DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
Claims 5-22, 24, 29-31, 34, 43, 53, 55-58, 67, 77-78, and 81-83 are pending.
Applicant’s election of Group I (claims 5-22, 24, 29-31, 34, 43, 53, 55-58, 67, and 77-78) without traverse in the reply filed December 4, 2024 is acknowledged. Applicant’s election of the species “a single-stranded oligomeric compound” is also acknowledged. Applicant did not explicitly state whether the election of species was made with or without traverse. Because the reply also did not distinctly and specifically point out the supposed errors in the requirement for election of species, the election of the aforementioned species has been treated as an election without traverse (MPEP § 818.01(a)).
Accordingly, claims 53, 55-58, 67, and 81-83 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention or a non-elected species. Examination on the merits commences on claims 5-22, 24, 29-31, 34, 43, and 77-78.
Claim Objections
Claims 22 and 77 are objected to because of the following informalities:
Claim 22 recites “5- methyl cytosine” which should be amended to “5- methyl[[ ]]cytosine.”
Claim 77 recites “A pharmaceutical composition comprising an oligomeric compound of claim 5.” It would be preferable to amend the claim to recite “A pharmaceutical composition comprising [[an]] the oligomeric compound of claim 5.”
Appropriate correction is required.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 6 and 34 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 6 recites that the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to the nucleobase sequences of any of SEQ ID NOs: 1-7 when measured across the entire nucleobase sequence of the modified oligonucleotide.
SEQ ID NOs: 1-7 each have various lengths, and an alignment between SEQ ID NOs: 1 and 3 which comprise the recited ranges in claim 5, and the recited SEQ ID NOs shows that these sequences each have various levels of identity to one another. For example, SEQ ID NO: 2 is 296,000 nts in length, while SEQ ID NO: 1 is 3,120 nts in length. SEQ ID NO: 1 appears to correspond to only selected ranges of the much lengthier SEQ ID NO: 2. As another example SEQ ID NO: 3 is 3,543 nts in length, and aligns with SEQ ID NO: 1 over only 86% of its length. See attached alignments in Appendix I.
It is not clear how/if the additional SEQ ID NOs, and particularly the sequence of SEQ ID NO: 2, are intended to further limit the modified oligonucleotide. For example, it is not clear if the claim is intended to I) further limit the complementary portion of the modified oligonucleotide to having 80% or more complementarity to a previously recited range in SEQ ID NO: 1 or SEQ ID NO: 3, or alternatively, if the claim intends to II) require the modified oligonucleotide comprise at least 80% complementarity to any one of SEQ ID NOs: 1-7, including complementarity to regions of the SEQ ID NOs which are not among the recited ranges in claim 5. For example, under interpretation (II), a 30-nt modified oligonucleotide comprising the sequence “TACAATCACTGGGGATACAAGGATATCTGA” which is “complementary” (at any level, but in this case, 100%) to an 8-nt contiguous sequence “TGATTGTA” in the range of 3192-3277 of SEQ ID NO: 3, and is also at least 80% complementary to SEQ ID NO: 2 (i.e., 83.3%) when measured across its entire length, would be encompassed by claim 6. However, such a modified oligonucleotide would not be encompassed by interpretation (I), because it does not have at least 80% identity to the recited range in SEQ ID NO: 3 when measured across its entire length. Such a modified oligonucleotide does not, in fact, have at least 80% identity to any sequence within any of SEQ ID NOs: 1, or 3-7. See attached alignments.
The structural requirements of the claim are unclear, and therefore, the claim is rendered indefinite.
Claim 34 recites that the oligomeric compound of claim 5 comprises an antisense RNAi oligonucleotide comprising a targeting region comprising at least 15, 19, 20, 21, or 25 contiguous nucleobases, wherein the targeting region is at least 90% complementary to an equal length portion of an APP RNA having the nucleobase sequence of any of SEQ ID NOs: 1-7.
First, SEQ ID NO: 2 does not appear to correspond to an “AAP RNA,” as it is 296,000 nts in length and based on the specification appears to correspond to a reference genome sequence (pg. 75, line 23). SEQ ID NOs: 1-7 each have various lengths, and an alignment between SEQ ID NO: 1 with SEQ ID NOs: 2-7 shows that these sequences each have various levels of identity to SEQ ID NO: 1 recited in claim 5. For example, SEQ ID NO: 2 is 296,000 nts in length, while SEQ ID NO: 1 is 3,120 nts in length. SEQ ID NO: 1 appears to correspond to only selected ranges of the much lengthier SEQ ID NO: 2. As another example SEQ ID NO: 3 is 3,543 nts in length, and aligns with SEQ ID NO: 1 over only 86% of its length. See attached alignments in Appendix I.
The structure of the oligomeric compound in claim 34 is unclear because the claim does not clearly refer back to any of the required elements in the oligomeric compound of claim 5, and because it recites additional sequences which are not recited in claim 5 and have regions that are not present in SEQ ID NOs: 1 or 3. Specifically, it is not clear if the oligomeric compound of claim 34 must I) comprise a modified oligonucleotide between 12-30 linked nucleosides with at least 8 nucleobases complementary to an equal length portion of one of the recited ranges in SEQ ID NOs: 1 or 3, and also an antisense RNAi oligonucleotide with at least 15 nucleobases at least 90% complementary to an equal length portion of one of SEQ ID NOs: 1-7, or alternatively, if the oligomeric compound must II) comprise a modified oligonucleotide between 12-30 linked nucleosides with at least 8 nucleobases complementary to an equal length portion of one of the recited ranges in SEQ ID NOs: 1 or 3, wherein some portion, or all of, the modified oligonucleotide is the antisense RNAi oligonucleotide recited in claim 34.
In the case of (I), it is noted that the specification does not appear to disclose any oligomeric compounds with multiple, distinct targeting regions. In the latter case (II), it is noted that it is not clear how the additional SEQ ID NOs, and particularly the genomic sequence in SEQ ID NO: 2, are intended to further limit the oligomeric compound, e.g., if the oligomeric compound may be complementary to regions of the genomic sequence of SEQ ID NO: 2 which are not among the recited ranges in claim 5. Because the structural requirements of the claim are unclear, the claim is rendered indefinite.
Claim Rejections - 35 USC § 102 - Dobie
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 5-8, 11, 13, 16-18, 20-22, 24, 29-31, 34, 43, and 77-78 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Dobie (Dobie, US 2003/0232435 A1, 18 December 2003). Claim 34 is evidenced by Kurreck (Kurreck, 22 April 2008, “Chapter 1: The Role of Backbone Modifications in Oligonucleotide-Based Strategies,” Therapeutic Oligonucleotides, The Royal Society of Chemistry, pg. 1-22).
Regarding claims 5, 24, and 43, Dobie teaches an single-stranded oligomeric compound (“ACTTAGGCAAGAGAAGCAGC”, SEQ ID NO: 11; Table 1, pg. 29), comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is complementary to at least 8 contiguous nucleobases of an equal length portion of nucleobases 2675-3054 of SEQ ID NO: 1 (i.e., nucleobases 2769-2788). See attached alignment in Appendix II. Dobie teaches the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage ([0040]-[0052]; [0280]).
Regarding claim 6, in view of the indefiniteness described in paragraph 8 above, the claim is examined under the interpretation that it further limits the complementary portion of the modified oligonucleotide to having 80% or more complementarity to a previously recited range in SEQ ID NO: 1 or SEQ ID NO: 3. As shown in the attached alignment in Appendix II, the complementary portion of the modified oligonucleotide is at least 80% complementary to an equal length portion of nucleobases 2675-3054 of SEQ ID NO: 1, when measured across the entire nucleobase sequence of the modified oligonucleotide.
Regarding claims 7-8, Dobie teaches at least one nucleoside of the modified oligonucleotide is a modified nucleoside comprising a modified sugar moiety ([0047]-[0049]; [0280]).
Regarding claims 11 and 13, Dobie teaches at least one nucleoside of the modified oligonucleotide is a modified nucleoside comprising a non-bicyclic modified sugar, wherein the non-bicyclic modified sugar is 2’-MOE ([0047]-[0049]; [0280]).
Regarding claims 16-18, and 20, Dobie teaches each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage ([0040]-[0043]; [0280]).
Regarding claims 21-22, Dobie teaches the modified oligonucleotide comprises at least one modified nucleobase, wherein the modified nucleobase is a 5-methylcytosine ([0050]-[0051]; [0280]).
Regarding claim 29, the term “gapmer” is interpreted as a modified oligonucleotide comprising an internal region have a plurality of nucleosides that support RNase H cleavage, positioned between external regions having one or more nucleosides, wherein at least one nucleoside of each of the external regions is chemically distinct from at least one of the internal region nucleosides (pg. 6, lines 1-4). Dobie teaches the modified oligonucleotide is a gapmer (“All compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting of ten 2'-deoxynucleotides, which is flanked on both sides (5' and 3' directions) by five-nucleotide "wings". The wings are composed of 2'-methoxyethyl (2'MOE) nucleotides.” , [0280]; [0054]-[0055]; [0229]).
Regarding claims 30-31, Dobie teaches the oligomeric compound has a sugar motif comprising a 5’ region and 3’ region, each consisting of 1-6 linked nucleosides comprising a modified sugar moiety (“flanked on both sides (5' and 3' directions) by five-nucleotide "wings". The wings are composed of 2'-methoxyethyl (2'MOE) nucleotides”), and a central region consisting of 6-10 linked nucleosides, wherein each of the central region nucleosides comprises a 2’-β-D-deoxyribosyl sugar moiety (“composed of a central "gap" region consisting of ten 2'-deoxynucleotides”)([0280]). The 5’ and 3’ region of Dobie’s oligomeric compound each consist of 2’-MOE nucleosides, and thus, the 3’-most nucleoside of the 5’ region and 5’-most nucleoside of the 3’ region comprise modified sugar moieties. The central region of Dobie’s oligomeric compound consists of ten nucleosides, each comprising a 2’-β-D-deoxyribosyl sugar moiety (“composed of a central "gap" region consisting of ten 2'-deoxynucleotides”), and thus, the central region comprises at least six nucleosides comprising a 2’-β-D-deoxyribosyl sugar moiety, wherein no more than two nucleosides comprise a 2’-substituted sugar moiety.
Regarding claim 34, in view of the indefiniteness described in paragraph 9 above, the claim is interpreted as requiring that the oligomeric compound comprise a modified oligonucleotide, wherein the modified oligonucleotide is an antisense RNAi oligonucleotide comprising a targeting region comprising at least 15 contiguous nucleobases at least 90% complementary to a region of SEQ ID NO: 1 or 3 recited in claim 5. The term “antisense RNAi oligonucleotide” is interpreted as “an oligonucleotide comprising a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNAi” (pg. 9, lines 14-16). Thus, under the present interpretation, the “antisense RNAi oligonucleotide” (i.e., modified oligonucleotide) must be at least 90% complementary to an at least 15 nucleobase target sequence, and comprise at least one chemical modification “suitable for RNAi.”
As shown in the attached alignment, the modified oligonucleotide of the oligomeric compound of Dobie is at least 90% complementary to at least 15 nucleobases of nts 2675-3054 in SEQ ID NO: 1, when measured across the entire nucleobase sequence of the modified oligonucleotide. The oligomeric compound also comprises phosphorothioate modifications ([0280]). As evidenced by Kurreck, phosphorothioate modifications are suitable for RNAi (“The introduction of phosphorothioate linkages was among the first steps to protect siRNAs against ribonucleases. This modification was found to be very compatible with the silencing function of siRNAs”, section 1.4.1). Thus, as evidenced by Kurreck, the oligomeric compound of Dobie comprises a modified oligonucleotide which is an “antisense RNAi oligonucleotide” (i.e., complementary to the target sequence and includes at least one chemical modification suitable for RNAi), at least 90% complementary to at least 15 contiguous nucleobases in SEQ ID NO: 1.
Regarding claim 77, Dobie teaches a pharmaceutical composition comprising the oligomeric compound and a pharmaceutically acceptable carrier or diluent ([0065]-[0072]; [0123]-[0127]).
Regarding claim 78, Dobie teaches the pharmaceutically acceptable diluent is sterile saline (“sterile aqueous solutions”, [0068]; “salt solutions”, [0127]).
Claim Rejections - 35 USC § 103 – Dobie in view of Kurreck
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 9-10, 12, 14-15, and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Dobie (Dobie, US 2003/0232435 A1, 18 December 2003) as applied to claims 5-8, 11, 13, 16-18, 20-22, 24, 29-31, 34, 43, and 77-78, in view of Kurreck (Kurreck, 22 April 2008, “Chapter 1: The Role of Backbone Modifications in Oligonucleotide-Based Strategies,” Therapeutic Oligonucleotides, The Royal Society of Chemistry, pg. 1-22).
The teachings of Dobie are recited above in paragraphs 10-21 and applied hereinafter as to claims 5-8, 11, 13, 16-18, 20-22, 24, 29-31, 34, 43, and 77-78. Dobie teaches many oligomeric compounds, including at least one which meets the limitations of instant claim 5 (i.e., SEQ ID NO: 11), which successfully inhibits human amyloid beta protein precursor (APP) mRNA levels (Table 1, pg. 29-30). Dobie teaches various modifications which may be used to prepare an oligomeric compound ([0040]-[0052]; [0280]). Regarding claims 9-10, and 12, Dobie teaches bicyclic sugar moieties (“LNA”) comprising a 2’-4’ bridge wherein the 2’-4’ bridge is -O-CH2 (“Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. The linkage is preferably a methelyne (-CH2-)n group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2.”, [0049]). Regarding claims 14-15, Dobie teaches sugar surrogates, wherein the sugar surrogates are PNA and morpholino ([0043]; [0045]). Regarding claim 19, Dobie teaches that an oligomeric compound which is “phosphorothioated at the 5’ and 3’ ends” has been reported in the art ([0006]). Dobie also teaches “It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an oligonucleotide” ([0054]).
Dobie teaches each of the aforementioned modifications are suitable for incorporation in the oligomeric compounds, but does not provide explicit motivation to modify the oligomeric compounds to arrive at the inventions of claims 9-10, 12, 14-15, and 19.
Regarding claims 9-10, and 12, Kurreck teaches that gapmers comprising LNA monomers in the 5’ and 3’ regions flanking a DNA center are potent inducers of RNase H cleavage (section 1.2.3). Kurreck teaches LNAs also confer high target affinity, and enhance cellular and nuclear uptake (section 1.2.3). Regarding claims 14-15, Kurreck teaches that incorporating morpholino sugar surrogates (“PMOs”) confers nuclease resistance, and may be used to inhibit translation of a target mRNA (section 1.2.3). Kurreck teaches that oligomeric compounds comprising LNA and morpholino sugar surrogates are in clinical trials (Table 1.1).
Regarding claims 9-10, 12, and 14-15, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the chemical motif of the oligomeric compound of Dobie, using the modifications taught by Dobie and Kurreck, to arrive at the oligomeric compounds of instant claims 9-10, 12, and 14-15. It would have amounted to applying known chemical modifications, to a known oligomeric compound, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in modifying the oligomeric compound because as evidenced by Kurreck and Dobie, it was well within the purview of the ordinarily skilled artisan to synthesize oligomeric compounds with a desired chemical motif applied across a desired nucleobase sequence. The skilled artisan would have been motivated to modify the oligomeric compound of Dobie, using the modifications described by Dobie and Kurreck, because Kurreck teaches that the modifications improve aspects of oligomeric compounds, e.g., target affinity, cellular uptake, and translation inhibition.
Regarding claim 19, Kurreck teaches that phosphorothioates have “several disadvantageous properties,” e.g., “reduced affinity towards complementary RNA molecules in comparison to their isosequential unmodified DNA counterpart” (section 1.2.1).
Regarding claim 19, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the backbone of the oligomeric compound of Dobie, using the guidance of Dobie and Kurreck, to arrive at the oligomeric compound of claim 19. It would have amounted to removing a known backbone modification of at least one nucleoside, in a known oligomeric compound, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in modifying the oligomeric compound because as evidenced by Kurreck and Dobie, it was well within the purview of the ordinarily skilled artisan to synthesize oligomeric compounds with a desired chemical motif applied across a desired nucleobase sequence, and because Dobie teaches an oligomeric compound targeting APP and comprising phosphorothioate end regions (rather than a fully phosphorothioate backbone) is reported in the art. Because Kurreck teaches that phosphorothioates reduce an oligomeric compound’s affinity for a target RNA, the skilled artisan would have been motivated to modify the oligomeric compound of Dobie by removing at least one phosphorothioate modification with a reasonable expectation that doing so would improve the target affinity of the oligomeric compound.
Claim Rejections - 35 USC § 103 – Monia in view of Dobie
Claims 5-8, 11, 13, 16-18, 20-22, 24, 29-31, 34, 43, and 77-78 are rejected under 35 U.S.C. 103 as being unpatentable over Monia (Monia et al., US 6,177,246 B1, 23 January 2001), in view of Dobie (Dobie, US 2003/0232435 A1, 18 December 2003). Claim 34 is evidenced by (Kurreck, 22 April 2008, “Chapter 1: The Role of Backbone Modifications in Oligonucleotide-Based Strategies,” Therapeutic Oligonucleotides, The Royal Society of Chemistry, pg. 1-22).
Monia teaches “A method of modulating abnormal expression of a gene encoding beta-amyloid precursor protein comprising contacting a tissue or cell comprising said gene with an oligonucleotide comprising from 8 to 50 nucleotides specifically hybridizable with a nucleic acid encoding an abnormally expressed beta-amyloid precursor protein, wherein said oligonucleotide comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, and SEQ ID NO:51” (see claim 1, cols. 43-44).
As shown in the attached alignments in Appendix II, each of the SEQ ID NOs recited in the Monia target a region of the APP mRNA encoded by instant SEQ ID NO: 1. However, none of the Monia’s SEQ ID NOs target one of the ranges of SEQ ID NO: 1 recited in instant claim 5.
The teachings of Dobie and Kurreck are recited above in paragraphs 10-21 and applied hereinafter as to claims 5-8, 11, 13, 16-18, 20-22, 24, 29-31, 34, 43, and 77-78.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the oligonucleotide used in Monia’s method, with the oligonucleotide of Dobie, which meets the limitations of instant claims 5-8, 11, 13, 16-18, 20-22, 24, 29-31, 34, 43. It would have amounted to substituting a known oligonucleotide specifically hybridizable with a nucleic acid encoding abnormally expressed beta-amyloid precursor protein, for another known oligonucleotide for the same purpose, as evidenced by Dobie. The skilled artisan would have had a reasonable expectation of success in substituting the oligonucleotides because Dobie teaches that the oligonucleotide successfully modulates the expression of APP (see Table 1, pg. 29). The skilled artisan would have been motivated to substitute the oligonucleotides because Dobie and Monia both teach a substantially identical method, and Dobie teaches an additional oligonucleotide which is functional in such a method.
Regarding instant claims 77-78, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have contacted the tissue or cell in Monia’s method with the oligonucleotide of Dobie in a pharmaceutical composition that meets the limitations of instant claims 77-78. It would have amounted to a simple combination of a known oligonucleotide with known elements of a pharmaceutical composition, by known means to yield predictable results. The skilled artisan would have been motivated to combine the oligonucleotide of Dobie in a pharmaceutical composition and contact the tissue/cell of Monia’s method, with a reasonable expectation of success, because Dobie teaches elements of such pharmaceutical compositions, and the skilled artisan would know that pharmaceutical compositions are suitable for delivering oligonucleotides to tissues and cells.
Claim Rejections - 35 USC § 103 – Monia and Dobie in view of Kurreck
Claims 9-10, 12, 14-15, and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Monia (Monia et al., US 6,177,246 B1, 23 January 2001) and Dobie (Dobie, US 2003/0232435 A1, 18 December 2003) as applied to claims 5-8, 11, 13, 16-18, 20-22, 24, 29-31, 34, 43, and 77-78 above, in further view of Kurreck (Kurreck, 22 April 2008, “Chapter 1: The Role of Backbone Modifications in Oligonucleotide-Based Strategies,” Therapeutic Oligonucleotides, The Royal Society of Chemistry, pg. 1-22).
The teachings of Monia and Dobie are recited directly above in paragraphs 27-32 and applied hereinafter. The teachings of Dobie and Kurreck are recited in paragraphs 21-26 above and applied as to claims 9-10, 12, 14-15, and 19 hereinafter.
Monia and Dobie teach many modifications which are suitable for incorporation in the oligomeric compounds, but do not provide explicit motivation to modify the oligomeric compounds to arrive at the inventions of instant claims 9-10, 12, 14-15, and 19.
The obviousness of modifying the oligonucleotide of Dobie to meet the limitations of instant claims 9-10, 12, 14-15, and 19 in view of Kurreck are recited above in paragraphs 25-26 and applied hereinafter.
Claim Rejections - 35 USC § 103 – Rigo in view of Dobie
Claims 5-8, 11, 13, 16-18, 20-22, 24, 29-31, 34, 43, and 77-78 are rejected under 35 U.S.C. 103 as being unpatentable over Rigo (Rigo et al., US 11,732,260 B2, effectively filed 2 March 2018), in view of Dobie (Dobie, US 2003/0232435 A1, 18 December 2003). Claim 34 is evidenced by Kurreck (Kurreck, 22 April 2008, “Chapter 1: The Role of Backbone Modifications in Oligonucleotide-Based Strategies,” Therapeutic Oligonucleotides, The Royal Society of Chemistry, pg. 1-22).
The applied reference has a common Applicant (i.e., Ionis Pharmaceuticals, Inc.) with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 103 might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C.102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B); or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. See generally MPEP § 717.02.
Rigo teaches “A method of decreasing expression of amyloid β in a cell, comprising contacting the cell with a modified oligonucleotide according to claim 2.” Rigo also teaches “A method of decreasing expression of amyloid β in a cell, comprising contacting the cell with a modified oligonucleotide according to claim 1.” See claims 21 and 39, cols. 39-40.
As shown in the attached alignments in Appendix II, the range of target nucleotides and the SEQ ID NOs recited in Rigo fail to overlap with any regions of the APP mRNA encoded by instant SEQ ID NO: 1 which are recited in instant claim 5. Thus, Rigo does not appear to teach a modified oligonucleotide that targets one of the instant ranges recited in SEQ ID NO: 1.
The teachings of Dobie and Kurreck are recited above in paragraphs 10-21 and applied hereinafter as to claims 5-8, 11, 13, 16-18, 20-22, 24, 29-31, 34, 43, and 77-78.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the oligonucleotide of in the method of Rigo, with the oligonucleotide of Dobie, which meets the limitations of instant claims 5-8, 11, 13, 16-18, 20-22, 24, 29-31, 34, 43. It would have amounted to substituting a known modified oligonucleotide targeting amyloid β expression, for another known oligonucleotide for the same purpose as evidenced by Dobie. The skilled artisan would have had a reasonable expectation of success in substituting the oligonucleotides because Dobie teaches that the oligonucleotide successfully modulates the expression of APP, which encodes amyloid β (see Table 1, pg. 29). The skilled artisan would have been motivated to substitute the oligonucleotides because Dobie and Rigo both teach a substantially identical methods, and Dobie teaches an additional oligonucleotide which is functional in such a method.
Regarding instant claims 77-78, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have contacted the cell in Rigo’s method with the oligonucleotide of Dobie in a pharmaceutical composition that meets the limitations of instant claims 77-78. It would have amounted to a simple combination of a known oligonucleotide with known elements of a pharmaceutical composition, by known means to yield predictable results. The skilled artisan would have been motivated to combine the oligonucleotide of Dobie in a pharmaceutical composition and contact the cell of Rigo’s method, with a reasonable expectation of success, because Dobie teaches elements of such pharmaceutical compositions, and the skilled artisan would know that pharmaceutical compositions are suitable for delivering oligonucleotides to cells.
Claim Rejections - 35 USC § 103 – Rigo and Dobie in view of Kurreck
Claims 9-10, 12, 14-15, and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Rigo (Rigo et al., US 11,732,260 B2, effectively filed 2 March 2018) and Dobie (Dobie, US 2003/0232435 A1, 18 December 2003) as applied to claims 5-8, 11, 13, 16-18, 20-22, 24, 29-31, 34, 43, and 77-78 above, in further view of Kurreck (Kurreck, 22 April 2008, “Chapter 1: The Role of Backbone Modifications in Oligonucleotide-Based Strategies,” Therapeutic Oligonucleotides, The Royal Society of Chemistry, pg. 1-22).
The teachings of Rigo and Dobie are recited directly above in paragraphs 43-46 and applied hereinafter. The teachings of Dobie and Kurreck are recited in paragraphs 21-26 above and applied as to claims 9-10, 12, 14-15, and 19 hereinafter.
Rigo and Dobie teach many modifications which are suitable for incorporation in the oligomeric compounds, but do not provide explicit motivation to modify the oligomeric compounds to arrive at the inventions of claims 9-10, 12, 14-15, and 19.
The obviousness of modifying the oligonucleotide of Dobie to meet the limitations of instant claims 9-10, 12, 14-15, and 19 in view of Kurreck are recited above in paragraphs 25-26 and applied hereinafter.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
U.S. Patent No. 6,177,246
Claims 5-22, 24, 29-31, 34, 43, and 77-78 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of U.S. Patent No. 6,177,246. Claims 5-8, 11, 13, 16-18, 20-22, 24, 29-31, 34, 43, and 77-78 are in view of Dobie (Dobie, US 2003/0232435 A1, 18 December 2003), wherein claim 34 is evidenced by Kurreck (Kurreck, 22 April 2008, “Chapter 1: The Role of Backbone Modifications in Oligonucleotide-Based Strategies,” Therapeutic Oligonucleotides, The Royal Society of Chemistry, pg. 1-22). Claims 9-10, 12, 14-15, and 19 are in further view of Kurreck (Kurreck, 22 April 2008, “Chapter 1: The Role of Backbone Modifications in Oligonucleotide-Based Strategies,” Therapeutic Oligonucleotides, The Royal Society of Chemistry, pg. 1-22).
Patented claim 1 recites “A method of modulating abnormal expression of a gene encoding beta-amyloid precursor protein comprising contacting a tissue or cell comprising said gene with an oligonucleotide comprising from 8 to 50 nucleotides specifically hybridizable with a nucleic acid encoding an abnormally expressed beta-amyloid precursor protein, wherein said oligonucleotide comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, and SEQ ID NO:51.”
As shown in the attached alignments in Appendix II, each of the SEQ ID NOs recited in the patented claims target a region of the APP mRNA encoded by instant SEQ ID NO: 1. However, none of the patented SEQ ID NOs target one of the ranges of SEQ ID NO: 1 recited in instant claim 5.
The teachings of Dobie and Kurreck are recited above in paragraphs 10-21 and applied hereinafter as to claims 5-8, 11, 13, 16-18, 20-22, 24, 29-31, 34, 43, and 77-78.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the oligonucleotide in the patented method, with the oligonucleotide of Dobie, which meets the limitations of instant claims 5-8, 11, 13, 16-18, 20-22, 24, 29-31, 34, 43. It would have amounted to substituting a known oligonucleotide specifically hybridizable with a nucleic acid encoding abnormally expressed beta-amyloid precursor protein, for another known oligonucleotide for the same purpose as evidenced by Dobie. The skilled artisan would have had a reasonable expectation of success in substituting the oligonucleotides because Dobie teaches that the oligonucleotide successfully modulates the expression of APP (see Table 1, pg. 29). The skilled artisan would have been motivated to substitute the oligonucleotides because Dobie and the patented claims both teach a substantially identical method, and Dobie teaches an additional oligonucleotide which is functional in such a method.
Regarding instant claims 77-78, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have contacted the tissue or cell in the patented methods with the oligonucleotide of Dobie in a pharmaceutical composition that meets limitations of instant claims 77-78. It would have amounted to a simple combination of a known oligonucleotide with known elements of a pharmaceutical composition, by known means to yield predictable results. The skilled artisan would have been motivated to combine the oligonucleotide of Dobie in a pharmaceutical composition and contact the tissue/cell of the patented method, with a reasonable expectation of success, because Dobie teaches elements of such pharmaceutical compositions, and the skilled artisan would know that pharmaceutical compositions are suitable for delivering oligonucleotides to tissues or cells.
The teachings of Dobie and Kurreck are recited above in paragraphs 22-26 and applied hereinafter as to claims 9-10, 12, 14-15, and 19. The obviousness of modifying the oligonucleotide of Dobie to meet the limitations of instant claims 9-10, 12, 14-15, and 19 are recited above in paragraphs 25-26 and applied hereinafter.
U.S. Patent No. 11,732,280 B2
Claims 5-22, 24, 29-31, 34, 43, and 77-78 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 21 and 39 of U.S. Patent No. 11,732,280 B2. Claims 5-8, 11, 13, 16-18, 20-22, 24, 29-31, 34, 43, and 77-78 are in view of Dobie (Dobie, US 2003/0232435 A1, 18 December 2003), wherein claim 34 is evidenced by Kurreck (Kurreck, 22 April 2008, “Chapter 1: The Role of Backbone Modifications in Oligonucleotide-Based Strategies,” Therapeutic Oligonucleotides, The Royal Society of Chemistry, pg. 1-22). Claims 9-10, 12, 14-15, and 19 are in further view of Kurreck (Kurreck, 22 April 2008, “Chapter 1: The Role of Backbone Modifications in Oligonucleotide-Based Strategies,” Therapeutic Oligonucleotides, The Royal Society of Chemistry, pg. 1-22).
Patented claim 21 recites “A method of decreasing expression of amyloid β in a cell, comprising contacting the cell with a modified oligonucleotide according to claim 2.”
Patented claim 39 recites “A method of decreasing expression of amyloid β in a cell, comprising contacting the cell with a modified oligonucleotide according to claim 1.”
The range of target nucleotides recited in patented claim 1, and the SEQ ID NOs recited in patented claim 2, fail to overlap with any regions of the APP mRNA encoded by instant SEQ ID NO: 1 which are recited in instant claim 5. Thus, neither the patented modified oligonucleotide of claims 1 or 2 target one of the ranges recited in SEQ ID NO: 1.
The teachings of Dobie and Kurreck are recited above in paragraphs 10-21 and applied hereinafter as to claims 5-8, 11, 13, 16-18, 20-22, 24, 29-31, 34, 43, and 77-78.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the oligonucleotide of the patented method, with the oligonucleotide of Dobie, which meets the limitations of instant claims 5-8, 11, 13, 16-18, 20-22, 24, 29-31, 34, 43. It would have amounted to substituting a known modified oligonucleotide targeting amyloid β expression, for another known oligonucleotide for the same purpose as evidenced by Dobie. The skilled artisan would have had a reasonable expectation of success in substituting the oligonucleotides because Dobie teaches that the oligonucleotide successfully modulates the expression of APP, which encodes amyloid β (see Table 1, pg. 29). The skilled artisan would have been motivated to substitute the oligonucleotides because Dobie and the patented claims both teach a substantially identical method, and Dobie teaches an additional oligonucleotide which is functional in such a method.
Regarding instant claims 77-78, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have contacted the cell in the patented method with the oligonucleotide of Dobie in a pharmaceutical composition that meets the limitations of instant claims 77-78. It would have amounted to a simple combination of a known oligonucleotide with known elements of a pharmaceutical composition, by known means to yield predictable results. The skilled artisan would have been motivated to combine the oligonucleotide of Dobie in a pharmaceutical composition and contact the cell of the patented method, with a reasonable expectation of success, because Dobie teaches elements of such pharmaceutical compositions, and the skilled artisan would know that pharmaceutical compositions are suitable for delivering oligonucleotides to cells.
The teachings of Dobie and Kurreck are recited above in paragraphs 22-26 and applied hereinafter as to claims 9-10, 12, 14-15, and 19. The obviousness of modifying the oligonucleotide of Dobie to meet the limitations of instant claims 9-10, 12, 14-15, and 19 are recited above in paragraphs 25-26 and applied hereinafter.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached on (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JENNA L PERSONS/Examiner, Art Unit 1637
/CATHERINE KONOPKA/Examiner, Art Unit 1635