Prosecution Insights
Last updated: April 19, 2026
Application No. 17/424,140

MICROENVIRONMENT SENSORS TO REGULATE ENGINEERED GENE EXPRESSION

Non-Final OA §102§103
Filed
Jul 19, 2021
Examiner
BATES, KEENAN ALEXANDER
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Seattle Children'S Hospital (Dba Seattle Children'S Research Institute)
OA Round
3 (Non-Final)
46%
Grant Probability
Moderate
3-4
OA Rounds
3y 3m
To Grant
99%
With Interview

Examiner Intelligence

Grants 46% of resolved cases
46%
Career Allow Rate
25 granted / 54 resolved
-13.7% vs TC avg
Strong +71% interview lift
Without
With
+70.8%
Interview Lift
resolved cases with interview
Typical timeline
3y 3m
Avg Prosecution
88 currently pending
Career history
142
Total Applications
across all art units

Statute-Specific Performance

§101
6.3%
-33.7% vs TC avg
§103
31.9%
-8.1% vs TC avg
§102
24.3%
-15.7% vs TC avg
§112
28.3%
-11.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 54 resolved cases

Office Action

§102 §103
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on August 8, 2025, has been entered. Election/Restrictions Applicant’s election of species in the reply filed on October 17, 2024, is acknowledged. Applicant elected the following species: An HRE as the alternative regulatory element An interleukin as the alternative therapeutic payload A LILRB receptor as the alternative extracellular binding domain An IgG4 hinge domain as the spacer domain A CD28 transmembrane domain as the alternative transmembrane domain CD3ξ and 4-1BB domains as the alternative intracellular signaling domain Glioblastoma as the alternative cancer Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). DETAILED ACTION The amended claims filed on August 8, 2025, have been acknowledged. Claims 1-56, 59-62, 67, 71, 77, and 79 were cancelled. Claim 57 was amended. Claims 57-58, 63-66, 68-70, 72-76, 78, and 80-82 are pending and examined on the merits. Priority The applicant claims domestic priority from U.S. provisional application No. 62/800,049, filed on February 1, 2019. Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Claims 57-58, 63-66, 68-70, 72-76, 78, and 80-82 receive domestic benefit from U.S. provisional application No. 62/800,049, filed on February 1, 2019. Withdrawn Claim Rejections - 35 USC § 102 The prior rejection of claims 57-58, 63-66, 73-75, and 78 under 35 U.S.C. 102(a)(1) as being anticipated by Kim et al. (Molecular Therapy 16: 599-606. 2008) is withdrawn in light of Applicant’s amendments to claim 57 to recite that the genetically modified cell comprises an HRE with a nucleotide sequence having 90% sequence identity to SEQ ID NO: 44. The prior rejection of claims 57-58, 65-66, 72, and 81-82 under 35 U.S.C. 102(a)(1) as being anticipated by Griffiths et al. (Gene Therapy 7: 255-262. 2000) is withdrawn in light of Applicant’s amendments to claim 57 to recite that the genetically modified cell comprises an HRE with a nucleotide sequence having 90% sequence identity to SEQ ID NO: 44. Withdrawn Claim Rejections - 35 USC § 103 The prior rejection of claims 57 and 77 under 35 U.S.C. 103 as being unpatentable over Kim et al. (Molecular Therapy 16: 599-606. 2008) as applied to claim 57 above, and further in view of William et al. (Eur J Physiol 451: 534–543. 2006) and Li et al. (ACS Nano 10: 6753−6761. 2016) is withdrawn in light of Applicant’s amendments to claim 57 to recite that the genetically modified cell comprises an HRE with a nucleotide sequence having 90% sequence identity to SEQ ID NO: 44. The prior rejection of claims 57, 77, and 79-80 under 35 U.S.C. 103 as being unpatentable over Kim et al. (Molecular Therapy 16: 599-606. 2008), William et al. (Eur J Physiol 451: 534–543. 2006), and Li et al. (ACS Nano 10: 6753−6761. 2016) as applied to claims 57 and 77 above, and further in view of Fujita et al. (FASEB J. 28: 2455–2465. 2014) is withdrawn in light of Applicant’s amendments to claim 57 to recite that the genetically modified cell comprises an HRE with a nucleotide sequence having 90% sequence identity to SEQ ID NO: 44. The prior rejection of claims 57 and 74-75 under 35 U.S.C. 103 as being unpatentable over Griffiths et al. (Gene Therapy 7: 255-262. 2000) as applied to claim 57 above is withdrawn in light of Applicant’s amendments to claim 57 to recite that the genetically modified cell comprises an HRE with a nucleotide sequence having 90% sequence identity to SEQ ID NO: 44. The prior rejection of claims 57, 74, and 76 under 35 U.S.C. 103 as being unpatentable over Griffiths et al. (Gene Therapy 7: 255-262. 2000) as applied to claims 57 and 74 above, and further in view of Christie et al. (Proceedings Volume 9305, Optical Techniques in Neurosurgery, Neurophotonics, and Optogenetics II; Macrophage mediated PCI enhanced gene-directed enzyme prodrug therapy. 93050C. 2015) is withdrawn in light of Applicant’s amendments to claim 57 to recite that the genetically modified cell comprises an HRE with a nucleotide sequence having 90% sequence identity to SEQ ID NO: 44. The prior rejection of claims 57-58, 65-66, 68-69, and 73-74 under 35 U.S.C. 103 as being unpatentable over John et al. (Molecular Therapy 26: 2487-2495. 2018) as applied to claims 57 and 68 above, and further in view of Ede et al. (ACS Synth. Biol. 5: 395−404. 2016) and Drolle et al. (Leukemia Research 39: 779–785. 2015) is withdrawn in light of Applicant’s amendments to claim 57 to recite that the genetically modified cell comprises an HRE with a nucleotide sequence having 90% sequence identity to SEQ ID NO: 44. The prior rejection of claims 57, 68, and 70 under 35 U.S.C. 103 as being unpatentable over John et al. (Molecular Therapy 26: 2487-2495. 2018), Ede et al. (ACS Synth. Biol. 5: 395−404. 2016), and Drolle et al. (Leukemia Research 39: 779–785. 2015) as applied to claims 57 and 68 above, and further in view of Jonnalagadda et al. (Molecular Therapy 23: 757-768. 2015) is withdrawn in light of Applicant’s amendments to claim 57 to recite that the genetically modified cell comprises an HRE with a nucleotide sequence having 90% sequence identity to SEQ ID NO: 44. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 57-58, 63-66, 73-75, 78, and 80 are rejected under 35 U.S.C. 103 as being unpatentable over Kim et al. (Molecular Therapy 16: 599-606. 2008), William et al. (Eur J Physiol 451: 534–543. 2006), Li et al. (ACS Nano 10: 6753−6761. 2016), Clambey et al. (PNAS 109: E2784-E2793. 2012), Wang et al. (Biochemical and Biophysical Research Communications 490: 480-485. 2017), and Fujita et al. (FASEB J. 28: 2455–2465. 2014). Regarding claims 57 and 80, Kim teaches a genetically modified T cell comprising a lentiviral vector encoding a bidirectional vascular endothelial growth factor (VEGF) hypoxia-inducible responsive element (HRE), which drives the hIL-2 gene and a marker gene (renilla luciferase). Hypoxia induces transgene expression of the luciferase and hIL-2 in vitro and in vivo. Kim teaches that they administered their modified T cells to tumor bearing mice and found that they caused complete and rapid tumor eradication and prolong survival in the mice. Kim teaches that hypoxia occurs in many tumors and reduces the effectiveness of radio- and chemotherapy. Hypoxia also impedes immune responses to tumors, reducing T lymphocyte production of cytokines such as interleukin-2 (IL-2) and interferon gamma, as well as the survival and proliferation of these cells (Abstract, page 605, column 1, paragraph 4, and Figures 2-3 and 5-6). Kim does not teach wherein the first nucleic acid comprises a minimal thymidine kinase promoter nor an HRE with a nucleotide sequence having 90% sequence identity to SEQ ID NO: 44. However, William teaches a nucleic acid construct 6HRE/PGK-TK-Luc luciferase comprising six repeats of the PGK hypoxia response element and a minimal thymidine kinase promoter (page 536, column 1, paragraph 2). Figure 3 shows that the 6HRE/PGK-TK-Luc has higher gene expression under pH 7.0 conditions than pH 7.4 conditions while EPO HREs with an SV40 promoter did not show the same significant increase in expression under acidic conditions. Li teaches that the pH of blood is 7.4 and the pH of the tumor microenvironment is (6.5-7.0 Scheme 1). Clambey teaches that mouse and human T cells increase expression of HIF1α and PGK under hypoxic conditions (Figures 1 and 2). Wang teaches that VEGF is activated by HIF2 and to lesser extent by HIF-1 and inhibited by CFNOA, while PGK1 is almost exclusively a HIF-1 responsive gene. Wang teaches that while both HIF-1α and HIF-2α can mediate the cellular response to hypoxia, they differ in their responsiveness to other cellular signals and cell types in which they are expressed. HIF-2α expression and LOX are important in oncogenesis and especially the process of metastases. Several specific small-molecule inhibitors of HIF-2α have been described, and it is possible that these may be useful in the prevention or treatment of cancer metastases. A potential advantage of specific HIF-2 inhibitors is that they would not block the general response of cells to hypoxia mediated by HIF-1 (page 484, column 2, paragraph 1-page 485, column 1, paragraph 3) It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the VEGF HREs and CMV promoter with the six repeats of the PGK hypoxia response element and a minimal thymidine kinase promoter of William to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to substitute with a reasonable expectation of success because Kim teaches that their modified T cells can be used for treating cancer and the tumor microenvironment is known to be associated with more acidic pH and hypoxia, as identified by Li and Kim. William teaches that the combination of six repeats of the PGK hypoxia response element and a minimal thymidine kinase promoter showed improved gene expression under pH 7.0 hypoxic conditions compared to pH 7.4 hypoxic conditions while other HRE- promoter combinations (EPO HRE-SV40 promoter) did not. Furthermore, Clambey teaches that T cells increase expression of HIF1α and PGK under hypoxic conditions and Wang teaches that VEGF is activated by HIF2 and to lesser extent by HIF-1 and inhibited by CFNOA, while PGK1 is almost exclusively a HIF-1 responsive gene and that small-molecule inhibitors of HIF-2α may be useful in the prevention or treatment of cancer metastases. Therefore, it would have been obvious to substitute the VEGF HRE elements of Kim with the PGK HRE and thymidine kinase promoter of William as the VEGF would prevent the use of the HIF-2α inhibitors for the treatment of cancer metastases in combination with modified T cells. Furthermore, it has already been shown that PGK HREs are active in T cells and undergo induced expression during hypoxic conditions and the PGK HRE and a minimal thymidine kinase promoter provides the potential for increased expression from the acidic tumor microenvironment as well, as it has already been shown in one cancer cell line. The tumor microenvironment has a more acidic pH (6.5-7.0) than the blood (7.4). This would help localize the expression of the transgene to the tumor microenvironment while limiting expression in non-target tissues and improve transgene expression within the tumor to improve the efficacy of the treatment. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. The teachings of Kim, William, Li, Clambey, and Wang are as discussed above. William is silent as to the sequence of the PGK HRE. However, Fujita teaches they cloned 3x Pgk1 HRE-Luc into a plasmid wherein the HRE sequence (Top row) is 100% identical to SEQ ID NO: 44 (Bottom row) of the instant application, as shown below (page 2456, column 2, paragraph 2): 1 TGTCACGTCCTGCACGACTCTAGT 24 |||||||||||||||||||||||| 1 TGTCACGTCCTGCACGACTCTAGT 24 Fujita teaches that the Pgk1 HRE sequence was obtained from Addgene and was functional (page 2456, column 2, paragraph 2 and Figure 3). As the Pgk1 HRE sequence is known within the art and was already cloned into a plasmid, it would have been obvious that one could choose this as the sequence for the Pgk HRE of William. Furthermore, the successful cloning and sequencing of the nucleic acid sequence encoding a known regulatory element is obvious, and thus unpatentable, if (1) there was some suggestion or motivation in the prior art to clone the DNA, and (2) there was a “reasonable expectation of success,” based on "detailed enabling methodology" in the prior art. Ex parte Kubin, 83 U.S.P.Q.2d (BNA) 1410 (B.P.A.I. 2007), aff'd, 561 F.3d 1351 (Fed. Cir. 2009). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Regarding claim 58, Kim teaches that they implanted EBV-LCL tumor cells in Matrigel subcutaneously into the flanks of irradiated severe combined immunodeficient mice and allowed the tumors to grow. Kim administered the HRE-IL-2 CTLs to tumor bearing mice and found that the HRE-IL-2 CTLs were present in the hypoxic region of the tumors, where they produced IL-2. Regarding claim 63, Kim teaches that the transgene is IL-2 (a cytokine) (Figure 2). Regarding claim 64, Figure 2 of Kim teaches that the HREs are linked to CMV promoters (a constitutive promoter). As Kim teaches that they used a bidirectional lentiviral vector comprising two CMV, promoters driving the renilla luciferase gene and the hIL-2 gene, the thymidine kinase promoter could replace the promoter for the hIL-2 gene for the potential additional increase in gene expression from the acidic tumor microenvironment while maintaining the CMV promoter for the renilla luciferase gene as this is a reporter gene and not a therapeutic gene. Regarding claims 65-66, Kim teaches that the polynucleotide is comprised within a lentiviral vector (Figure 2). Regarding claim 73, Kim teaches that the genetically modified cell is a T cell (abstract). Regarding claims 74-75, Kim, as stated supra, teaches that they administered the HRE-IL-2 CTLs to solid tumor bearing mice and found that the HRE-IL-2 CTLs promotes complete and rapid tumor eradication and prolonged survival (Figure 6 and page 602, column 1, paragraph 2-column 2, paragraph 1). Regarding claim 78, Kim teaches that the lentiviral vector construct comprises five HREs (Figure 2), William teaches that their construct comprises six HREs (page 536, column 1, paragraph 2), and Fujita teaches that their construct comprises three HREs (page 2456, column 2, paragraph 2). Response to Arguments Applicant's arguments filed April 29, 2024 are acknowledged. First, Applicant argues that William provides no reason to substitute the VEGF/HRE-pCMV of Kim with the PGK/HRE-pTk of William as William shows increased expression in HeLa cells but not Hep3B cells under hypoxic pH 7.0 conditions compared to pH 7.4 hypoxic conditions. Thus, William provides no reason to select the PGK/HRE-pTk combination of HRE and promoter over any other combination of HRE and promoter (page 7, paragraph 2). Applicant's arguments have been fully considered but they are not persuasive. As an initial matter, the prior rejection over Kim, William, and Li has been withdrawn and a new rejection has been made. Regarding the lack of a reason to substitute, as stated supra, it would have been obvious to substitute the VEGF HRE elements of Kim with the PGK HRE and thymidine kinase promoter of William as the VEGF would prevent the use of the HIF-2α inhibitors for the treatment of cancer metastases in combination with modified T cells. Furthermore, it has already been shown that PGK HREs are active in T cells and undergo induced expression during hypoxic conditions and the PGK HRE and a minimal thymidine kinase promoter provides the potential for increased expression from the acidic tumor microenvironment as well, as it has already been shown in one cancer cell line. The tumor microenvironment has a more acidic pH (6.5-7.0) than the blood (7.4). This would help further localize the expression of the transgene to the tumor microenvironment while limiting expression in non-target tissues and improve transgene expression within the tumor to improve the efficacy of the treatment. As such, it would have been reasonable to substitute the VEGF HRE elements of Kim with the PGK HRE and thymidine kinase promoter of William. Second, Applicant argues that the claimed cells include activities not readily predicted from the cited references. Example 4 discloses a working example in which macrophages were transduced with reporter constructs including HREs and a minimal thymidine kinase (TK) promoter. See e.g., figure 1. Levels of expression from the construct containing HREs and a minimal TK promoter rapidly decreased by day 3 to levels substantially the same as control cells which had not been subjected to hypoxic conditions. The rapid decrease in transgene expression in the absence of hypoxic conditions would limit transgene expression to the tumor environment and improve efficacy of therapy. Applicant submits that Kim, William and Li, alone or in combination do not teach such activities (page 7, paragraph 3). Applicant's arguments have been fully considered but they are not persuasive. Although Applicant argues unexpected results, the claims are not commensurate in scope with the experimental results cited by the Applicant. MPEP 716.02(d) discloses that whether the unexpected results are the result of unexpectedly improved results or a property not taught by the prior art, the "objective evidence of nonobviousness must be commensurate in scope with the claims which the evidence is offered to support." In other words, the showing of unexpected results must be reviewed to see if the results occur over the entire claimed range. In re Clemens, 622 F.2d 1029, 1036, 206 USPQ 289, 296 (CCPA 1980) (Claims were directed to a process for removing corrosion at "elevated temperatures" using a certain ion exchange resin (with the exception of claim 8 which recited a temperature in excess of 100°C). Appellant demonstrated unexpected results via comparative tests with the prior art ion exchange resin at 110°C and 130°C. The court affirmed the rejection of claims 1-7 and 9-10 because the term "elevated temperatures" encompassed temperatures as low as 60°C where the prior art ion exchange resin was known to perform well. The rejection of claim 8, directed to a temperature in excess of 100°C, was reversed.). See also In re Peterson, 315 F.3d 1325, 1329-31, 65 USPQ2d 1379, 1382-85 (Fed. Cir. 2003) (data showing improved alloy strength with the addition of 2% rhenium did not evidence unexpected results for the entire claimed range of about 1-3% rhenium); In re Grasselli, 713 F.2d 731, 741, 218 USPQ 769, 777 (Fed. Cir. 1983) (Claims were directed to certain catalysts containing an alkali metal. Evidence presented to rebut an obviousness rejection compared catalysts containing sodium with the prior art. The court held this evidence insufficient to rebut the prima facie case because experiments limited to sodium were not commensurate in scope with the claims.). Regarding the claims at issue in the instant application, claim 57 encompasses any immune cell and not just macrophages as used in Example 4 and Applicant’s arguments. Furthermore, Applicant uses a specific HRE sequence while claim 57 encompasses many more possible sequences. As such, the claims as written are not commensurate in scope with alleged unexpected results. Additionally, it is not clear that these results would be unexpected as Kim (Figure 3) and William (Figure 3) show limited to no expression of their transgenes under normoxic conditions, suggesting that switching the cells to normoxic conditions after hypoxic conditions would also result in a drop in promoter activation and transgene expression levels back to normoxic levels. Thus, it is not surprising that the transgene expression returned to baseline 3 days after returning to normoxic conditions. Furthermore, the benefit of limiting transgene expression to the tumor environment identified by the Applicant was directly identified by Kim (abstract and Introduction). Claims 57-58, 65-66, 68-69, and 73-74 are rejected under 35 U.S.C. 103 as being unpatentable over Kim et al. (Molecular Therapy 16: 599-606. 2008), William et al. (Eur J Physiol 451: 534–543. 2006), Li et al. (ACS Nano 10: 6753−6761. 2016), Clambey et al. (PNAS 109: E2784-E2793. 2012), Wang et al. (Biochemical and Biophysical Research Communications 490: 480-485. 2017), and Fujita et al. (FASEB J. 28: 2455–2465. 2014) as applied to claim 57 above, and further in view of John et al. (Molecular Therapy 26: 2487-2495. 2018), Drolle et al. (Leukemia Research 39: 779–785. 2015), and Ede et al. (ACS Synth. Biol. 5: 395−404. 2016). The teachings of Kim, William, Li, Clambey, Wang, and Fujita are as discussed above. Kim teaches that although they examined their construct in EBV-associated lymphoma, the same approach may be applicable to T cell therapies for other malignancies (page 605, column 1, paragraph 1). The combined teachings of Kim, William, Li, Clambey, Wang, and Fujita do not teach wherein the genetically modified cell further comprises a CAR. Regarding claim 57, John teaches that they generated a novel anti-LILRB4 CAR-T cell that displays high antigen affinity and specificity. These CAR-T cells display efficient effector function in vitro and in vivo against LILRB4+ AML cells. Furthermore, they demonstrate anti-LILRB4 CAR-T cells are not toxic to normal CD34+ umbilical cord blood cells in colony-forming unit assays, nor in a humanized hematopoietic-reconstituted mouse model. Their data demonstrate that anti-LILRB4 CAR-T cells specifically target monocytic AML cells with no toxicity to normal hematopoietic progenitors, thus offering a new treatment strategy to improve outcomes for monocytic AML, with the potential for elimination of leukemic disease while minimizing the risk for on-target off-tumor toxicity (abstract). Anti-LILRB4 CAR-T cells demonstrated significantly increased effector cytokine release of both IFN-γ and TNF-α when activated by MV4-11 AML cells, compared with control T cells (Figure 3C) (page 2490, column 1, paragraph 1 and Figure 3C). John teaches that the CAR construct comprises a CD8a leader, humanized anti-LILRB4 scFv, CD8α hinge and transmembrane domain, intracellular 41BB co-stimulatory domain, and intracellular CD3ζ activation domain. Drolle teaches that acute myeloid leukemia cells are in a hypoxic environment in the bone marrow with approximately 6% O2 (page 784, column 1, paragraph 1). Ede teaches that they constructed a hypoxia-inducible chimeric antigen receptor (CAR) expression system to restrict antigen-responsive T-cell activation to hypoxic environments (page 400, column 1, paragraph 1-column 2, paragraph 1 and Figure 7). By placing CAR expression under the control of YB_TATA coupled to hypoxia-responsive elements, they successfully engineered human Jurkat T cells to respond to antigen stimulation only when the antigen is present in a hypoxic environment. Such a conditional T-cell activation system could increase the specificity of adoptive T-cell therapy against tumors, which are frequently characterized by hypoxic growth (page 400, column 2, paragraph 5). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the modified T cell of Kim, William, Li, Clambey, Wang, and Fujita with a LILRB CAR T-cell with the HREx4 YB_TATA hypoxia-responsive regulator of CAR expression to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to combine with a reasonable expectation of success because Kim, Wang, John, and Ede are both interested in improving the efficacy of treating cancer while minimizing off-target effects and John and Ede teach that their LILRB CAR and HREx4 YB_TATA hypoxia-responsive regulator of CAR expression, respectively, increases the specificity of adoptive T-cell therapy against tumors. Furthermore, Drolle teaches that the bone marrow is a hypoxic environment in acute myeloid leukemia. As such, it would have been obvious to combine the modified T cell of Kim, William, Li, Clambey, Wang, and Fujita with a LILRB CAR T-cell with the HREx4 YB_TATA hypoxia-responsive regulator of CAR expression to increase the specificity of adoptive T-cell therapy against cancerous malignancies. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Regarding claim 68, as stated supra, John teaches that the CAR construct comprises a humanized anti-LILRB4 scFv (extracellular binding domain), CD8a hinge (considered a spacer domain) and transmembrane domain (a transmembrane domain), intracellular 41BB co-stimulatory domain (intracellular signaling domain), and intracellular CD3ξ activation domain (intracellular signaling domain) (Figure 1). Regarding claim 69, as stated supra, John teaches that the extracellular signaling domain is an LILRB4 antigen (i.e. derived from an LILRB receptor) (Figure 1). Response to Arguments Applicant's arguments filed October 15, 2024, are acknowledged and have been addressed supra. Claims 57, 68, and 70 are rejected under 35 U.S.C. 103 as being unpatentable over Kim et al. (Molecular Therapy 16: 599-606. 2008), William et al. (Eur J Physiol 451: 534–543. 2006), Li et al. (ACS Nano 10: 6753−6761. 2016), Clambey et al. (PNAS 109: E2784-E2793. 2012), Wang et al. (Biochemical and Biophysical Research Communications 490: 480-485. 2017), Fujita et al. (FASEB J. 28: 2455–2465. 2014), John et al. (Molecular Therapy 26: 2487-2495. 2018), Drolle et al. (Leukemia Research 39: 779–785. 2015), and Ede et al. (ACS Synth. Biol. 5: 395−404. 2016) as applied to claims 57 and 68 above, and further in view of Jonnalagadda et al. (Molecular Therapy 23: 757-768. 2015). Although John teaches that their CAR comprises 4-1BB and CD3ξ intracellular domains, John does not teach wherein the spacer domain is an IgG4 hinge domain and the transmembrane domain is a CD28 transmembrane domain. However, Jonnalagadda teaches CARs frequently incorporate a spacer/linker region based on the constant region of either IgG1 or IgG4 to connect extracellular ligand binding with intracellular signaling domains. They generated CD19-specific CARs (CD19-specific scFv-IgG4-CD28-zeta CAR) with IgG4-Fc spacers that had either been mutated at two sites (L235E; N297Q) within the CH2 region (CD19R(EQ)) or incorporated a CH2 deletion (CD19Rch2Δ). These mutations reduced binding to soluble FcγRs without altering the ability of the CAR to mediate antigen-specific lysis. Importantly, CD19R(EQ) and CD19Rch2Δ T cells exhibited improved persistence and more potent CD19-specific antilymphoma efficacy in NSG mice (abstract). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the hinge and transmembrane domains of John with the IgG4 hinge domain and CD28 transmembrane domain of Jonnalagadda to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to substitute with a reasonable expectation of success because Jonnalagadda teaches that these mutations reduced binding to soluble FcγRs without altering the ability of the CAR to mediate antigen-specific lysis. Importantly, the modified T cells exhibited improved persistence and more potent CD19-specific antilymphoma efficacy in NSG mice. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Response to Arguments Applicant's arguments filed October 15, 2024, are acknowledged and have been addressed supra. Claims 57-58, 65-66, 72, 74-75, and 81-82 are rejected under 35 U.S.C. 103 as being unpatentable over Griffiths et al. (Gene Therapy 7: 255-262. 2000), William et al. (Eur J Physiol 451: 534–543. 2006), Li et al. (ACS Nano 10: 6753−6761. 2016), Sotoodehnejadnematalahi et al. (PLoS One 10: 1-19. 2015), Wang et al. (Biochemical and Biophysical Research Communications 490: 480-485. 2017), and Fujita et al. (FASEB J. 28: 2455–2465. 2014). Regarding claim 57, Griffiths teaches that they transduced human macrophages with a hypoxia-regulated adenoviral vector with a gene encoding CYP2B6 under control of an HRE element. Gene expression is induced by hypoxia. Griffiths teaches that they cultured their modified macrophages with tumor spheroids and reduced the tumor size when incubated with cyclophosphamide (abstract, page 256, column 1, paragraphs 2-3, and page 257, column 1, paragraph 2-page 258, column 1, paragraph 1). Griffiths does not teach wherein the first nucleic acid comprises a minimal thymidine kinase promoter is silent as to the type of HRE used in their adenovirus. However, William teaches a nucleic acid construct 6HRE/PGK-TK-Luc luciferase comprising six repeats of the PGK hypoxia response element and a minimal thymidine kinase promoter (page 536, column 1, paragraph 2). Figure 3 shows that the 6HRE/PGK-TK-Luc has higher gene expression under pH 7.0 conditions than pH 7.4 conditions while EPO HREs with an SV40 promoter did not show the same significant increase in expression under acidic conditions. Li teaches that the pH of blood is 7.4 and the pH of the tumor microenvironment is (6.5-7.0 Scheme 1). Sotoodehnejadnematalahi teaches that hypoxic macrophages up-regulate a number of hypoxia-inducible transcription factors, the most important of which is Hypoxia-inducible factor 1 (HIF-1). PGK is highly upregulated by HIF-1α expression (page 2, paragraph 3 and Figure 5). Wang teaches that PGK1 is almost exclusively a HIF-1 responsive gene. Wang teaches that while both HIF-1α and HIF-2α can mediate the cellular response to hypoxia, they differ in their responsiveness to other cellular signals and cell types in which they are expressed. HIF-2α expression and LOX are important in oncogenesis and especially the process of metastases. Several specific small-molecule inhibitors of HIF-2α have been described, and it is possible that these may be useful in the prevention or treatment of cancer metastases. A potential advantage of specific HIF-2 inhibitors is that they would not block the general response of cells to hypoxia mediated by HIF-1 (page 484, column 2, paragraph 1-page 485, column 1, paragraph 3). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have used the PGK hypoxia response element and a minimal thymidine kinase promoter of William to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to use this HRE and promoter combination with a reasonable expectation of success because Griffiths teaches that their modified macrophages can be used for reducing cancer cell growth and the tumor microenvironment is known to be associated with more acidic pH and hypoxia, as identified by Li and Griffiths (page 261, column 1, paragraph 2). William teaches that the combination of six repeats of the PGK hypoxia response element and a minimal thymidine kinase promoter showed improved gene expression under pH 7.0 hypoxic conditions compared to pH 7.4 hypoxic conditions while other HRE- promoter combinations (EPO HRE-SV40 promoter) did not. Furthermore, Sotoodehnejadnematalahi teaches that hypoxic macrophages up-regulate a number of hypoxia-inducible transcription factors, the most important of which is Hypoxia-inducible factor 1 (HIF-1). Sotoodehnejadnematalahi and Wang teach PGK is highly upregulated by HIF-1α expression. Wang teaches that small-molecule inhibitors of HIF-2α may be useful in the prevention or treatment of cancer metastases. Therefore, it would have been obvious to use the PGK HRE and thymidine kinase promoter of William as this construct would not prevent the use of the HIF-2α inhibitors for the treatment of cancer metastases in combination with modified macrophage cells. Furthermore, the PGK HRE and a minimal thymidine kinase promoter provides the potential for increased expression from the acidic tumor microenvironment as well, as it has already been shown in one cancer cell line. The tumor microenvironment has a more acidic pH (6.5-7.0) than the blood (7.4). This would help localize the expression of the transgene to the tumor microenvironment while limiting expression in non-target tissues and improve transgene expression within the tumor to improve the efficacy of the treatment. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. The teachings of Griffiths, William, Li, Sotoodehnejadnematalahi, and Wang are as discussed above. William is silent as to the sequence of the PGK HRE. However, Fujita teaches they cloned 3x Pgk1 HRE-Luc into a plasmid wherein the HRE sequence (Top row) is 100% identical to SEQ ID NO: 44 (Bottom row) of the instant application, as shown below (page 2456, column 2, paragraph 2): 1 TGTCACGTCCTGCACGACTCTAGT 24 |||||||||||||||||||||||| 1 TGTCACGTCCTGCACGACTCTAGT 24 Fujita teaches that the Pgk1 HRE sequence was obtained from Addgene and was functional (page 2456, column 2, paragraph 2 and Figure 3). As the Pgk1 HRE sequence is known within the art and was already cloned into a plasmid, it would have been obvious that one could choose this as the sequence for the Pgk HRE of William. Furthermore, the successful cloning and sequencing of the nucleic acid sequence encoding a known regulatory element is obvious, and thus unpatentable, if (1) there was some suggestion or motivation in the prior art to clone the DNA, and (2) there was a “reasonable expectation of success,” based on "detailed enabling methodology" in the prior art. Ex parte Kubin, 83 U.S.P.Q.2d (BNA) 1410 (B.P.A.I. 2007), aff'd, 561 F.3d 1351 (Fed. Cir. 2009). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Regarding claim 58, although Griffiths performs their tests in vitro using tumor spheroids as a model, Griffiths teaches that their model is known to represent avascular (i.e. hypoxic) tumour microenvironments found in solid tumors (page 256, clumn 1, paragraph 5). As such, the construct of Griffiths is capable of inducing transcription in an in vivo hypoxic tumor microenvironment. Regarding claims 65-66, Griffiths teaches that the HRE-CYP2B6 is comprised within an adenoviral vector (abstract). Regarding claims 72 and 81, Griffiths teaches that they genetically modified macrophages (abstract). Regarding claim 74, although Griffiths did not teach administering their genetically modified cells to a subject to treat cancer, they stated that their data indicate that macrophages can be used as silent carriers of a gene therapy until they infiltrate diseased tissue at which point they can respond to the hypoxic microenvironment and activate the expression of a therapeutic gene. In this way a gene therapy can be delivered specifically to large areas of diseased tissue with the potential to treat a range of diseases including disseminated cancers (page 261, column 1, paragraph 2). As such, although Griffiths does not directly teach administering their genetically modified cells to a patient with cancer, Griffiths clearly contemplates this as the next logical step based on their research. They also directly contemplate that their cells would improve gene therapy methods in patients by localizing the gene delivery to the diseased tissue(s). As such, it would have been obvious that one of ordinary skill in the art could administer the macrophages of Griffiths to target breast cancer as Griffiths macrophages reduced the number of T47D breast cancer cell line spheroids in vitro (page 256, column 1, paragraph 5 and page 261, column 2, paragraph 5-page 262, column 1, paragraph 2). Regarding claim 75, breast cancer is a solid tumor. Regarding claim 82, Griffiths teaches that the macrophages are derived from human primary monocytes (page 261, column 1, paragraph 3-page 262, column 1, paragraph 2). Response to Arguments Applicant's arguments filed October 15, 2024, are acknowledged and have been addressed supra. Claims 57, 74, and 76 are rejected under 35 U.S.C. 103 as being unpatentable over Griffiths et al. (Gene Therapy 7: 255-262. 2000), William et al. (Eur J Physiol 451: 534–543. 2006), Li et al. (ACS Nano 10: 6753−6761. 2016), Sotoodehnejadnematalahi et al. (PLoS One 10: 1-19. 2015), Wang et al. (Biochemical and Biophysical Research Communications 490: 480-485. 2017), and Fujita et al. (FASEB J. 28: 2455–2465. 2014) as applied to claims 57 and 74 above, and further in view of Christie et al. (Proceedings Volume 9305, Optical Techniques in Neurosurgery, Neurophotonics, and Optogenetics II; Macrophage mediated PCI enhanced gene-directed enzyme prodrug therapy. 93050C. 2015). The teachings of Griffiths, William, Li, Sotoodehnejadnematalahi, Wang, and Fujita are as discussed above. The combined teachings of Griffiths, William, Li, Sotoodehnejadnematalahi, Wang, and Fujita do not teach wherein the cancer is glioblastoma. However, Christie teaches that tumor-associated macrophages are frequently found in and around glioblastoma. Macrophages loaded with suicide genes could therefore be used to target tumors by local synthesis of the gene. The basic concept is to use the macrophage as a suicide gene carrier to deliver the gene to the tumor (abstract). The macrophage is transfected with the suicide gene, infiltrates the tumor, the pro-drug is converted to its active form in the macrophage, and the active drug inhibiting the growth of the adjacent tumor cells via the bystander effect (Figure 1). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the method of infiltrating tumors with genetically modified macrophages wherein gene expression is induced in the hypoxic tumor microenvironment of Griffiths with the method of treating glioblastoma using macrophages as suicide gene carriers of Christie to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to combine with a reasonable expectation of success because Griffiths and Christie are both interested in ensuring that their therapeutic is specifically expressed in the tumor microenvironment to reduce off-target effects and they both use macrophages t target the tumors. Griffith specifically identifies their method as being good for gene therapy to specifically deliver the therapeutic gene to large areas of cancerous tissue where it can respond to the hypoxic microenvironment and activate the expression of a therapeutic gene. In a similar manner, Christie is focused on using macrophages so that they selectively target the tumor where a pro-drug can be converted into its active form and target the surrounding glioblastoma tumor cells. As such, it would have been obvious that to one of ordinary skill in the art that they could have used the combined method of Griffiths and Christie to target glioblastoma. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Response to Arguments Applicant's arguments filed October 15, 2024, are acknowledged and have been addressed supra. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEENAN A BATES whose telephone number is (571)270-0727. The examiner can normally be reached M-F 7:30-5:00. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Doug Schultz can be reached on (571) 272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /KEENAN A BATES/Examiner, Art Unit 1631 /JAMES D SCHULTZ/Supervisory Patent Examiner, Art Unit 1631
Read full office action

Prosecution Timeline

Jul 19, 2021
Application Filed
Oct 30, 2024
Non-Final Rejection — §102, §103
Feb 04, 2025
Response Filed
Apr 08, 2025
Final Rejection — §102, §103
Aug 08, 2025
Request for Continued Examination
Aug 11, 2025
Response after Non-Final Action
Sep 24, 2025
Non-Final Rejection — §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12545900
CGAS/DNCV-LIKE NUCLEOTIDYLTRANSFERASES AND USES THEREOF
2y 5m to grant Granted Feb 10, 2026
Patent 12516292
METHODS OF PRODUCING MODIFIED NATURAL KILLER CELLS AND METHODS OF USE
2y 5m to grant Granted Jan 06, 2026
Patent 12503693
INTEGRATED SYSTEM FOR LIBRARY CONSTRUCTION, AFFINITY BINDER SCREENING AND EXPRESSION THEREOF
2y 5m to grant Granted Dec 23, 2025
Patent 12502418
METHOD FOR TREATING MUSCULAR DYSTROPHY BY TARGETING LAMA1 GENE
2y 5m to grant Granted Dec 23, 2025
Patent 12491223
A METHOD FOR TREATING AN AUDITORY NEUROPATHY SPECTRUM DISORDER
2y 5m to grant Granted Dec 09, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
46%
Grant Probability
99%
With Interview (+70.8%)
3y 3m
Median Time to Grant
High
PTA Risk
Based on 54 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month