-cell therapy against tumors. Furthermore, Drolle teaches that the bone marrow is a hypoxic environment in acute myeloid leukemia. As such, it would have been obvious to combine the modified T cell of Kim, Willam, Li, Clambey, Wang, and Fujita with a LILRB CAR T-cell with the HREx4 YB_TATA hypoxia-responsive regulator of CAR expression to increase the specificity of adoptive T-cell therapy against cancerous malignancies. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Regarding claim 68, as stated supra, John teaches that the CAR construct comprises a humanized anti-LILRB4 scFv (extracellular binding domain), CD8a hinge (considered a spacer domain) and transmembrane domain (a transmembrane domain), intracellular 41BB co-stimulatory domain (intracellular signaling domain), and intracellular CD3ξ activation domain (intracellular signaling domain) (Figure 1).
Regarding claim 69, as stated supra, John teaches that the extracellular signaling domain is an LILRB4 antigen (i.e. derived from an LILRB receptor) (Figure 1).
Claims 57, 68, and 70 are rejected under 35 U.S.C. 103 as being unpatentable over Kim et al. (Molecular Therapy 16: 599-606. 2008), Willam et al. (Eur J Physiol 451: 534–543. 2006), Li et al. (ACS Nano 10: 6753−6761. 2016), Clambey et al. (PNAS 109: E2784-E2793. 2012), Wang et al. (Biochemical and Biophysical Research Communications 490: 480-485. 2017), Fujita et al. (FASEB J. 28: 2455–2465. 2014), Geng et al. (Gene Therapy 21: 444-449. 2014), John et al. (Molecular Therapy 26: 2487-2495. 2018), Drolle et al. (Leukemia Research 39: 779–785. 2015), and Ede et al. (ACS Synth. Biol. 5: 395−404. 2016) as applied to claims 57 and 68 above, and further in view of Jonnalagadda et al. (Molecular Therapy 23: 757-768. 2015). This is a new rejection that is substantially similar to a previous rejection of record made in response to Applicant’s amendment to claim 57. Any aspect of Applicant’s traversal that has not been addressed above, is addressed below.
Although John teaches that their CAR comprises 4-1BB and CD3ξ intracellular domains, John does not teach wherein the spacer domain is an IgG4 hinge domain and the transmembrane domain is a CD28 transmembrane domain.
However, Jonnalagadda teaches CARs frequently incorporate a spacer/linker region based on the constant region of either IgG1 or IgG4 to connect extracellular ligand binding with intracellular signaling domains. They generated CD19-specific CARs (CD19-specific scFv-IgG4-CD28-zeta CAR) with IgG4-Fc spacers that had either been mutated at two sites (L235E; N297Q) within the CH2 region (CD19R(EQ)) or incorporated a CH2 deletion (CD19Rch2Δ). These mutations reduced binding to soluble FcγRs without altering the ability of the CAR to mediate antigen-specific lysis. Importantly, CD19R(EQ) and CD19Rch2Δ T cells exhibited improved persistence and more potent CD19-specific antilymphoma efficacy in NSG mice (abstract).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the hinge and transmembrane domains of John with the IgG4 hinge domain and CD28 transmembrane domain of Jonnalagadda to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to substitute with a reasonable expectation of success because Jonnalagadda teaches that these mutations reduced binding to soluble FcγRs without altering the ability of the CAR to mediate antigen-specific lysis. Importantly, the modified T cells exhibited improved persistence and more potent CD19-specific antilymphoma efficacy in NSG mice. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Response to Arguments
Applicant's arguments filed March 31, 2026, are acknowledged.
Applicant argues that Jonnalagadda cautions that IgG4-Fc spacers can engage Fcy receptors and correlate with impaired in vivo persistence, requiring specific spacer engineering (e.g., Fe mutations or CH2 deletion) to avoid these off-target FcyR interactions and to restore persistence and antitumor efficacy. See Jonnalagadda at Abstract and page 758. This teaching is inconsistent with any suggestion that one can simply swap spacer domains as a routine design choice without introducing new, persistence-limiting FcyR interactions (page 13, paragraph 4-page 15, paragraph 1).
Applicant's arguments have been fully considered but they are not persuasive.
As identified in Jonnalagadda, they already identified potential CD19-specific CARs with IgG4-Fc spacers that had either been mutated at two sites (L235E; N297Q) within the CH2 region (CD19R(EQ)) or incorporated a CH2 deletion (CD19Rch2Δ) that showed improved persistence and more potent CD19-specific antilymphoma efficacy in NSG mice (abstract). These mutations overcome the cited issue in Jonnalagadda and were identified as being possible spacers that could be used in the rejection. Therefore, Jonnalagadda is not considered to teach away from using these spacers in a CAR.
Claims 57-58, 65-66, 72, 74-76, and 81-82 are rejected under 35 U.S.C. 103 as being unpatentable over Griffiths et al. (Gene Therapy 7: 255-262. 2000), Willam et al. (Eur J Physiol 451: 534–543. 2006), Li et al. (ACS Nano 10: 6753−6761. 2016), Sotoodehnejadnematalahi et al. (PLoS One 10: 1-19. 2015), Wang et al. (Biochemical and Biophysical Research Communications 490: 480-485. 2017), Fujita et al. (FASEB J. 28: 2455–2465. 2014), and Moyes et al. (Human Gene Therapy 28: 200-215. 2016). This is a new rejection that is substantially similar to a previous rejection of record made in response to Applicant’s amendment to claim 57. Any aspect of Applicant’s traversal that has not been addressed above, is addressed below.
Regarding claim 57, Griffiths teaches that they transduced human macrophages with a hypoxia-regulated adenoviral vector with a gene encoding CYP2B6 under control of an HRE element. Gene expression is induced by hypoxia. Griffiths teaches that they cultured their modified macrophages with tumor spheroids and reduced the tumor size when incubated with cyclophosphamide (abstract, page 256, column 1, paragraphs 2-3, and page 257, column 1, paragraph 2-page 258, column 1, paragraph 1).
Griffiths does not teach wherein the first nucleic acid comprises a minimal thymidine kinase promoter is silent as to the type of HRE used in their adenovirus.
However, Willam teaches a nucleic acid construct 6HRE/PGK-TK-Luc luciferase comprising six repeats of the PGK hypoxia response element and a minimal thymidine kinase promoter (page 536, column 1, paragraph 2). Figure 3 shows that the 6HRE/PGK-TK-Luc has higher gene expression under pH 7.0 conditions than pH 7.4 conditions while EPO HREs with an SV40 promoter did not show the same significant increase in expression under acidic conditions.
Li teaches that the pH of blood is 7.4 and the pH of the tumor microenvironment is (6.5-7.0 Scheme 1).
Sotoodehnejadnematalahi teaches that hypoxic macrophages up-regulate a number of hypoxia-inducible transcription factors, the most important of which is Hypoxia-inducible factor 1 (HIF-1). PGK is highly upregulated by HIF-1α expression (page 2, paragraph 3 and Figure 5).
Wang teaches that PGK1 is almost exclusively a HIF-1 responsive gene. Wang teaches that while both HIF-1α and HIF-2α can mediate the cellular response to hypoxia, they differ in their responsiveness to other cellular signals and cell types in which they are expressed. HIF-2α expression and LOX are important in oncogenesis and especially the process of metastases. Several specific small-molecule inhibitors of HIF-2α have been described, and it is possible that these may be useful in the prevention or treatment of cancer metastases. A potential advantage of specific HIF-2 inhibitors is that they would not block the general response of cells to hypoxia mediated by HIF-1 (page 484, column 2, paragraph 1-page 485, column 1, paragraph 3).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have used the PGK hypoxia response element and a minimal thymidine kinase promoter of Willam to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to use this HRE and promoter combination with a reasonable expectation of success because Griffiths teaches that their modified macrophages can be used for reducing cancer cell growth and the tumor microenvironment is known to be associated with more acidic pH and hypoxia, as identified by Li and Griffiths (page 261, column 1, paragraph 2). Willam teaches that the combination of six repeats of the PGK hypoxia response element and a minimal thymidine kinase promoter showed improved gene expression under pH 7.0 hypoxic conditions compared to pH 7.4 hypoxic conditions while other HRE- promoter combinations (EPO HRE-SV40 promoter) did not. Furthermore, Sotoodehnejadnematalahi teaches that hypoxic macrophages up-regulate a number of hypoxia-inducible transcription factors, the most important of which is Hypoxia-inducible factor 1 (HIF-1). Sotoodehnejadnematalahi and Wang teach PGK is highly upregulated by HIF-1α expression. Wang teaches that small-molecule inhibitors of HIF-2α may be useful in the prevention or treatment of cancer metastases. Therefore, it would have been obvious to use the PGK HRE and thymidine kinase promoter of Willam as this construct would not prevent the use of the HIF-2α inhibitors for the treatment of cancer metastases in combination with modified macrophage cells. Furthermore, the PGK HRE and a minimal thymidine kinase promoter provides the potential for increased expression from the acidic tumor microenvironment as well, as it has already been shown in one cancer cell line. The tumor microenvironment has a more acidic pH (6.5-7.0) than the blood (7.4). This would help localize the expression of the transgene to the tumor microenvironment while limiting expression in non-target tissues and improve transgene expression within the tumor to improve the efficacy of the treatment. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
The teachings of Griffiths, Willam, Li, Sotoodehnejadnematalahi, and Wang are as discussed above.
Willam is silent as to the sequence of the PGK HRE.
However, Fujita teaches they cloned 3x Pgk1 HRE-Luc into a plasmid wherein the HRE sequence (Top row) is 100% identical to SEQ ID NO: 44 (Bottom row) of the instant application, as shown below (page 2456, column 2, paragraph 2):
1 TGTCACGTCCTGCACGACTCTAGT 24
||||||||||||||||||||||||
1 TGTCACGTCCTGCACGACTCTAGT 24
Fujita teaches that the Pgk1 HRE sequence was obtained from Addgene and was functional (page 2456, column 2, paragraph 2 and Figure 3).
As the Pgk1 HRE sequence is known within the art and was already cloned into a plasmid, it would have been obvious that one could choose this as the sequence for the Pgk HRE of Willam. Furthermore, the successful cloning and sequencing of the nucleic acid sequence encoding a known regulatory element is obvious, and thus unpatentable, if (1) there was some suggestion or motivation in the prior art to clone the DNA, and (2) there was a “reasonable expectation of success,” based on "detailed enabling methodology" in the prior art. Ex parte Kubin, 83 U.S.P.Q.2d (BNA) 1410 (B.P.A.I. 2007), aff'd, 561 F.3d 1351 (Fed. Cir. 2009). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
The combined teachings of Griffiths, Willam, Li, Sotoodehnejadnematalahi, Wang, and Fujita do not teach using a lentiviral particle comprising VPX for delivery of the polynucleotide compriding the HRE element.
However, Moyes teaches using genetically modified macrophages to treat tumors. Furthermore, Moyes teaches that lentiviruses are limited in their ability to infect macrophages due to the expression of SAMHD1. Through its phosphohydrolase activity, SAMHD1 decreases dexoxynucleotide triphosphate pools for reverse transcription. To relieve the SAMDH1-mediated resistance to HIV LV infection, the accessory lentiviral gene product protein X (Vpx) can be included as part of the packaged viral particle as it induces degradation of SAMHD1 in macrophages thereby alleviating the restriction block. Using an MOI of 15 as demonstrated in DCs and 100 lg/mL of protamine sulfate, it was observed that 20% of DCs and 60% of macrophages expressed lentivirally encoded GFP. However, the combination of high viral dose and a high concentration of protamine sulfate had a detrimental effect on macrophage viability, with >30% of cells examined staining positive for a dye that marks dead or dying cells. In contrast, when lentivirus was packaged with Vpx, an MOI of 1 was sufficient to infect nearly 100% of day 3 macrophages, without the negative impact on viability. Vpx achieves nearly 100% efficiency at 250 LP/cell, equating to 10 ng of p24, per 500,000 cells, 60 times less virus. This approach causes a higher number of genomic integration events than are observed in some engineered T cells used clinically. However, because the GEMs do not divide, as observed in the in vivo studies demonstrating a lack of GEM expansion, it is not anticipated that insertional mutagenesis will have an impact on the safety of a clinical product. This method of lentiviral modification of primary human macrophages may serve as a novel type of cellular immunotherapy, which can be generated in as little as 7 days from a patient’s blood, using a clinically approved lentiviral backbone (abstract and page 201, column 1, paragraph 1-page 214, column 1, paragraph 2).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the genetically modified macrophage of the combined teachings of Griffiths, Willam, Li, Sotoodehnejadnematalahi, Wang, and Fujita by using a lentiviral vector to deliver the transgene to the macrophage and by incorporating VPX into the lentiviral particle encoding the polynucleotide comprising the HRE element, as identified by Moyes, to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to modify with a reasonable expectation of success because Griffiths teaches that they are genetically modifying macrophages for treating tumors using adenoviruses while Moyes teaches that they are generating genetically modified macrophages for treating tumors using lentiviruses packages with Vpx. Moyes teaches that VPX significantly increases the transduction efficiency of the lentiviral particle in macrophages, increasing the rate of transduction to ~100% and increasing viability of the macrophages compared to not using Vpx. Vpx achieves nearly 100% efficiency at 250 LP/cell, equating to 10 ng of p24, per 500,000 cells, 60 times less virus. This approach causes a higher number of genomic integration events than are observed in some engineered T cells used clinically. Additionally, because the GEMs do not divide, it is not anticipated that insertional mutagenesis will have an impact on the safety of a clinical product. This method of lentiviral modification of primary human macrophages may serve as a novel type of cellular immunotherapy, which can be generated in as little as 7 days from a patient’s blood, using a clinically approved lentiviral backbone. Furthermore, adenoviruses are known to produce transient, episomal expression while lentiviruses achieve insertion for longer term expression. Therefore, it would have been obvious to use a lentiviral particle comprising VPX to deliver the HRE element into the macrophages as this would allow for insertion of the transgene into the cells for long term expression would improve the transduction efficiency and the efficacy of the treatment method as more macrophages would be transduced with less lentivirus for treating the cancer. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Regarding claim 58, although Griffiths performs their tests in vitro using tumor spheroids as a model, Griffiths teaches that their model is known to represent avascular (i.e. hypoxic) tumour microenvironments found in solid tumors (page 256, clumn 1, paragraph 5). As such, the construct of Griffiths is capable of inducing transcription in an in vivo hypoxic tumor microenvironment.
Regarding claims 65-66, Griffiths teaches that the HRE-CYP2B6 is comprised within an adenoviral vector (abstract).
Regarding claims 72 and 81, Griffiths teaches that they genetically modified macrophages (abstract).
Regarding claim 74, although Griffiths did not teach administering their genetically modified cells to a subject to treat cancer, they stated that their data indicate that macrophages can be used as silent carriers of a gene therapy until they infiltrate diseased tissue at which point they can respond to the hypoxic microenvironment and activate the expression of a therapeutic gene. In this way a gene therapy can be delivered specifically to large areas of diseased tissue with the potential to treat a range of diseases including disseminated cancers (page 261, column 1, paragraph 2).
As such, although Griffiths does not directly teach administering their genetically modified cells to a patient with cancer, Griffiths clearly contemplates this as the next logical step based on their research. They also directly contemplate that their cells would improve gene therapy methods in patients by localizing the gene delivery to the diseased tissue(s). As such, it would have been obvious that one of ordinary skill in the art could administer the macrophages of Griffiths to target breast cancer as Griffiths macrophages reduced the number of T47D breast cancer cell line spheroids in vitro (page 256, column 1, paragraph 5 and page 261, column 2, paragraph 5-page 262, column 1, paragraph 2).
Regarding claim 75, breast cancer is a solid tumor.
Regarding claim 76, Moyes teaches using their genetically modified macrophages to target glioblastoma (whole document).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the method of infiltrating tumors with genetically modified macrophages wherein gene expression is induced in the hypoxic tumor microenvironment of Griffiths with the method of treating glioblastoma using macrophages of Moyes to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to combine with a reasonable expectation of success because Griffiths and Moyes are both interested in ensuring that their therapeutic is specifically expressed in the tumor microenvironment to reduce off-target effects and they both use macrophages to target the tumors. Griffith specifically identifies their method as being good for gene therapy to specifically deliver the therapeutic gene to large areas of cancerous tissue where it can respond to the hypoxic microenvironment and activate the expression of a therapeutic gene. In a similar manner, Moyes is focused on using macrophages as a cellular delivery vehicle that can express a multitude of factors that can overturn an immunosuppressive tumor microenvironment and support existing or novel immunotherapies (page 201, column 1, paragraphs 1-2). As such, it would have been obvious that to one of ordinary skill in the art that they could have used the combined method of Griffiths and Moyes to target glioblastoma. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Regarding claim 82, Griffiths teaches that the macrophages are derived from human primary monocytes (page 261, column 1, paragraph 3-page 262, column 1, paragraph 2).
Response to Arguments
Applicant's arguments filed March 31, 2026, are acknowledged.
Applicant argues that the Office action relies of impermissible hindsight reconstruction. The cited references do not provide a reliable motivation or reasonable expectation that Willam's PGK-HRE/miniTK cassette would function in macrophages in vivo as asserted, much less provide a predictable improvement in an acidic tumor microenvironment. Li merely provides a general statement that tumor microenvironments can be mildly acidic relative to blood pH, but does not teach any transcriptional regulatory module, any PGK-HRE/miniTK design, or any reason to expect a particular hypoxiaresponsive promoter system to operate in engineered macrophages in vivo. Griffiths itself is silent regarding PGK HREs and minimal TK promoters in macrophages and instead employs a hypoxia-regulated adenoviral vector system. See Griffiths at Abstract and pages 256-258. Finally, Fujita's disclosure of a 24-bp Pgkl HRE sequence appears in the context of reporter plasmids used in nucleus pulposus and disc biology, and Fujita does not supply any teaching that the sequence would be suitable or advantageous in macrophages in vivo, particularly under the specific tumor-macrophage setting contemplated by Griffiths. Fujita is also directed to a materially different construct architecture, namely a Pgkl-3xHRELuc reporter plasmid, rather than a therapeutic immune-cell vector, and Fujita does not disclose the minimal thymidine kinase promoter configuration relied upon by the Office Action. Thus, even if Fujita is considered evidence that the 24 bp Pgkl HRE sequence was known (see Office Action at item 17), it does not teach that this sequence was known to be interchangeable with the regulatory system used in Griffiths, or that it could be predictably combined with Willam's miniTK-based reporter configuration and applied in primary macrophages in vivo without altering regulatory behavior. Accordingly, the cited art does not articulate why a person of ordinary skill would have selected Willam's PGK-HRE/miniTK system to replace Griffiths' hypoxia control in macrophages, nor why one would reasonably expect success in macrophages in vivo under acidic tumor microenvironment conditions. Instead, the rejection relies on hindsight reconstruction by stitching together cell-line-specific reporter observations, generalized tumor pH statements, and general hypoxia and macrophage biology, to retrofit a particular regulatory cassette into a distinct macrophage gene therapy system, without a predictive teaching that the substituted cassette would operate as alleged in macrophages in vivo. Absent evidence that PGK-HRE/TK would predictably regulate transgenes in macrophages, or that acidity would enhance such regulation in macrophages, the combination relies on hindsight and "obvious to try" across an unpredictable art. That rationale is flawed because none of the references shows that a PGK HRE + miniTK architecture using the SEQ ID NO:44 motif would function in primary immune cells in vivo, and William itself reports cell-type-dependent and inconsistent pH effects that undercut a reasonable expectation of success for transplanting that promoter/HRE module across cell types (page 14, paragraph 2-page 18, paragraph 2).
Applicant's arguments have been fully considered but they are not persuasive.
In response to Applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971).
As stated supra, it would have been obvious to have used the PGK hypoxia response element and a minimal thymidine kinase promoter of Willam to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to use this HRE and promoter combination because Griffiths teaches that their modified macrophages can be used for reducing cancer cell growth and the tumor microenvironment is known to be associated with more acidic pH and hypoxia, as identified by Li and Griffiths (page 261, column 1, paragraph 2). Willam teaches that the combination of six repeats of the PGK hypoxia response element and a minimal thymidine kinase promoter showed improved gene expression under pH 7.0 hypoxic conditions compared to pH 7.4 hypoxic conditions while other HRE- promoter combinations (EPO HRE-SV40 promoter) did not. Furthermore, Sotoodehnejadnematalahi teaches that hypoxic macrophages up-regulate a number of hypoxia-inducible transcription factors, the most important of which is Hypoxia-inducible factor 1 (HIF-1). Sotoodehnejadnematalahi and Wang teach PGK is highly upregulated by HIF-1α expression. Wang specifically teaches that small-molecule inhibitors of HIF-2α may be useful in the prevention or treatment of cancer metastases. Therefore, it would have been obvious to use the PGK HRE and thymidine kinase promoter of Willam as this construct would not prevent the use of the HIF-2α inhibitors for the treatment of cancer metastases in combination with modified macrophage cells. Furthermore, it has already been shown that PGK HRE and a minimal thymidine kinase promoter provides the potential for increased expression from the acidic tumor microenvironment as well, as it has already been shown in one cancer cell line. The tumor microenvironment has a more acidic pH (6.5-7.0) than the blood (7.4). This would help further localize the expression of the transgene to the tumor microenvironment while limiting expression in non-target tissues and improve transgene expression within the tumor to improve the efficacy of the treatment. As such, it would have been reasonable to use the PGK HRE and thymidine kinase promoter of Willam to maintain the possibility of increased expression in the tumor microenvironment.
Therefore, the teachings of Wang alone provide motivation for using the PGK HRE elements as Wang specifically identifies that the PGK HRE element allows for co-administration of additional anti-cancer therapeutics targeting HIF-2α. It is well understood that co-administration of additional anti-cancer agents may improve the efficacy of the anti-cancer treatment. Therefore, it would have been obvious to use the PGK HRE elements to maintain the option of using additional anti-cancer agents that target HIF-2α to increase the efficacy of the anti-cancer treatments.
Furthermore, regarding Applicant’s arguments against the teachings of Willam specifically, it is worth pointing out that although there may be inconsistent results regarding the increased expression under acidic conditions of their PGK HRE elements, Willam identifies that even if no increased expression occurs under more acidic conditions, expression does not decrease in response to a change in pH (Figures 1 and 3). Therefore, Willam shows that the PGK HRE elements can lead to an increase in expression that would be beneficial in treating cancer or no change in expression under hypoxic conditions which would not negatively impact the treatment of cancer. As such, one would weigh the potential benefits of increased expression against the fact that there are no reductions in expression in cells where it doesn’t increase expression under more acidic conditions and come to the conclusion that the potential benefit of increased expression is worth using the PGK HRE elements.
Moreover, absolute predictability is not a necessary prerequisite to a case of obviousness. Rather, a degree of predictability that one of ordinary skill would have found to be reasonable is sufficient. The Federal Circuit concluded that “[g]ood science and useful contributions do not necessarily result in patentability.” Id. at 1364, 83 USPQ2d at 1304.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEENAN A BATES whose telephone number is (571)270-0727. The examiner can normally be reached M-F 7:30-5:00.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Doug Schultz can be reached on (571) 272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEENAN A BATES/Examiner, Art Unit 1631
/JAMES D SCHULTZ/Supervisory Patent Examiner, Art Unit 1631
Prosecution Insights