Prosecution Insights
Last updated: October 02, 2026
Application No. 17/426,993

ADENO-ASSOCIATED VIRUS DELIVERY OF CLN6 POLYNUCLEOTIDE

Final Rejection §102§103§DP
Filed
Jul 22, 2022
Priority
Feb 04, 2019 — provisional 62/800,915 +5 more
Examiner
SPENCER, ANDREA LYNNE MORRIS
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Research Institute At Nationwide Children's Hospital
OA Round
2 (Final)
22%
Grant Probability
At Risk
3-4
OA Rounds
0m
Est. Remaining
58%
With Interview

Examiner Intelligence

Grants only 22% of cases
22%
Career Allowance Rate
2 granted / 9 resolved
-37.8% vs TC avg
Strong +36% interview lift
Without
With
+35.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
41 currently pending
Career history
63
Total Applications
across all art units

Statute-Specific Performance

§101
3.5%
-36.5% vs TC avg
§103
45.1%
+5.1% vs TC avg
§102
17.6%
-22.4% vs TC avg
§112
22.7%
-17.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 9 resolved cases

Office Action

§102 §103 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant's election with traverse of group I (claims 11-14, 16, 19-23, and 44-45) in the reply filed on 08/04/2025 is acknowledged. The species election of the following species in the reply filed on 08/04/2025 is also acknowledged: intrathecal administration, drawn to group II which is not elected. Applicant traverses the election but does not present an argument, therefore the traversal is not found persuasive. The requirement is still deemed proper and is therefore made FINAL. Claims Status Claims 1, 12-14, 16 and 19 are canceled, claims 46-57 have been withdrawn from consideration as being drawn to non-elected subject matter, and claims 11, 20-23 and 44-45 have been considered on the merits. All arguments have been considered. Withdrawn Objections & Rejections Applicant's response filed 12/19/2025 has been considered. Rejections and/or objections not reiterated from the previous Office action mailed 11/18/2025 are hereby withdrawn. The objections and rejections under 112, 102, 103 and nonstatutory patenting as recited in the action mailed 11/18/2025 are withdrawn as discussed below. The objections and rejections presented herein represent the full set of objections and rejections currently pending in the application. Claim Rejections - 35 USC § 102/103 (New Rejection) In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 11, 20-23 and 44 are rejected under 35 U.S.C. 102(a)(1)as anticipated by or, in the alternative, under 35 U.S.C. 103 as obvious over by Mole et al (Lancet Neurology (2019)18;107-117, as cited in the IDS filed on 07/18/2023 and cited in the previous action) and as evidenced by Amicus Clinical Trial (NCT02725580, made available to the public on 04/01/2016; see page 9 of PDF), and Cain et al (Molecular Therapy (2019) 27:10;1836-1856). Regarding claims 11 and 20-23: Mole teach neuronal ceroid lipofuscinoses, or Batten disease, is caused by mutations in genes including CLN6 (p107 col1 ¶2). Mole teach gene therapy studies and gene therapy clinical trials have been conducted for treatment of neuronal ceroid lipofuscinoses (p111 col2 ¶2). Mole disclose the clinical trial NCT02725580 for patients with CLN6 disease, which conducts intrathecal administration of the scAAV9.CB.CLN6 gene transfer vector (also known as AT-GTX-501), delivering the CLN6 gene by a self-complementary AAV9 (scAAV9) (p111 col2 ¶3, Table 2). As discussed supra, an AAV comprises a single-stranded genome and thus the disclosure of Mole reads on the limitation ”single-stranded genome” as recited in the instant claims. Regarding Seq ID NO: 4: the instant specification teaches Seq ID NO: 4 discloses the nucleotide sequence of the gene cassette of scAAV9.CB.CLN6 (p14 [0057]; figure 13). As evidenced by Cain, the scAAV9.CB.CLN6 construct used in the clinical trial NCT02725580 (the same clinical trial disclosed by Mole) is disclosed by Figure S1A (p1842 col1 ¶2 of Cain; see below). As shown in Figure S1A of Cain (below), scAAV9.CB.CLN6 expression cassette as taught by Cain (and used in the clinical trial and as taught by Mole) comprises the identical structure as scAAV9.CB.CLN6 of the instant disclosure. It would be reasonable for one of ordinary skill in the art to consider the expression cassette disclosed by Cain and Mole, which comprises an identical name and structure as that disclosed by the instant Seq ID NO:4, and shares inventors with the instant disclosure, to be substantially similar, if not identical to the expression cassette disclosed by the instant Seq ID No: 4. Thus, if Seq ID No:4 is not anticipated by the disclosure of Mole as evidenced by Cain, it would be rendered obvious. MPEP reads "When the PTO shows a sound basis for believing that the products of the applicant and the prior art are the same, the applicant has the burden of showing that they are not. In re Spada, 911 F.2d 705, 709, 15 USPQ2d 1655, 1658 (Fed. Cir. 1990). See MPEP §§ 2112 - 2112.02”. The Patent and Trademark Office is not equipped to conduct experimentation in order to determine whether or not applicants' expression cassette scAAV9.CB.CLN6 as taught by Seq ID NO: 4 differs and if so to what extent, from the expression cassette scAAV9.CB.CLN6, taught by Mole. Accordingly, it has been established that the prior art expression cassette, which has the same name and structure, and shares inventors and the property of delivering the CLN6 gene by a self-complementary AAV9 for enzyme replacement therapy for CLN6-Batten disease, demonstrates a reasonable probability that it is either identical or sufficiently similar to the claimed expression cassette scAAV9.CB.CLN6 (as disclosed by the instant Seq ID NO: 4) that whatever differences exist are not patentably significant. Therefore, the burden of establishing novelty or unobviousness by objective evidence is shifted to Applicant. Merely because a characteristic of a known expression cassette is not disclosed in a reference does not make the known expression cassette patentable. The new expression cassette possesses inherent characteristics which might not be displayed in the tests used the reference. Clear evidence that the scAAV9.CB.CLN6 construct of the cited prior art does not possess a critical characteristic that is possessed by the claimed scAAV9.CB.CLN6 construct as disclosed by Seq ID NO: 4 would advance prosecution and might permit allowance of claims to applicants' nucleic acid molecule. Figure S1A of Cain is reproduced below: PNG media_image1.png 103 998 media_image1.png Greyscale Regarding claim 44: Mole teach the AAV9 gene therapy vector is administrated intrathecally (p111 col2 ¶3). One of ordinary skill in the art would understand that for a composition to be delivered via intrathecal administration (i.e. direct injection into the cerebral spinal fluid) to a human in a clinical trial, the composition must comprise a pharmaceutically acceptable excipient, carrier, or diluent. Claim Rejections - 35 USC § 103 (new rejection) In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim 45 is rejected under 35 U.S.C. 103 as being unpatentable over Mole et al (Lancet Neurology (2019)18;107-117, as cited in the IDS filed on 07/18/2023 and cited in the previous action) and as evidenced by Amicus Clinical Trial (NCT02725580, made available to the public on 04/01/2016; see page 9 of PDF), and Cain et al (Molecular Therapy (2019) 27:10;1836-1856) as applied to claims 11, 20-23 and 44 above, and further in view of Kaspar et al (WO 2014/022582 A1, as cited in the IDS filed 02/12/2024; cited previously). Regarding claim 45: The teachings of Mole are discussed supra. Mole are silent on the composition of the pharmaceutically acceptable excipient. Kaspar teach an rAAV9 vector for treatment of lysosomal storage disease (abstract). Kaspar further teach lysosomal storage diseases include Neuronal Ceroid Lipofuscinoses CLN6 disease (Atypical Late Infantile, Late Onset variant, Early Juvenile) (p7 ¶0021). Kaspar teach the AAV vector is delivered via intrathecal injection comprising a non-ionic, low-osmolar carrier (claim 1). It would have been obvious to one of ordinary skill in the art to adapt the AAV9 gene therapy vector for CLN6 gene therapy as taught by Mole with the teachings of Kaspar; to include a pharmaceutically acceptable excipient comprising a non-ionic, low-osmolar compound. One would have been motivated to modify the gene transfer vector taught by Mole with the with the teachings of Kasper, to include a pharmaceutically acceptable excipient comprising a non-ionic, low-osmolar compound because the gene therapy vector taught by Kaspar can be used for treatment of lysosomal storage disorders such as CLN6 disease, and Kaspar further teach the gene therapy vector expresses the transgene primarily in the CNS after cisternal or intrathecal injection (p19 0068/0069). One would have had a reasonable expectation of success because one of ordinary skill in the art would understand that compositions that are injected would typically comprise a pharmaceutically acceptable excipient comprising a non-ionic, low-osmolar pharmaceutically acceptable excipient and both disclosures are drawn to intrathecal administration of an AAV9 gene therapy vector for the treatment of Neuronal Ceroid Lipofuscinoses CLN6 disease, and Kaspar shows the method using a non-ionic, low-osmolar pharmaceutically acceptable excipient is successful. Double Patenting (new rejection) The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 11, 20-23, and 44-45 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1 and 32 of copending Application No. 17604188 (reference application, hereafter referred to as ‘188). Although the claims at issue are not identical, they are not patentably distinct from each other, as discussed below. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Regarding claims 11, 20-23 and 44: Claim 11 of the instant disclosure requires the nucleic acid sequence of seq ID NO: 4 which the instant specification teaches is the scAAV9.CB.CLN6 gene cassette (p14 [0057]). Instant claims 11, 20-23 and 44 require an AAV9 vector comprising Seq ID NO:4. Claim 1 of copending ‘188 teaches a recombinant adeno-associated virus 9 (rAAV9) that comprises the nucleotide sequence of Seq ID No: 4 which is administered to an individual. Seq ID NO:4 of ‘188 is identical to Seq ID NO: 4 of the instant disclosure and thus Claim 1 of ‘188 anticipates the instant claims 11 and 20-23 (see alignment below). A composition which is administered to an individual necessarily comprises a pharmaceutically acceptable excipient and is therefore Claim 1 of copending ‘188 is interpreted to read on the instant claim 44. Alignment of Seq ID NO: 4 from the instant application (Query) and copending ‘188 (Sbjct): Query 1 CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTT 60 Query 61 GGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGAATTCACGCGTGGA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 GGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGAATTCACGCGTGGA 120 Query 121 TCTGAATTCAATTCACGCGTGGTACCTCTGGTCGTTACATAACTTACGGTAAATGGCCCG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 TCTGAATTCAATTCACGCGTGGTACCTCTGGTCGTTACATAACTTACGGTAAATGGCCCG 180 Query 181 CCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 CCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATA 240 Query 241 GTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 GTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCC 300 Query 301 CACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGAC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 CACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGAC 360 Query 361 GGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 GGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGG 420 Query 421 CAGTACATCTACTCGAGGCCACGTTCTGCTTCACTCTccccatctcccccccctccccac 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 CAGTACATCTACTCGAGGCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCAC 480 Query 481 ccccAattttgtatttatttattttttaattattttGTGCAGCGATgggggcgggggggg 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 CCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGG 540 Query 541 ggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcgga 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 541 GGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGA 600 Query 601 gaggtgcggcggcagccaatcagagcggcgcgCTCCGAAAGTTTCCTTTTATggcgaggc 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 601 GAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGC 660 Query 661 ggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagcggGATCAGCCA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 661 GGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGCGGGATCAGCCA 720 Query 721 CCGCGGTGGCGGCCTAGAGTCGACGAGGAACTGAAAAACCAGAAAGTTAACTGGTAAGTT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 721 CCGCGGTGGCGGCCTAGAGTCGACGAGGAACTGAAAAACCAGAAAGTTAACTGGTAAGTT 780 Query 781 TAGTCTTTTTGTCTTTTATTTCAGGTCCCGGATCCGGTGGTGGTGCAAATCAAAGAACTG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 781 TAGTCTTTTTGTCTTTTATTTCAGGTCCCGGATCCGGTGGTGGTGCAAATCAAAGAACTG 840 Query 841 CTCCTCAGTGGATGTTGCCTTTACTTCTAGGCCTGTACGGAAGTGTTACTTCTGCTCTAA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 841 CTCCTCAGTGGATGTTGCCTTTACTTCTAGGCCTGTACGGAAGTGTTACTTCTGCTCTAA 900 Query 901 AAGCTGCGGAATTGTACCCGCGGCCGATCCACCGGTCTTAAGGGCCGAGGCGGCCAGATC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 901 AAGCTGCGGAATTGTACCCGCGGCCGATCCACCGGTCTTAAGGGCCGAGGCGGCCAGATC 960 Query 961 TTTCGAAGATATCGGCGCCGCTAGCGCGGCCGCATGGAGGCGACGCGGAGGCGGCAGCAC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 961 TTTCGAAGATATCGGCGCCGCTAGCGCGGCCGCATGGAGGCGACGCGGAGGCGGCAGCAC 1020 Query 1021 CTGGGAGCGACGGGCGGCCCAGGCGCGCAGCTGGGCGCCTCCTTCCTGCAGGCCAGGCAT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1021 CTGGGAGCGACGGGCGGCCCAGGCGCGCAGCTGGGCGCCTCCTTCCTGCAGGCCAGGCAT 1080 Query 1081 GGCTCTGTGAGCGCTGATGAGGCTGCCCGCACGGCTCCCTTCCACCTCGACCTCTGGTTC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1081 GGCTCTGTGAGCGCTGATGAGGCTGCCCGCACGGCTCCCTTCCACCTCGACCTCTGGTTC 1140 Query 1141 TACTTCACACTGCAGAACTGGGTTCTGGACTTTGGGCGTCCCATTGCCATGCTGGTATTC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1141 TACTTCACACTGCAGAACTGGGTTCTGGACTTTGGGCGTCCCATTGCCATGCTGGTATTC 1200 Query 1201 CCTCTCGAGTGGTTTCCACTCAACAAGCCCAGTGTTGGGGACTACTTCCACATGGCCTAC 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1201 CCTCTCGAGTGGTTTCCACTCAACAAGCCCAGTGTTGGGGACTACTTCCACATGGCCTAC 1260 Query 1261 AACGTCATCACGCCCTTTCTCTTGCTCAAGCTCATCGAGCGGTCCCCCCGCACCCTGCCA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1261 AACGTCATCACGCCCTTTCTCTTGCTCAAGCTCATCGAGCGGTCCCCCCGCACCCTGCCA 1320 Query 1321 CGCTCCATCACGTACGTGAGCATCATCATCTTCATCATGGGTGCCAGCATCCACCTGGTG 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1321 CGCTCCATCACGTACGTGAGCATCATCATCTTCATCATGGGTGCCAGCATCCACCTGGTG 1380 Query 1381 GGTGACTCTGTCAACCACCGCCTGCTCTTCAGTGGCTACCAGCACCACCTGTCTGTCCGT 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1381 GGTGACTCTGTCAACCACCGCCTGCTCTTCAGTGGCTACCAGCACCACCTGTCTGTCCGT 1440 Query 1441 GAGAACCCCATCATCAAGAATCTCAAGCCGGAGACGCTGATCGACTCCTTTGAGCTGCTC 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1441 GAGAACCCCATCATCAAGAATCTCAAGCCGGAGACGCTGATCGACTCCTTTGAGCTGCTC 1500 Query 1501 TACTATTATGATGAGTACCTGGGTCACTGCATGTGGTACATCCCCTTCTTCCTCATCCTC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1501 TACTATTATGATGAGTACCTGGGTCACTGCATGTGGTACATCCCCTTCTTCCTCATCCTC 1560 Query 1561 TTCATGTACTTCAGCGGCTGCTTTACTGCCTCTAAAGCTGAGAGCTTGATTCCAGGGCCT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1561 TTCATGTACTTCAGCGGCTGCTTTACTGCCTCTAAAGCTGAGAGCTTGATTCCAGGGCCT 1620 Query 1621 GCCCTGCTCCTGGTGGCACCCAGTGGCCTGTACTACTGGTACCTGGTCACCGAGGGCCAG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1621 GCCCTGCTCCTGGTGGCACCCAGTGGCCTGTACTACTGGTACCTGGTCACCGAGGGCCAG 1680 Query 1681 ATCTTCATCCTCTTCATCTTCACCTTCTTCGCCATGCTGGCCCTCGTCCTGCACCAGAAG 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1681 ATCTTCATCCTCTTCATCTTCACCTTCTTCGCCATGCTGGCCCTCGTCCTGCACCAGAAG 1740 Query 1741 CGCAAGCGCCTCTTCCTGGACAGCAACGGCCTCTTCCTCTTCTCCTCCTTCGCACTGACC 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1741 CGCAAGCGCCTCTTCCTGGACAGCAACGGCCTCTTCCTCTTCTCCTCCTTCGCACTGACC 1800 Query 1801 CTCTTGCTTGTGGCGCTCTGGGTCGCCTGGCTGTGGAATGACCCTGTTCTCAGGAAGAAG 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1801 CTCTTGCTTGTGGCGCTCTGGGTCGCCTGGCTGTGGAATGACCCTGTTCTCAGGAAGAAG 1860 Query 1861 TACCCGGGTGTCATCTACGTCCCTGAGCCCTGGGCTTTCTACACCCTTCACGTCAGCAGT 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1861 TACCCGGGTGTCATCTACGTCCCTGAGCCCTGGGCTTTCTACACCCTTCACGTCAGCAGT 1920 Query 1921 CGGCACTGAGTCTCTAGAAAGCTTATCGATACCGTCGACTAGAGCTCGCTGATCAGCCTC 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1921 CGGCACTGAGTCTCTAGAAAGCTTATCGATACCGTCGACTAGAGCTCGCTGATCAGCCTC 1980 Query 1981 GACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGAC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1981 GACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGAC 2040 Query 2041 CCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2041 CCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTG 2100 Query 2101 TCTGAGTAGGTGTCATTCTATTCTggggggtggggtggggCAGGACAGCAAGGGGGAGGA 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2101 TCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGA 2160 Query 2161 TTGGGAAGACAATAGCAGGCATGCTGGGGAGAGATCGATCTGAGGAACCCCTAGTGATGG 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2161 TTGGGAAGACAATAGCAGGCATGCTGGGGAGAGATCGATCTGAGGAACCCCTAGTGATGG 2220 Query 2221 AGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCG 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2221 AGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCG 2280 Query 2281 CCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAG 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2281 CCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAG 2340 Query 2341 TGG 2343 ||| Sbjct 2341 TGG 2343 Regarding claim 45: Copending claim 32 teaches the pharmaceutically acceptable excipient comprises a non-ionic, low-osmolar compound, a buffer, a polymer, a salt, or a combination thereof and thus anticipates the instant claim 45. Thus claims 1 and 32 of copending ‘188 anticipate the invention as claimed. Response to Arguments The responses are directed to the Arguments filed 12/19/2025. Regarding Arguments directed to the Objections: Applicant's arguments filed on 12/19/2025 have been fully considered and they are persuasive. Specifically, Claim 1 is cancelled and objections drawn to the cancelled claim are moot and therefore withdrawn. Regarding Arguments directed to 35 USC § 112(a): Applicant's arguments filed on 12/19/2025 have been fully considered and they are persuasive. Specifically, claims 16 and 16 are cancelled and rejections drawn to the cancelled claims are moot and therefore withdrawn. Regarding Arguments directed to 35 USC § 102: Applicant's arguments filed on 12/19/2025 have been fully considered and they are persuasive. Specifically, the amendment to claim 11 incorporating the limitation “Seq ID NO: 4” overcomes the rejection and the rejection is withdrawn. In response to arguments relevant to the instant rejection under 102: Applicant argues that because Mole et al does not disclose the exact sequence of Seq ID NO:4 as recited in amended claim 11, the claim-recited nucleotide sequence of Seq ID NO: 4 is not expressly or inherently anticipated by the cited references (p5/6 ¶5/1 Remarks). As discussed supra in the instant rejection under 102/103: Regarding Seq ID NO: 4: the instant specification teaches Seq ID NO: 4 discloses the nucleotide sequence of the gene cassette of scAAV9.CB.CLN6 (p14 [0057]; figure 13). As evidenced by Cain, the scAAV9.CB.CLN6 construct used in the clinical trial NCT02725580 (the same clinical trial disclosed by Mole) is disclosed by Figure S1A (p1842 col1 ¶2 of Cain). As shown in Figure S1A of Cain (below), scAAV9.CB.CLN6 as taught by Cain (and used in the clinical trial and as taught by Mole) comprises the identical structure as scAAV9.CB.CLN6 of the instant disclosure. It would be reasonable for one of ordinary skill in the art to consider the vector disclosed by Cain and Mole, which comprises an expression cassette with the identical name and structure as that disclosed by the instant Seq ID NO:4, and shares inventors with the instant disclosure, to be substantially similar, if not identical to the expression cassette disclosed by the instant Seq ID No: 4. Thus, if Seq ID No:4 is not anticipated by the disclosure of Mole as evidenced by Cain, it would be rendered obvious. MPEP reads "When the PTO shows a sound basis for believing that the products of the applicant and the prior art are the same, the applicant has the burden of showing that they are not. In re Spada, 911 F.2d 705, 709, 15 USPQ2d 1655, 1658 (Fed. Cir. 1990). See MPEP §§ 2112 - 2112.02”. The Patent and Trademark Office is not equipped to conduct experimentation in order to determine whether or not applicants' expression cassette scAAV9.CB.CLN6 as taught by Seq ID NO: 4 differs and if so to what extent, from the expression cassette scAAV9.CB.CLN6 taught by Mole. Accordingly, it has been established that the prior art expression cassette, which has the same name, structure and inventive group, and shares the property of delivering the CLN6 gene by a self-complementary AAV9 for enzyme replacement therapy for CLN6-Batten disease, demonstrates a reasonable probability that it is either identical or sufficiently similar to the claimed expression cassette scAAV9.CB.CLN6 (as disclosed by the instant Seq ID NO: 4) that whatever differences exist are not patentably significant. Therefore, the burden of establishing novelty or unobviousness by objective evidence is shifted to Applicant. Merely because a characteristic of a known expression cassette is not disclosed in a reference does not make the known expression cassette patentable. The new expression cassette possesses inherent characteristics which might not be displayed in the tests used the reference. Clear evidence that the scAAV9.CB.CLN6 construct of the cited prior art does not possess a critical characteristic that is possessed by the claimed scAAV9.CB.CLN6 construct as disclosed by Seq ID NO: 4 would advance prosecution and might permit allowance of claims to applicants' nucleic acid molecule. Regarding Arguments directed to 35 USC § 103: The amendment to claim 11 incorporating the limitation “Seq ID NO: 4” overcomes the rejection under 103 and the rejection is withdrawn. Regarding Arguments directed to the nonstatutory double patenting: Applicant's arguments filed on 12/19/2025 have been fully considered and they are persuasive. Specifically, the amendment to claim 11 incorporating the limitation “Seq ID NO: 4” overcomes the rejection and the nonstatuatory double patenting and the rejection is withdrawn. Conclusion No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ANDREA LYNNE MORRIS SPENCER whose telephone number is (571)272-3328. The examiner can normally be reached Monday-Friday 9:00-5:00. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, James (Doug) Schultz can be reached at 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ANDREA LYNNE MORRIS SPENCER/Examiner, Art Unit 1631 /TAEYOON KIM/Primary Examiner, Art Unit 1631
Read full office action

Prosecution Timeline

Jul 22, 2022
Application Filed
Oct 01, 2025
Non-Final Rejection mailed — §102, §103, §DP
Dec 19, 2025
Response Filed
May 18, 2026
Final Rejection mailed — §102, §103, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12702730
ENGINEERED CARTILAGE
4y 3m to grant Granted Aug 11, 2026
Patent 12606833
MODIFIED MINI-NUCLEOSOME CORE PROTEINS AND USE IN NUCLEIC ACID DELIVERY
3y 6m to grant Granted Apr 21, 2026
Study what changed to get past this examiner. Based on 2 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
22%
Grant Probability
58%
With Interview (+35.7%)
3y 10m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 9 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month