DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim(s) 1, 21, 24, 96-97, and 102 are pending.
Applicant’s arguments filed 05/27/2025 have been thoroughly reviewed, but are not persuasive for the reasons that follow. Any rejections and objections not reiterated in this action have been withdrawn. This action is FINAL.
Election/Restrictions
Applicant’s election without traverse of Group I (claim(s) 1-2, 21, 24, and 96-97), drawn to a chemically modified CD33-targeting gRNA, in the reply filed on 12/03/2024 is acknowledged.
Applicant’s election without traverse of species that includes (1) The chemically modified guide RNA of claim 1, wherein (m) the guide sequence comprises the nucleic acid sequence mG*mU*mC*AGUGACGGUACAGGA (SEQ ID NO: 2), wherein m indicates a 2'-O-methyl modification, and wherein * indicates a phosphorothioate modification the modified nucleic acid of SEQ ID NO: 1; and (2) SEQ ID NO: 1 for the guide sequence from claim 21. The election reads on Group I claims 1-2, 21, 24, and 96-97. Election was made without traverse in the reply filed on 12/03/2024.
The species (1) The chemically modified guide RNA of claim 1, selected from the modification or nucleic acid sequences as listed items (a) through (r) from claim 2, and (2) the guide sequence selected from SEQ ID NO: 1 and 16 from claim 21, were rejoined and are reintroduced into examination in the previous action filed 02/27/2025.
Claims 29-30, 41, 53, 60, 65-66, 69-70, 77-78, 81-82, and 87 were withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected subject matter, there being no allowable generic or linking claim.
Newly added claim 102 of the current claim set filed 05/27/2025, reads on Group I.
Claim(s) 1, 21, 24, 96-97, and 102 are under consideration.
Priority
Acknowledgement is made that this application is a 371 of PCT/US2020/019370, filed 02/21/2020, which claims priority based on a provisional application filed as 62/809,448 on 02/22/2019.
All claims are given the priority date of 02/22/2019.
Drawings
The drawings (replacement sheets) were received on 05/27/2025. These drawings are accepted.
Response to Arguments – Nucleotide and/or Amino Acid Sequence Disclosure
The lack of compliance with ST.25 for the Nucleotide and/or Amino Acid Sequence Disclosure, i.e., a lack of SEQ ID NOs corresponding to specifically defined an enumerated nucleotide sequences in FIGs. 1C, 1D, 1L, and 12, has been remedied through Applicant supplying replacement drawings filed 05/27/2025.
Acknowledgement is made of Applicant submitting a Sequence listing, filed 05/27/2025, and a corresponding SEQUENCE LISTING statement with the ASCII text file and its corresponding size in bytes.
Response to Arguments – Specification
The previous objection to the specification for containing embedded hyperlinks and/or other forms of browser-executable code, recited in (1) pg. 81, line 22; (2) pg. 89, line 16; and (3) pg.90, line 20, has been withdrawn in view of Applicant’s amendments filed 05/27/2025.
Claim Rejections - 35 USC § 112(b) - Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim(s) 1, 24, and 96-97 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. This is a new rejection necessitated by amendment(s) to the claim(s) in the reply filed on 05/27/2025.
Claim 1 recites, “wherein the crRNA portion and/or the tracrRNA portion comprise(s) one or more modified nucleotides, and the guide sequence comprises the nucleic acid sequence of SEQ ID NO: 2. . . .” According to the claim recitation and sequence listing, the sequence of SEQ ID NO: 2 contains 2’-O-methyl modification and phosphorothioate modification at positions 1-3. With the “and/or” phrase, the claim language suggests that the modified sequence of SEQ ID NO: 2 is not required when the tracrRNA portion comprises one or modified nucleotides.
Thus, the metes and bounds of claim 1 and dependent claim 24 are unclear.
Claim 96 recites, “wherein the guide sequence comprises the nucleic acid sequence of SEQ ID NO: 2.” According to the sequence listing, the sequence of SEQ ID NO: 2 contains 2’-O-methyl modification and phosphorothioate modification at positions 1-3. Claim 96 also recites, “wherein the crRNA portion and/or the tracrRNA portion comprise(s) one or more modified nucleotides.” This phrase suggests that the modified sequence of SEQ ID NO: 2 is not required when the tracrRNA portion comprises one or modified nucleotides.
Thus, the metes and bounds of claim 96 and dependent claim 97 are unclear.
Response to Arguments - Claim Rejections - 35 USC § 112(b) – Indefiniteness
The previous rejection of claim(s) 24 and 97 under 35 U.S.C 112(b) for reciting the trademark/trade name SpyFi™ has withdrawn in view of Applicant’s amendments to the claims filed 05/27/2025.
Claim Rejections - 35 USC § 112(d) – Improper Claim Dependency
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 102 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 102 depends from claim 1 and recites, “wherein the guide sequence consists of the nucleic acid sequence GUCAGUGACGGUACAGGA (SEQ ID NO: 1).” Claim 1 states, “the guide sequence comprises the nucleic acid sequence mG*mU*mC*AGUGACGGUACAGGA (SEQ ID NO: 2), wherein m indicates a 2’-O-methyl modification and wherein * indicates a phosphorothioate modification.” Claim 102 does not include all of the limitations of the claim from which it depends, because the chemical modifications present in SEQ ID NO: 2 are excluded from the scope of the claim.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Response to Arguments - Claim Rejections - 35 USC § 112(d) – Improper Claim Dependency
The previous rejection of claim 2 35 U.S.C 112(d) for improper claim dependency is moot in view of Applicant’s cancellation of the claim filed 05/27/2025.
Claim Rejections - 35 USC § 103 – Obviousness
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claim(s) 1, 21, 24, and 96-97, are rejected under 35 U.S.C. 103 as being unpatentable over Gill et al (WO 2017/079400 A1; cited on IDS 11/17/2023) in view of Bolen et al (WO 2018/160768 A1; cited on PTO 892 filed 02/27/2025). This rejection was made in the Office Action Filed on 02/27/2025 and has been rewritten to address the amendment to the claims in the reply filed on 05/27/2025.
Regarding claim 1, 24, and 96-97, Gill et al is drawn to an invention related to compositions and methods of generating modified hematopoietic stem or progenitor cells (Abstract).
Gill et al teaches that CRISPR system comprises a Cas9 protein complexed with a guide nucleic acid sequence specific for the endogenous gene wherein the endogenous gene encodes CD33 (pg. 2, lines 26-33).
Gill et al teaches that the guide RNA (gRNA) sequence can be specific for any endogenous gene that is involved in chimeric antigen receptor (CAR) T cell therapy targeting antigens such as CD33 and wherein the gRNA is specific for endogenous gene that encodes CD33 (pg. 24, lines 6-11).
Gill et al teaches that CRISPR/Cas system comprises spacer sequences integrated, transcribed and processed into CRISPR RNAs or crRNAs that anneal to trans-activating crRNAs or tracrRNAs (i.e. interpreted as tracrRNA binding and complementary to the spacer sequence of the crRNA and thereby rendering it an anti-repeat sequence) (pg. 12, lines 21-23).
Gill et al teaches that a seed target recognition sequence (i.e. capable of binding or hybridizing the target gene) is located within the crRNA and a conserved PAM motif (pg. 12, lines 25-27).
Gill et al teaches that CRISPR/Cas system comprises palindromic repeats or short repetition of base sequences that is followed by the spacer region (i.e. indicating the conserved repeat sequence in the crRNA/tracrRNA of gRNA acquired in the bacterial CRISPR system) (pg. 12, lines 14-20).
Gill et al teaches that crRNA-tracrRNA within gRNA contribute to direct Cas9 to cleave sequence of interest (i.e. the endogenous gene encoding CD33) (pg. 12, lines 28-29).
Gill et al teaches that molecules and cells used in the invention for editing the target gene can be modified in many ways including chemically, structurally and functionally and cells can be modified through introduction of nucleic acids (pg. 15, lines 27-30).
Gill et al teaches that the CRISPR system comprises a Cas9 protein complexed with a guide nucleic (reading on the combination of tracrRNA and crRNA, as taught above) acid sequence specific for the endogenous gene (i.e. CD33) (pg. 2, lines 26-27; and Fig. 9A).
PNG
media_image1.png
124
752
media_image1.png
Greyscale
PNG
media_image2.png
364
762
media_image2.png
Greyscale
Regarding claim 1 and 21, Gill et al teaches the base gRNA sequence of SEQ ID NO: 2 (underlined in the figure below) and SEQ ID NO: 16 (highlighted by the dashed box in the figure below) with 100% sequence identity for targeting or knocking out CD33 (pg. 46, lines 21-23; FIG. 4C; see SEQ ID search results; see image below).
Gill et al does not teach the crRNA portion or chemically modified gRNA comprising modified nucleotides.
Bolen et al is drawn to an invention related to compositions, methods, and kits for use in treating hematopoietic malignancies and targeting cells expressing a lineage-specific cell-surface protein (Abstract).
Bolen et al teaches that the CRISPR/Cas9 system hybridizes with a target sequence in a lineage specific protein polynucleotide, where the CRISPR/Cas9 system comprises a Cas9 nuclease and an engineered crRNA/tracrRNA or single guide RNA (sgRNA) (pg. 42, paragraph 2).
Bolen et al teaches that the gRNA of the CRISPR/Cas9 system hybridizes to the nucleotide sequence encoding lineage-specific cell-surface protein or CD33 (pg. 42, paragraph 1).
Bolen et al teaches that all designed, synthetic sgRNAs were chemically modified nucleotides at three terminal positions at both the 5’ and 3’ ends wherein modified nucleotides contain 2'-0-methyl-3'-phosphorothioate (pg. 64, paragraph 4).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to substitute the chemically modified CD33-gRNA (i.e., CD-33 gRNA chemically modified at the three terminal nucleotide positions at the 5’ end wherein modified nucleotides contain 2'-0-methyl-3'-phosphorothioate) or the crRNA portion as taught by Bolen et al with the CD33-gRNA of Gill et al, to yield the chemically modified CD33-targeting guide RNA (of claim 1). One would have had a reasonable expectation of success because both references teach gene editing systems targeting cell surface proteins such as CD33.
Therefore, since Bolen et al teaches a CRISPR/Cas9 mediated gene editing approach using gRNA with three modified 5’ nucleotides (2’MOE modifications interspaced with phosphorothioate bonds) and Gill et al teaches the method of generating modified hematopoietic stem or progenitor cells using CRISPR/Cas9 system comprising crRNA-tracrRNA within gRNA and by targeting endogenous gene encoding CD33, substituting the chemically modified gRNA or the crRNA portion comprising modified nucleotides of Bolen et al for the gRNA or the crRNA portion of Gill et al, would have resulted in the predicable outcome of success.
Accordingly, claim(s) 1, 21, 24, and 96-97 are unpatentable over Gill et al in view of Bolen et al.
Claim 102 is rejected under 35 U.S.C. 103 as being unpatentable over Gill et al (WO 2017/079400 A1; cited on IDS 11/17/2023) in view of Bolen et al (WO 2018/160768 A1; cited on PTO 892 filed 02/27/2025) as applied to claim 1 above, and further in view of Fu et al (Improving CRISPR-Cas nuclease specificity using truncated guide RNAs, Nat Biotechnol, Vol 32, Issue 3, page 279-284, Published January 26th, 2014).
Gill et al and Bolen et al do not teach 18 nucleotides in the guide strand.
Regarding claim 102, Fu et al teaches, “[W]e and others, have shown that lengthening the 5' end of the complementary region can reduce on-target editing efficiency, with some of these longer gRNAs processed back to standard length in human cells. In contrast, certain gRNAs bearing either truncations or progressively greater numbers of mismatches at the 5' end of their complementarity targeting regions have been shown to retain robust Cas9-mediated on-target cleavage activities. We hypothesized that these 5'-end nucleotides might not be necessary for full gRNA activity and that these nucleotides might normally compensate for mismatches at other positions along the gRNA-target DNA interface; therefore, we reasoned that shorter gRNAs might be more sensitive to mismatches and thus more specific (Supplementary Fig. 1).
. . .
[T]o extend the generality of these findings, we assayed full-length gRNAs and matched gRNAs with 18, 17 and/or 16 nucleotides of complementarity to four additional EGFP reporter gene sites (EGFP sites #1, #2, #3 and #4; Fig. 1c). For all four target sites, gRNAs with 17 and/or 18 nucleotides of complementarity functioned as efficiently as (or, in one case, more efficiently than) their matched full-length counterparts (Fig. 1c).”, (see page 2, paragraph 2 and 3; see Figure 1C and 1D below).
PNG
media_image3.png
442
624
media_image3.png
Greyscale
PNG
media_image4.png
598
676
media_image4.png
Greyscale
Further, Fu et al teaches, “Our findings have several important implications for how to choose potential RGN target sites. The use of shorter gRNAs does not decrease the targeting range of the platform because target sites with 17 or 18 nts of complementarity will each occur in random DNA with frequencies equal to those with 20 nts of complementarity. Our results show that trugRGNs generally appear to induce very low or undetectable levels of mutagenesis at off target sites with as few as one or two mismatches and suggest that sites with three or more mismatches will not have mutations at high frequencies, if at all. Thus, a reasonable strategy for choosing target sites to minimize off-target effects might be to choose tru-gRNA target sites that are unique in the genome and that have the smallest possible number of potential off-target sites with 1 or 2 mistmatches.”, (see page 5, paragraph 4).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the chemically-modified guide strand (as taught in combination from Gill et al and Bolen et al above) to contain 18 nucleotides, instead of 20, as taught by Fu et al, to arrive at the claimed invention of a guide strand consisting of SEQ ID NO: 1 (claim 102). One would have had a reasonable expectation of success because Fu et al teaches (1) truncating the typical “20 nucleotide” guide RNAs to 17-18 nucleotides does not decrease the targeting range, (2) the truncated guides induce very low or undetectable levels of mutagenesis at off target sites, and (3) when an 18-base-pair guide targets the same location as a 20-base-pair guide (e.g., Figure 1C and 1D) the 18-base-pair guide is equal to or out performs the 20-base-pair guide. Thus, one would be motivated to have use an 18-base-pair nucleotide guide sequence to maintain optimal guide efficiency and reduce indel frequency.
Accordingly, claim 102 is unpatentable over Gill et al in view of Bolen et al in further view of Fu et al.
Response to Arguments - Claim Rejections - 35 USC § 103 – Obviousness
The rejection of claim 2 under 35 U.S.C 103 is moot in view of Applicant’s cancellation of the claims in the reply filed 05/27/2025.
With respect to the rejection of claim(s) 1, 21, 24, and 96-97, under 35 U.S.C. 103, Applicant's arguments at page 16 of the reply filed 05/27/2025 have been fully considered but they are not persuasive.
Regarding claim(s) 1 and 24 –
Applicant contends that amended claim(s) 1 and 24 are not obvious over Gill and Bolen, and that the Examiner “does not identify, nor does Gill or Bolen disclose, individually or in combination, a guide sequence comprising the nucleic acid sequence of SEQ ID NO:2.” Applicant is reminded that SEQ ID NO: 2 was originally recited in, now cancelled, claim 2. In the office action, filed 02/27/2025, independent claim 1 did not include this limitation. However, Gill et al in view of Bolen et al, does teach a guide RNA comprising SEQ ID NO: 2, and the 35 U.S.C. 103 rejection above has been rewritten to include this newly added limitation. Thus, the argument provided has drawn merely conclusory statements, but has not provided substantial reasoning as to why Gill et al in view of Bolen et al are not obvious over claim(s) 1 and 24.
Regarding claim 21 –
Applicant contends that claim 21 is not obvious over Gill and Bolen. Applicant disagrees that Gill et al does not teach SEQ ID NO: 16, and that the Examiner’s reasoning was factually incorrect based on the recited “Consisting of”.
PNG
media_image5.png
124
752
media_image5.png
Greyscale
Applicant states, “Gill’s description of the gRNA sequence in FIG. 4C does not consist of the guide sequence of SEQ ID NO: 16. At best, FIG 4 identifies a CD33-gRNA having the sequence GAGAGUCAGUGACGGUACAGGA, which includes a GA extension at the 5’ end. . . .” The sequence in question is seen below. The examiner respectfully disagrees with sequence provided by the Applicant arguing the GA extension at the 5’ end. Encompassed in the dotted box below is SEQ ID NO: 16. Gill et al teaches that this region is the CD33-gRNA, made obvious by the line over the sequence. There is no GA 5’ extension in addition to SEQ ID NO: 16 (GAGUCAGUGACGGUACAGGA) presented in Fig 4C. There is a 5’ GCAG but that is outside of the described CD33-gRNA region presented in Fig. 4C of Gill et al.
With respect to claim 21’s recitation of consisting of, the claim fully recites:
A CD33-targeting guide RNA comprising:
a crRNA portion comprising (i) a guide sequence consisting of the nucleic acid sequence GUCAGUGACGGUACAGGA (SEQ ID NO:1) or GAGUCAGUGACGGUACAGGA (SEQ ID NO: 16), capable of hybridizing to a target endogenous gene locus encoding for CD33, and (ii) a repeat sequence; and
a tracrRNA portion comprising an anti-repeat sequence that is complementary to the repeat sequence.
Thus, the recitation of the broader comprising in the preamble, and a crRNA portion comprising, broadens the claim to encompass the whole sequence recited in Gill et al’s FIG 4C when it relates to sequences in addition to SEQ ID NO:16.
Regarding claim(s) 96 and 97 –
Applicant contends that amended claim 96 and 97 are not obvious over Gill and Bolen. Applicant states that “Gill and Bolen fail to teach or suggest the amended subject matter at least for the reasons set for in the obviousness rejection of claim 1.” As stated above, claim 1 was amended to recite the limitations of the now cancelled claim 2. The argument provided has drawn merely conclusory statements, but has not provided substantial reasoning as to why Gill et al in view of Bolen et al are not obvious over claim(s) 96 and 97.
Accordingly, the rejection on 35 U.S.C. 103 for obviousness is maintained for claim(s) 1, 21, 24, and 96-97.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claim(s) 1, 21, and 96, are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, and 9 of U.S. Patent No. 10548922 B2 in view of in view of Bolen et al (WO2018160768A1; cited on PTO 892 filed 02/27/2025). This rejection was made in the Office action mailed 02/27/2025 and has been rewritten to address the amendment to the claims in the reply filed on 05/27/2026.
Regarding claims 1 and 96 of the instant application, U.S. Patent No. 10548922 B2 claims 1, and 9, claim a CRISPR system comprising a CD33-targeting guide RNA (gRNA) for generating modified HSPCs.
Claims 1 and 9 of the US Patent No. 10548922 B2 do not teach the composition of gRNA comprising crRNA portion with repeat sequence and a tracrRNA portion with anti-repeat sequence and wherein the crRNA and/or tracrRNA comprise(s) one or more modified nucleotides.
However, one of ordinary skill in the art would have considered the teachings of Bolen et al as both references are analogous prior art pertaining to the gene editing methods targeting cell surface proteins.
Bolen et al teaches that the CRISPR/Cas9 system hybridizes with a target sequence in a lineage specific protein polynucleotide, where the CRISPR/Cas9 system comprises a Cas9 nuclease and an engineered crRNA/tracrRNA or single guide RNA (sgRNA) (pg. 42, paragraph 2). Bolen teaches that the gRNA of the CRISPR/Cas9 system hybridizes to the nucleotide sequence encoding lineage-specific cell-surface protein or CD33 (pg. 42, paragraph 1). Bolen teaches that all designed, synthetic sgRNAs were chemically modified nucleotides at three terminal positions at both the 5’ and 3’ ends wherein modified nucleotides contain 2'-0-methyl-3'-phosphorothioate (pg. 64, paragraph 4).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to substitute the gRNA composition of the U.S. Patent No. 10548922 B2 claims 1, and 9 for the gRNA comprising the crRNA and tracrRNA wherein crRNA portion with modified nucleotides of Bolen et al. A person of ordinary skill in the art would have had a reasonable expectation of success because both references teach gene editing systems targeting a gene sequence encoding endogenous CD33. Therefore, since Bolen teaches a CRISPR/Cas9 mediated gene editing approach using gRNA comprising crRNA/tracrRNA with modified nucleotides and the U.S. Patent No. 10548922 B2 claims 1, and 9 teach the method of generating modified HSPCs using CRISPR/Cas9 system comprising gRNA and by targeting endogenous gene encoding CD33, substituting the gRNA composition of the U.S. Patent No. 10548922 B2 claims 1, and 9 for the chemically modified gRNA or the crRNA portion comprising modified nucleotides of Bolen would have resulted in the predicable outcome of success.
Regarding claim 21, U.S. Patent No. 10548922 B2 claims 1, and 9 are similarly drawn to limitations requiring that the CD33-targeting gRNA comprising a guide sequence consisting of the nucleic acid sequence of SEQ ID NO: 16 (with the 100% sequence identity of U.S. Patent No. 10548922 B2 claims 1, and 9 SEQ ID NO: 4; see attached SEQ ID search results).
Accordingly claim(s) 1, 21, and 96 are patentably obvious over U.S. Patent No. 10548922 B2 in view of Bolen et al.
Claim 102 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, and 9 of U.S. Patent No. 10548922 B2 in view of in view of Bolen et al (WO2018160768A1; cited on PTO 892 filed 02/27/2025), as applied to claim 1 above, and further in view of Fu et al (Improving CRISPR-Cas nuclease specificity using truncated guide RNAs, Nat Biotechnol, Vol 32, Issue 3, page 279-284, Published January 26th, 2014).
U.S. Patent No. 10548922 B2 and Bolen et al do not teach guide nucleotides of 18-base-pair lengths.
Fu et al teaches, “[W]e and others, have shown that lengthening the 5' end of the complementary region can reduce on-target editing efficiency, with some of these longer gRNAs processed back to standard length in human cells. In contrast, certain gRNAs bearing either truncations or progressively greater numbers of mismatches at the 5' end of their complementarity targeting regions have been shown to retain robust Cas9-mediated on-target cleavage activities. We hypothesized that these 5'-end nucleotides might not be necessary for full gRNA activity and that these nucleotides might normally compensate for mismatches at other positions along the gRNA-target DNA interface; therefore, we reasoned that shorter gRNAs might be more sensitive to mismatches and thus more specific (Supplementary Fig. 1).
. . .
[T]o extend the generality of these findings, we assayed full-length gRNAs and matched gRNAs with 18, 17 and/or 16 nucleotides of complementarity to four additional EGFP reporter gene sites (EGFP sites #1, #2, #3 and #4; Fig. 1c). For all four target sites, gRNAs with 17 and/or 18 nucleotides of complementarity functioned as efficiently as (or, in one case, more efficiently than) their matched full-length counterparts (Fig. 1c).”, (see page 2, paragraph 2 and 3; see Figure 1C and 1D below).
PNG
media_image3.png
442
624
media_image3.png
Greyscale
PNG
media_image4.png
598
676
media_image4.png
Greyscale
Further, Fu et al teaches, “Our findings have several important implications for how to choose potential RGN target sites. The use of shorter gRNAs does not decrease the targeting range of the platform because target sites with 17 or 18 nts of complementarity will each occur in random DNA with frequencies equal to those with 20 nts of complementarity. Our results show that trugRGNs generally appear to induce very low or undetectable levels of mutagenesis at off target sites with as few as one or two mismatches and suggest that sites with three or more mismatches will not have mutations at high frequencies, if at all. Thus, a reasonable strategy for choosing target sites to minimize off-target effects might be to choose tru-gRNA target sites that are unique in the genome and that have the smallest possible number of potential off-target sites with 1 or 2 mistmatches.”, (see page 5, paragraph 4).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the chemically-modified guide strand (as taught in combination from U.S. Patent No. 10548922 B2 and Bolen et al) to contain 18 nucleotides, instead of 20, as taught by Fu et al, to arrive at the claimed invention of a guide strand consisting of SEQ ID NO: 1 (claim 102). One would have had a reasonable expectation of success because Fu et al teaches (1) truncating the typical “20 nucleotide” guide RNAs to 17-18 nucleotides does not decrease the targeting range, (2) the truncated guides induce very low or undetectable levels of mutagenesis at off target sites, and (3) when an 18-base-pair guide targets the same location as a 20-base-pair guide (e.g., Figure 1C and 1D) the 18-base-pair guide is equal to or out performs the 20-base-pair guide. Thus, one would be motivated to have use a 18-base-pair nucleotide guide sequence to maintain optimal guide efficiency and reduce indel frequency.
Accordingly claim 102 is patentably obvious over U.S. Patent No. 10548922 B2 in view of Bolen et al in further view of Fu et al.
Response to Arguments – Double Patenting
The rejection of claim 2 under Nonstatutory Double Patenting is moot in view of Applicant’s cancellation of the claims in the reply filed 05/27/2025.
The rejection of claim(s) 1, 21, 96, and 97 as being patentably obvious over U.S. Patent No. 11, 771, 719 in view of Bolen et al has been withdrawn in view of the amendments to the claims filed 05/27/2025.
The rejection of claim(s) 1 and 96 as being patentably obvious over 18/467,223 application in view of Bolen et al has been withdrawn in view of the amendments to the claims filed 05/27/2025.
With respect to the rejection of claim(s) 1, 21, 24, and 96-97, under Nonstatuatory Double Patenting, Applicant's arguments at page 18 of the reply filed 05/27/2025 have been fully considered but they are not persuasive.
Regarding U.S. Patent No. 10,548,922 in view of Bolen et al.
Applicant contends that each of the independent claim(s) (1, 21, and 96) have been amended to recite CD33-targeting guide sequences comprising or consisting of specific nucleic acid sequences identified by SEQ ID NOs.” Applicant states that the ‘922 patent does not describe any particular nucleic acid sequences recited in the rejected claims. In the Nonstatuatory Double Patenting Rejection filed 02/27/2025, Examiner pointed to SEQ ID NO: 4 of the ‘922 patent which consists of SEQ ID NO: 16 (of claim 21 – as highlighted below by the dotted box)
PNG
media_image6.png
154
546
media_image6.png
Greyscale
and comprises, in view of Bolen et al, SEQ ID NO: 2 (of the amended claim(s) 1 and 96).
Thus, the argument provided has drawn merely conclusory statements, but has not provided substantial reasoning as to why U.S. Patent No. 10,548,922 claims 1 and 9, in view of Bolen et al are not patentably obvious over claim(s) 1, 21, and 96.
Regarding U.S. Patent No. 11, 771, 719 in view of Bolen et al.
Applicant contends that each of the independent claim(s) (1, 21, and 96) have been amended to recite CD33-targeting guide sequences comprising or consisting of specific nucleic acid sequences identified by SEQ ID NOs.” Applicant states that the ‘719 patent does not describe any particular nucleic acid sequences recited in the rejected claims. Applicant is reminded that claim 2 was initially dependent upon claim 1, and in the amendments filed on 05/27/2025 cancelled claim 2, and added the claim limitation into claim 1. The original claim rejection was based on the previously presented claim(s) 1, 24, 96, and 97. Applicant merely provides conclusory statements, but has not provided substantial reasoning as to why U.S. Patent No. 11,77,719 claims 1-3 and 6, in view of Bolen et al are not patentably obvious over claim(s) 1, 24, 96 and 97. However, in light of the newly filed claim amendments on 05/27/2025, this Obviousness-Type Nonstatuatory Double Patenting rejection is withdrawn.
Regarding 18/467,223 in view of Bolen et al.
The Applicant requests that the rejection be held in abeyance until claims are found allowable. The rejection has been overcome by the addition of SEQ ID NO: 2 in claim 1 and 96.
Therefore, the provisional rejection is withdrawn.
Conclusion
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to LEXUS M TATGE whose telephone number is (571)272-0061. The examiner can normally be reached Monday-Friday: 8:30am to 5:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/L.M.T./Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637