Office Action Predictor
Application No. 17/579,655

METHODS FOR INHIBITION OF HAO1 (HYDROXYACID OXIDASE 1 (GLYCOLATE OXIDASE)) GENE EXPRESSION

Final Rejection §112§DP
Filed
Jan 20, 2022
Examiner
TRAN, CHRISTINA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Alnylam Pharmaceuticals, INC.
OA Round
2 (Final)
43%
Grant Probability
Moderate
3-4
OA Rounds
4y 2m
To Grant
62%
With Interview

Examiner Intelligence

43%
Career Allow Rate
19 granted / 44 resolved
Without
With
+19.0%
Interview Lift
avg trend
4y 2m
Avg Prosecution
54 pending
98
Total Applications
career history

Statute-Specific Performance

§101
6.4%
-33.6% vs TC avg
§103
30.2%
-9.8% vs TC avg
§102
14.1%
-25.9% vs TC avg
§112
35.6%
-4.4% vs TC avg
Black line = Tech Center average estimate • Based on career data

Office Action

§112 §DP
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Applicant's amendments and remarks filed on October 22, 2025 are acknowledged. Claims 3-17 have been canceled. Claims 2 and 18 were amended. Claims 1, 2, and 18-41 are pending and are examined on the merits herein. Priority This application is a continuation of 16/630,800 filed on January 13, 2020 which claims priority to PCT/US18/41891 filed on July 12, 2018 which claims priority to U.S. provisional application 62/682,020, filed on June 7, 2018, U.S. provisional application 62/646,285 filed on March 21, 2018, U.S. provisional application 62/581,565 filed on November 3, 2017, and U.S. provisional application 62/532,176 filed on July 13, 2017. Information Disclosure Statement The information disclosure statement (IDS) submitted on October 22, 2025 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. It is noted that cite number CL2 is a duplicate of CK2; therefore, CL2 was lined through on the IDS. It is noted that cite numbers CD3 and CE3 are duplicates of CC3; therefore, CD3 and CE3 were lined through on the IDS. It is noted that cite number CZ1 is a duplicate of CO2; therefore, CZ1 was lined through on the IDS. It is noted that cite number CJ2 is a duplicate of CS2; therefore, CJ2 was lined through on the IDS. It is noted that cite number CR2 is a duplicate of CT2; therefore, CR2 was lined through on the IDS. The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Withdrawn Objections In view of Applicant’s amendments and response, the objections to the drawings are withdrawn. In view of Applicant’s amendments and response, the claim objections are withdrawn. Withdrawn Rejections In view of Applicant’s amendments and response, the 35 U.S.C 112(b), 35 U.S.C 102, and 35 U.S.C 103 rejections are withdrawn. Drawings The drawings were received on October 22, 2025. These drawings are found acceptable by the examiner. Specification The use of the term Invitrogen, which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Response to Arguments Applicant's arguments filed October 22, 2025 have been fully considered but they are not persuasive. Applicant asserts that the specification has been amended to address the objections to the specification in reference to the use of trademarks or tradenames. However, the first paragraph on page 99 was not amended and still uses the term “Invitrogen”. Claim Objections Applicant is advised that should claims 22-24 be found allowable, claims 29-31 will be objected to under 37 CFR 1.75 as being a substantial duplicate thereof. When two claims in an application are duplicates or else are so close in content that they both cover the same thing, despite a slight difference in wording, it is proper after allowing one claim to object to the other as being a substantial duplicate of the allowed claim. See MPEP § 608.01(m). Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claims 40 and 41 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 40 recites the method of claim 38 wherein the dsRNA agent, or a salt thereof, is present in a buffer solution. Claim 38 recites the method of claim 35 wherein the dsRNA agent, or a salt thereof, is present in an unbuffered solution. Therefore, the claim does not include all of the limitations of the claim from which it depends. Claim 41 recites the method of claim 38 wherein the dsRNA agent, or a salt thereof, is present in an unbuffered solution. Claim 38 recites the method of claim 35 wherein the dsRNA agent, or a salt thereof, is present in an unbuffered solution. Therefore, claim 41 does not further limit the claim which it depends upon. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1, 2, and 18-41 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 20, 23, 27, 31, 86, 87, 88, 90, 92, 93, 94, and 118-121 of copending Application No. 18/324,191 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims are directed to subject matter that overlap in scope with the instant claims. Claim 20 of the ‘191 application is drawn to a method for treating a human subject having primary hyperoxaluria type I (PH1). Claims 23, 27, and 31 depend from claim 20 and further limits the loading phase and maintenance phase dosage and frequency. Claims 86-88 are drawn to the method of claim 20 wherein the RNAi agent is administered in a pharmaceutical composition (claim 86), wherein the double stranded RNAi agent is in a salt form (claim 87), and further comprising administering an additional therapeutic agent (claim 88). Claims 90, 92, and 93 are drawn to the method of claim 20 wherein the subject has end stage renal disease (claim 90) and is on dialysis (claims 92 and 93). Claims 118-121 depend from claim 20 and is drawn to the method of claim 20 wherein the double stranded RNAi agent further comprises a ligand. SEQ ID NO: 14 of ‘191 has a 100% match to instant SEQ ID NO: 14 as shown in the sequence search results below. Claim 94 of the ‘191 application is drawn to the method of claim 20 wherein the double stranded RNAi agent is administered to the subject subcutaneously. Thus, instant claims 1, 2, and 18-41 are not patently distinct from the claims of the ‘191 application. ‘655 SEQ ID NO: 14 1 GACUUUCAUCCUGGAAAUAUA 21 ||||||||||||||||||||| ‘191 SEQ ID NO: 14 1 GACUUUCAUCCUGGAAAUAUA 21 This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Response to Arguments Applicant's arguments filed October 22, 2025 have been fully considered but they are not persuasive. PNG media_image1.png 236 752 media_image1.png Greyscale However, the nonstatutory double patenting rejection is not the only rejection remaining in the instant application. Therefore, the Examiner is maintaining the nonstatutory double patenting rejection. Conclusion No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /C.T./ Examiner, Art Unit 1637 /Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Jan 20, 2022
Application Filed
Apr 20, 2025
Non-Final Rejection — §112, §DP
Oct 22, 2025
Response Filed
Jan 01, 2026
Final Rejection — §112, §DP
Apr 02, 2026
Response after Non-Final Action

Precedent Cases

Applications granted by this same examiner with similar technology. Study what changed to get past this examiner.

Patent 12584126
MICRORNA INHIBITORS FOR USE IN TREATING METABOLIC DISEASES
2y 5m to grant Granted Mar 24, 2026
Patent 12570707
CODON-OPTIMISED COMPLEMENT FACTOR I
2y 5m to grant Granted Mar 10, 2026
Patent 12545893
RECOMBINANT NERVOUS SYSTEM CELLS AND METHODS TO GENERATE THEM
2y 5m to grant Granted Feb 10, 2026
Patent 12529057
THERAPEUTICS FOR SYNGAP HAPLOINSUFFICIENCY
2y 5m to grant Granted Jan 20, 2026
Patent 12522818
METHOD FOR INDUCING DELETION IN GENOMIC DNA
2y 5m to grant Granted Jan 13, 2026

AI Strategy Recommendation

Click below to generate an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
43%
Grant Probability
62%
With Interview (+19.0%)
4y 2m
Median Time to Grant
Moderate
PTA Risk
Based on 44 resolved cases by this examiner