Prosecution Insights
Last updated: May 29, 2026
Application No. 17/428,670

TXNIP AND LDHB COMPOSITIONS AND METHODS FOR THE TREATMENT OF DEGENERATIVE OCULAR DISEASES

Final Rejection §103§DOUBLEPATENT
Filed
Aug 05, 2021
Priority
Feb 11, 2019 — provisional 62/803,680 +1 more
Examiner
KIM, TAEYOON
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
President and Fellows of Harvard College
OA Round
4 (Final)
52%
Grant Probability
Moderate
5-6
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allowance Rate
453 granted / 879 resolved
-8.5% vs TC avg
Strong +51% interview lift
Without
With
+51.4%
Interview Lift
resolved cases with interview
Typical timeline
3y 9m
Avg Prosecution
56 currently pending
Career history
954
Total Applications
across all art units

Statute-Specific Performance

§101
1.5%
-38.5% vs TC avg
§103
58.1%
+18.1% vs TC avg
§102
7.0%
-33.0% vs TC avg
§112
10.5%
-29.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 879 resolved cases

Office Action

§103 §DOUBLEPATENT
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s amendment and response filed on 3/16/2026 has been received and entered into the case. It is noted that applicant’s election without traverse of Group I and 35-37) and nucleotides 2023-2514 of SEQ ID NO:26 (hRedO) and nucleotides 2521- 3714 of SEQ ID NO:26 (TXNIP) in the reply filed on 11/21/2024 was acknowledged. Claims 2-9, 11-25, 27-32, 34, 38-41 and 43-49 have been canceled, claims 10 and 42 have been withdrawn from consideration as being drawn to non-elected subject matter, and claims 1, 26, 33, 35-37 have been considered on the merits. All arguments have been considered. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1, 33 and 35-37 are rejected under 35 U.S.C. 103 as being unpatentable over Li et al. (2008, Vision Research; of record) in view of Wang et al. (2016, Cell Reports; of record), Neitz et al. (US2014/0080900; of record) and Ye et al. (2016, Human Gene Therapy; of record). Regarding claims 1 and 33, Li et al. teach a recombinant AAV vector comprising a human red opsin (hRedO) promoter for cone-specific expression of GFP (see entire document). Li et al. teach that the rAAV vector has significant implications for the therapy of retinal degenerations that primarily affect cone photoreceptors, and these include retinitis pigmentosa (p.337, 2nd col., 1st para.), suggesting that the rAAV having hRedO promoter would be used for targeted delivery of any desired gene to cone photoreceptor cells (see Discussion at p.336-337). Thus, the rAAV vector of Li et al. comprising hRedO promoter and nucleic acid encoding GFP contains an expression cassette for GFP, i.e. GFP rAAV cassette (see Fig. 1). It is noted that Figure 1 of Li et al. has a figure legend that is incorrect as the diagram A is for human L/M cone opsin promoter driving GFP (pR2.1-FGFP) rAAV cassette, not the diagram B. Li et al. do not teach the AAV expression cassette comprising a nucleic acid molecule encoding TXNIP. Wang et al. teach that mutations in rod-specific genes in retinitis pigmentosa (RP) lead to diminished peripheral vision and dark adaption, and with rod degeneration, cone photoreceptors begin to lose function, and this diminished cone function is highlighted by loss of functional structures, including visual pigment-rich outer segments (OSs) and mitochondrial-rich inner segments (ISs). Wang et al. teach that the persistence of dormant cones in RP patients and animal models raises the possibility that endogenous pathways for IS assembly and OS synthesis might be subject to reactivation in these cone cells (p.373, Introduction). Wang et al. teach that impaired glucose transport to photoreceptors in the RP retina causes cone dormancy, and direct injection of glucose into the subretinal space restored cone OS synthesis in the absence of rods (p.374, 1st col.). Wang et al. teach that the glucose induces thioredoxin-interacting protein (TXNIP), the most highly glucose-inducible gene identified to date, regulates Akt activity to divert cells toward aerobic glucose metabolism and fatty acid synthesis (p.374, 1st col.). Wang et al. concluded that glucose induction of TXNIP is key to regulating Akt activity and directing glucose metabolism toward OS synthesis (p.374, 1st col.). These teachings indicate that TXNIP induced by glucose injection in the retina would reactivate dormant cone cells to synthesize OS. It would have been obvious to a person skilled in the art to engineer the rAAV vector taught by Li et al. in order to express TXNIP of Wang et al. in an animal model of retinitis pigmentosa with a reasonable expectation of success. A person of ordinary skilled in the art would have been motivated to do so because based on the teachings of Wang et al., one skilled in the art would recognize the role of TXNIP expression necessary for aerobic glucose metabolism and cone outer segment regeneration in an animal model of RP. As Wang et al. show the recovery of the lost function of the cone cells by replacing rod cells or injection of glucose and the importance of TXNIP for such recovery, it would have been reasonable to a person skilled in the art to test whether or not the overexpression of TXNIP in cone cells of the RP animal model would necessarily and sufficiently reactivate cone cells, and thus, to produce the same effect as the glucose injection and/or rod cell transplantation. For such a purpose, one skilled in the art would recognize that the AAV vector of Li et al. is suitable for a cone-specific expression of a transgene, and thus, the use of the AAV vector of Li et al. to express TXNIP in cone cells would be within the purview of the artisan in the field with a reasonable expectation of success. Regarding the limitation directed to the nucleic acid molecule encoding TXNIP being nucleotides 2521-3714 of SEQ ID NO:26 (previously in claim 16), it is noted that the corresponding nucleotides encode mouse TXNIP (see alignment below; the claimed sequence vs. Mus musculus Txnip, transcript variant 1, mRNA (see attached). RESULT 1 US-17-428-670-3_f280_t1473 Query Match 42.6%; Score 1194; DB 1; Length 1194; Best Local Similarity 100.0%; Matches 1194; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 280 ATGGTGATGTTCAAGAAGATCAAGTCTTTTGAGGTGGTCTTCAACGACCCCGAGAAGGTG 339 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGGTGATGTTCAAGAAGATCAAGTCTTTTGAGGTGGTCTTCAACGACCCCGAGAAGGTG 60 Qy 340 TACGGCAGCGGGGAGAAGGTGGCCGGACGGGTAATAGTGGAAGTGTGTGAAGTTACCCGA 399 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 TACGGCAGCGGGGAGAAGGTGGCCGGACGGGTAATAGTGGAAGTGTGTGAAGTTACCCGA 120 Qy 400 GTCAAAGCCGTCAGGATCCTGGCTTGCGGCGTGGCCAAGGTCCTGTGGATGCAAGGGTCT 459 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GTCAAAGCCGTCAGGATCCTGGCTTGCGGCGTGGCCAAGGTCCTGTGGATGCAAGGGTCT 180 Qy 460 CAGCAGTGCAAACAGACTTTGGACTACTTGCGCTATGAAGACACACTTCTCCTAGAAGAG 519 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CAGCAGTGCAAACAGACTTTGGACTACTTGCGCTATGAAGACACACTTCTCCTAGAAGAG 240 Qy 520 CAGCCTACAGCAGGTGAGAACGAGATGGTGATCATGAGGCCTGGAAACAAATATGAGTAC 579 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 CAGCCTACAGCAGGTGAGAACGAGATGGTGATCATGAGGCCTGGAAACAAATATGAGTAC 300 Qy 580 AAGTTCGGCTTCGAGCTTCCTCAAGGGCCCCTGGGAACATCCTTTAAAGGAAAATATGGT 639 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 AAGTTCGGCTTCGAGCTTCCTCAAGGGCCCCTGGGAACATCCTTTAAAGGAAAATATGGT 360 Qy 640 TGCGTAGACTACTGGGTGAAGGCTTTTCTCGATCGCCCCAGCCAGCCAACTCAAGAGGCA 699 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 TGCGTAGACTACTGGGTGAAGGCTTTTCTCGATCGCCCCAGCCAGCCAACTCAAGAGGCA 420 Qy 700 AAGAAAAACTTCGAAGTGATGGATCTAGTGGATGTCAATACCCCTGACCTAATGGCACCA 759 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 AAGAAAAACTTCGAAGTGATGGATCTAGTGGATGTCAATACCCCTGACCTAATGGCACCA 480 Qy 760 GTGTCTGCCAAAAAGGAGAAGAAAGTTTCCTGCATGTTCATTCCTGATGGACGTGTGTCA 819 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GTGTCTGCCAAAAAGGAGAAGAAAGTTTCCTGCATGTTCATTCCTGATGGACGTGTGTCA 540 Qy 820 GTCTCTGCTCGAATTGACAGAAAAGGATTCTGTGAAGGTGATGACATCTCCATCCATGCT 879 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 GTCTCTGCTCGAATTGACAGAAAAGGATTCTGTGAAGGTGATGACATCTCCATCCATGCT 600 Qy 880 GACTTTGAGAACACGTGTTCCCGAATCGTGGTCCCCAAAGCGGCTATTGTGGCCCGACAC 939 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 GACTTTGAGAACACGTGTTCCCGAATCGTGGTCCCCAAAGCGGCTATTGTGGCCCGACAC 660 Qy 940 ACTTACCTTGCCAATGGCCAGACCAAAGTGTTCACTCAGAAGCTGTCCTCAGTCAGAGGC 999 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 ACTTACCTTGCCAATGGCCAGACCAAAGTGTTCACTCAGAAGCTGTCCTCAGTCAGAGGC 720 Qy 1000 AATCACATTATCTCAGGGACTTGCGCATCGTGGCGTGGCAAGAGCCTCAGAGTGCAGAAG 1059 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 AATCACATTATCTCAGGGACTTGCGCATCGTGGCGTGGCAAGAGCCTCAGAGTGCAGAAG 780 Qy 1060 ATCAGACCATCCATCCTGGGCTGCAACATCCTCAAAGTCGAATACTCCTTGCTGATCTAC 1119 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 ATCAGACCATCCATCCTGGGCTGCAACATCCTCAAAGTCGAATACTCCTTGCTGATCTAC 840 Qy 1120 GTCAGTGTCCCTGGCTCCAAGAAAGTCATCCTTGATCTGCCCCTAGTGATTGGCAGCAGG 1179 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 GTCAGTGTCCCTGGCTCCAAGAAAGTCATCCTTGATCTGCCCCTAGTGATTGGCAGCAGG 900 Qy 1180 TCTGGTCTGAGCAGCCGGACATCCAGCATGGCCAGCCGGACGAGCTCTGAGATGAGCTGG 1239 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 TCTGGTCTGAGCAGCCGGACATCCAGCATGGCCAGCCGGACGAGCTCTGAGATGAGCTGG 960 Qy 1240 ATAGACCTAAACATCCCAGATACCCCAGAAGCTCCTCCTTGCTATATGGACATCATTCCT 1299 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 ATAGACCTAAACATCCCAGATACCCCAGAAGCTCCTCCTTGCTATATGGACATCATTCCT 1020 Qy 1300 GAAGATCACAGACTAGAGAGCCCCACCACCCCTCTGCTGGACGATGTGGACGACTCTCAA 1359 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 GAAGATCACAGACTAGAGAGCCCCACCACCCCTCTGCTGGACGATGTGGACGACTCTCAA 1080 Qy 1360 GACAGCCCTATCTTTATGTACGCCCCTGAGTTCCAGTTCATGCCCCCACCCACTTACACT 1419 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 GACAGCCCTATCTTTATGTACGCCCCTGAGTTCCAGTTCATGCCCCCACCCACTTACACT 1140 Qy 1420 GAGGTGGATCCGTGCGTCCTTAACAACAACAACAACAACAACAACGTGCAGTGA 1473 |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 GAGGTGGATCCGTGCGTCCTTAACAACAACAACAACAACAACAACGTGCAGTGA 1194 It would have been obvious to a person skilled in the art to engineer the rAAV vector of Li et al. to express mouse TXNIP in order to use the vector in a mouse with a reasonable expectation of success. A person of ordinary skilled in the art would have been motivated to do so because it is known in the art that rAAV vector comprising human L-opsin promoter can be used for expressing a mouse protein in a mouse according to Ye et al. Ye et al. teach that human L-opsin promoter can be used in cone-specific expression of transgene in a mouse model (Abstract). Regarding the hRedO promoter comprising nucleotides 2023-2514 of SEQ ID NO:26 (claim 1), Li et al. do not particularly teach the limitation. However, according to the sequence search of the nucleotide 2023-2514, the claimed nucleotide is identical to SEQ ID NO:1 of Neitz et al. as shown below. According to Neitz et al., SEQ ID NO:1 is L opsin promoter (para. 34), and Neitz et al. teach recombinant AAV carrying a human L-opsin gene (para. 172). It is known in the art that L-opsin and Red opsin are identical as confirmed by sequence alignment below. Thus, the teachings of Li et al. in view of Neitz et al. would meet the limitation. RESULT 2 US-14-075-415-1 (NOTE: this sequence has 3 duplicates in the database searched. See complete list at the end of this report) Sequence 1, US/14075415 Patent No. 9198595 GENERAL INFORMATION APPLICANT: Neitz, Jay APPLICANT: Neitz, Maureen TITLE OF INVENTION: Reagents and methods for modulating cone photoreceptor activity FILE REFERENCE: 10-1030-PCT CURRENT APPLICATION NUMBER: US/14/075,415 CURRENT FILING DATE: 2013-11-08 PRIOR APPLICATION NUMBER: 61/242587 PRIOR FILING DATE: 2009-09-15 NUMBER OF SEQ ID NOS: 51 SEQ ID NO 1 LENGTH: 494 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Query Match 100.0%; Score 492; Length 494; Best Local Similarity 100.0%; Matches 492; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GATCCGGTTCCAGGCCTCGGCCCTAAATAGTCTCCCTGGGCTTTCAAGAGAACCACATGA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2 GATCCGGTTCCAGGCCTCGGCCCTAAATAGTCTCCCTGGGCTTTCAAGAGAACCACATGA 61 Qy 61 GAAAGGAGGATTCGGGCTCTGAGCAGTTTCACCACCCACCCCCCAGTCTGCAAATCCTGA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 62 GAAAGGAGGATTCGGGCTCTGAGCAGTTTCACCACCCACCCCCCAGTCTGCAAATCCTGA 121 Qy 121 CCCGTGGGTCCACCTGCCCCAAAGGCGGACGCAGGACAGTAGAAGGGAACAGAGAACACA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 122 CCCGTGGGTCCACCTGCCCCAAAGGCGGACGCAGGACAGTAGAAGGGAACAGAGAACACA 181 Qy 181 TAAACACAGAGAGGGCCACAGCGGCTCCCACAGTCACCGCCACCTTCCTGGCGGGGATGG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 182 TAAACACAGAGAGGGCCACAGCGGCTCCCACAGTCACCGCCACCTTCCTGGCGGGGATGG 241 Qy 241 GTGGGGCGTCTGAGTTTGGTTCCCAGCAAATCCCTCTGAGCCGCCCTTGCGGGCTCGCCT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 242 GTGGGGCGTCTGAGTTTGGTTCCCAGCAAATCCCTCTGAGCCGCCCTTGCGGGCTCGCCT 301 Qy 301 CAGGAGCAGGGGAGCAAGAGGTGGGAGGAGGAGGTCTAAGTCCCAGGCCCAATTAAGAGA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 302 CAGGAGCAGGGGAGCAAGAGGTGGGAGGAGGAGGTCTAAGTCCCAGGCCCAATTAAGAGA 361 Qy 361 TCAGGTAGTGTAGGGTTTGGGAGCTTTTAAGGTGAAGAGGCCCGGGCTGATCCCACAGGC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 362 TCAGGTAGTGTAGGGTTTGGGAGCTTTTAAGGTGAAGAGGCCCGGGCTGATCCCACAGGC 421 Qy 421 CAGTATAAAGCGCCGTGACCCTCAGGTGATGCGCCAGGGCCGGCTGCCGTCGGGGACAGG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 422 CAGTATAAAGCGCCGTGACCCTCAGGTGATGCGCCAGGGCCGGCTGCCGTCGGGGACAGG 481 Qy 481 GCTTTCCATAGC 492 |||||||||||| Db 482 GCTTTCCATAGC 493 Regarding claim 35 directed to an AAV vector particle, Li et al. teach that the plasmid pR2.1-UF-2 (expressing cassette comprising hReO promoter) is packaged into recombinant virus along with helper plasmid DNA, and the recombinant AAV particles were purified from the human 293 cells (p.334, 2.2. Packaging of rAAV). Thus, it would have been obvious to a person skilled in the art that the rAAV virus comprising an expression cassette comprising hReO promoter and a nucleic acid encoding TXNIP (which replaces a nucleic acid encoding GFP) by using the same packaging process in order to isolate/purify the rAAV expressing TXNIP under the control of hReO promoter with a reasonable expectation of success. This teaching would also meet the cell comprising the AAV particle as claimed in claim 36. Regarding claim 37, the limitation is interpreted the same as claim 1 as the limitation of “pharmaceutical composition formulated for intraocular administration” does not additionally provide any structure other than the AAV composition. Thus, the combined teachings of Li et al. and Wang et al. would meet the limitation of claim 37. Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention. Claim(s) 26 is rejected under 35 U.S.C. 103 as being unpatentable over Li et al. in view of Wang et al., Neitz et al. and Ye et al. as applied to claims 1, 33 and 35-37 above, and further in view of Komaromy et al. (2008, Gene Therapy; of record) Regarding claim 26 directed to the expression cassette further comprising a polyadenylation signal, the rAAV vector of Li et al. contain pA1 (polyadenylation signal) (see Fig. 1). While Li et al. do not particularly disclose that “pA1” is a polyadenylation signal (Poly-A), however, the rAAV vector comprising human L/M cone opsin promoter driving GFP (pR2.1-GFP) is derived from pR2.1 plasmid, and the pR2.1 plasmid contains poly-A signal according to Komaromy et al. (see Fig. 2, below). PNG media_image1.png 99 888 media_image1.png Greyscale Li et al. Fig. 1 PNG media_image2.png 128 835 media_image2.png Greyscale Komaromy et al. Fig. 2 Furthermore, Ye et al. teach that the pR2.1 promoter was used the design of an AAV vector induces the capsid, enhancer, promoter, cDNA, polyadenylation sequence, and overall size of the DNA expression cassette (p.78, Discussion). Thus, it would have been obvious to a person skilled in the art that the plasmid utilized by Li et al. for cone-specific expression of TXNIP according to Wang et al. would inherently and necessarily contain a polyadenylation signal. Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1, 26, 33, 35-37 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1-3, 11, 16, 18, 20-22, 32, 39, 43, 45 of copending Application No. 18/017,093 (reference application) in view of Wang et al. (supra). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of the ‘093 application disclose a composition comprising an AAV expression cassette comprising a photoreceptor-specific promoter including hReO promoter and a nucleic acid molecule encoding a variant TXNIP. According to the sequence search, SEQ ID NO:16 of the ‘093 application, encoding hReO promoter, is identical to nucleotides 2023-2514 of SEQ ID NO:26 of the instant application (which is identical to SEQ ID NO:16 of the instant application). SEQ ID NO:115 of the ‘093 application, encoding TXNIP, has 99.1% identity to nucleotides 2521-3714 of SEQ ID NO:26 of the instant application. However, SEQ ID NO:115 of the ‘093 application is not 100% identical to nucleotide 2521-3714 of SEQ ID NO:26. As the SEQ ID NO:26 of the instant application is directed to mouse TXNIP (see 103 rejection for alignment), and claim 18 of the ’093 application discloses about 85% up to about 99% of SEQ ID NO:115, it would have been obvious to a person skilled in the art to have the TXNIP identical to the nucleotide 2521-3714 of SEQ ID NO:26 of the instant application. Thus, the SEQ ID NOs of ‘093 application would meet the sequences of SEQ ID NO:26 of the instant application encoding hReO promoter and TXNIP. Thus, the claims of the ‘093 application render the claims of the instant application obvious. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Response to Arguments Applicant's arguments filed 3/16/2026 have been fully considered but they are not persuasive. Regarding the 103 rejection to claims 1, 33 and 35-37, applicant stated that Wang teaches the opposite of the examiner’s discussion made in p.15 of the OA mailed on 12/17/2025 (i.e. the restoration of glucose transport and cone outer segment regeneration requires induction of Txnip) as Wang discloses that induction of TXNIP and cone OS regeneration requires glucose transport. It is acknowledged that the examiner’s statement was incorrect with regard to the restoration of glucose transport requires induction of Txnip and it should have been stated as “the restoration of glucose metabolism and cone outer segment regeneration requires induction of Txnip”. Regardless of this incorrect statement, however, it is the examiner’s position that it would have been obvious to a person skilled in the art to express Txnip in order to restore the glucose metabolism in the cones and the regeneration of outer segment of cones based on the teaching of Wang et al. using the recombinant AAV vector of Li et al. Applicant alleged that in view of the glucose deficiency because of glucose being sequestered in the RPE and unable to reach and induce TXNIP, one skilled in the art would expect that increasing the level of TXNIP would have little or no therapeutic effect in RP because the upstream metabolite glucose is absent or significantly reduced. It is acknowledged that glucose transport is required for induction of TXNIP, however, the rationale of the claim rejection is based on the use of TXNIP bypassing glucose transport. The rationale of making an AAV vector expressing TXNIP discussed in the claim rejection does not state that TXNIP expression would necessarily and sufficiently treat RP. The rationale of making this construct to express TXNIP is to test whether or not TXNIP expression which is induced by glucose transport can bypass the glucose in cone OS regeneration shown by glucose injection. It is reminded that the claims are directed to the product not the method of using the product, and in order to test if TXNIP expression is sufficient to regenerate cone OS regeneration, one skilled in the art would use the AAV vector of Li et al. to produce a construct to express TXNIP with a reasonable expectation of success. Applicant alleged that applicant has surprisingly discovered that intraocular delivery of AAV gene therapy vectors comprising TXNIP prolong survival of cones in RP-mutant mice, and this EXNIP-mediated effect was only observed when TXNIP was specifically expressed in cones. Applicant did not provide any discussion how the alleged outcome is considered unexpected and surprising. Rather, based on the teachings from Wang et al., the importance of TXNIP in restoration of cone outer segment is known, and thus, it is expected that the expression of Txnip in cone would produce a positive outcome in restoring the glucose metabolism and the structure of the cone outer segment. Applicant is advised to provide any evidence supporting the alleged unexpected results preferably in the form of a declaration for further consideration. Applicant stated that multiple AAV vectors expressing various genes for treating retinitis pigmentosa were tested and among all the AAV vectors tested, only TXNIP was able to delay cone degeneration and/or improve cone survival in rd1 mice. While the evidence provided in the instant specification appears to provide convincing evidence that TXNIP expression would delay or improve cone survival in rd1 mice compared to other genes according to Example 1, however, there is no reason to consider that the genes tested along with TXNIP are expected to produce the same effect as TXNIP, particularly, based on the teaching of Wang et al. showing the function of TXNIP in glucose metabolism and the cone regeneration. In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). Based on the above discussion, it is the Examiner’s position that the combined teachings of the cited references render the claimed invention obvious. Regarding the double patenting rejection, as the provisional double patenting rejection is not the only rejection remaining in the prosecution, the holding of the rejection is a must. Conclusion No claims are allowed. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to TAEYOON KIM whose telephone number is (571)272-9041. The examiner can normally be reached 9-5 EST Monday-Friday. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JAMES SCHULTZ can be reached at 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /TAEYOON KIM/ Primary Examiner, Art Unit 1631
Read full office action

Prosecution Timeline

Show 2 earlier events
May 02, 2025
Response Filed
May 23, 2025
Final Rejection mailed — §103, §DOUBLEPATENT
Aug 21, 2025
Response after Non-Final Action
Sep 18, 2025
Request for Continued Examination
Sep 24, 2025
Response after Non-Final Action
Dec 17, 2025
Non-Final Rejection mailed — §103, §DOUBLEPATENT
Mar 16, 2026
Response Filed
Apr 24, 2026
Final Rejection mailed — §103, §DOUBLEPATENT (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12637693
ANELLOSOMES AND METHODS OF USE
4y 11m to grant Granted May 26, 2026
Patent 12594301
COMPOSITIONS AND METHODS FOR TREATMENT OF LIQUID CANCERS
4y 0m to grant Granted Apr 07, 2026
Patent 12583894
MATERIALS AND METHODS FOR THE TREATMENT OF LEWY BODY DISORDERS
5y 5m to grant Granted Mar 24, 2026
Patent 12582699
COMPOSITIONS AND METHODS FOR ENHANCED LYMPHOCYTE-MEDIATED IMMUNOTHERAPY
4y 7m to grant Granted Mar 24, 2026
Patent 12582724
Compositions and Methods for the Treatment of Genetic Diseases
4y 7m to grant Granted Mar 24, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

5-6
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+51.4%)
3y 9m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 879 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month