Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on December 11, 2026, has been entered.
DETAILED ACTION
The amended claims filed on November 19, 2025, have been acknowledged. Claims 3-5, 7, and 11-22 were cancelled. Claims 1-2 and 8-10 were amended. Claims 1-2, 6, and 8-11 are pending and examined on the merits.
Withdrawn Claim Rejections - 35 USC § 112(b)
The prior rejection of claims 10-11 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention is withdrawn in light of the cancellation of claim 11 and the amendments to claim 10 to remove the language lacking antecedent basis.
Withdrawn Claim Rejections - 35 USC § 112(d)
The prior rejection of claim 8 under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends is withdrawn in light of Applicant’s amendment to claim 8 to make it dependent on claim 6.
New Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 1-2, 6, and 8-10 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. This a new rejection made in response to Applicant’s amendments to claim 1.
Where applicant acts as his or her own lexicographer to specifically define a term of a claim contrary to its ordinary meaning, the written description must clearly redefine the claim term and set forth the uncommon definition so as to put one reasonably skilled in the art on notice that the applicant intended to so redefine that claim term. Process Control Corp. v. HydReclaim Corp., 190 F.3d 1350, 1357, 52 USPQ2d 1029, 1033 (Fed. Cir. 1999). The term “guide RNA is SEQ ID NO: 90” in claim 2 is used by the claim to mean “guide RNA target sequence is SEQ ID NO: 90,” while the accepted meaning is “guide RNA is encoded by SEQ ID NO: 90.” The term is indefinite because the specification does not clearly redefine the term. Although Applicant identifies SEQ ID NOs: 84-98 in specification as gRNA sequences (pages 50-51), these are, in fact, gRNA target sequences as the sequence listing identifies that these sequences include the PAM sequence. As can be seen in Figures 1 of Richardson et al. (Nature Biotechnology 34: 339-344. 2016) and Sun et al. (Transl Perioper & Pain Med 1: 22-32. 2016), the PAM sequence is associated with the opposite strand (identified as the non-target strand in Richardson and target strand in Sun) that is not bound by the gRNA. Therefore, the gRNA would not include the PAM sequence. As such, SEQ ID NOs: 84-98 are considered guide RNA target sequences that include a PAM sequence but are not considered a gRNA sequence.
Regarding the limitation in claim 1, said guide RNA strand targets a mutated gene in fetal, or post-natal lung and is selected from the group consisting of SEQ ID NOS: 84 – 98, as claim 2 identifies that SEQ ID NO: 90 is a guide RNA, SEQ ID NOs: 84-89 and 91-98 are also considered to be intended as gRNA sequences. Therefore, “said guide RNA … is selected from the group consisting of SEQ ID NOs: 84-98” is also considered to be indefinite.
Claims 2, 6, and 8-10 are also rejected because their dependency on claim 1.
New Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1-2, 6, and 8-10 are rejected under 35 U.S.C. 103 as being unpatentable over World Intellectual Property Organization Application No. 2017/070633 (Liu; identified in IDS), Alapati et al. (American Journal of Respiratory Cell and Molecular Biology 56: 283-290. 2017; previous art of record), Sun et al. (Transl Perioper & Pain Med 1: 22-32. 2016), and World Intellectual Property Organization Patent Application No. 2017205423 (Curiel). This a new rejection made in response to Applicant’s amendments to claim 1.
Regarding the 112b issue in claims 1 and 2, SEQ ID NOs: 84 – 98, are interpreted to correspond to the target strand sequence containing the PAM sequence and not the gRNA sequence.
Regarding claims 1-2, Liu teaches a method of treating a disease in a subject (such as a human, i.e. eukaryotic cells) with a T to C point mutation by delivering a Cas9 fusion protein to a cell to correct the point mutation through deamination, wherein the target DNA sequence is the 218T to C (Ile73Thr) point mutation in the SFTPC gene (a monogenic mutant gene expressed in lung cells that cause neonatal respiratory distress (Alapati, page 284)). The deamination of the mutant C results in a change of the amino acid encoded by the mutant codon back to the wild-type amino acid. This method can be performed in vivo or ex vivo. Liu teaches that the Cas9 fusion protein and gRNA can be comprised within a vector with a promoter (a regulatory element) driving expression. Liu teaches that the gRNA can be 15-100 nucleotides long and comprises a sequence of at least 10 contiguous nucleotides that is complementary to a target sequence.
In Table 6, SEQ ID NO. 1437 shows that the gRNA target sequence is the mutant gene sequence for sequence-specific binding and deamination of the mutant C in the gene to a T (the wild type nucleotide) (page 300).
Liu teaches SEQ ID NO:1437 which has a sequence 100% (bottom line) identical (underlined) to SEQ ID NO: 90 of the instant application (upper line) as shown below and that sequence corresponds to the mutant SFTPC gene (page 300). The H corresponds to an A, T, or C and is at position 218 of the SFTPC gene and would be a C in the point mutant associated with surfactant deficiency:
1 GGAGATGAGCACTGGGGCGCCGG 23
|||||||||||||||||||||||
15 GGAGATGAGCACTGGGGCGCCGG 37
Liu teaches that the Cas9 can be derived from a multitude of different species, including S. pyogenes (paragraphs 0070-0071, 0099, 00115, 00121, 00210-00224, and 00271 and Table 6, page 300, SEQ ID NO. 1437).
As the method is used in a broadly defined eukaryotic cell, the limitation “said guide strand targets a mutated gene in fetal or post-natal lung” is interpreted to mean that the target gene must be found in fetal or post-natal lung but the eukaryotic cell does not need to be a lung cell. Although claim 1 uses the term “eukaryotic lung cell” this is only in relation to the regulatory element. At no point in the claim is CRISPR-Cas system required to be introduced into a eukaryotic lung cell. As stated supra, SFTPC is expressed in neonatal lungs, fulfilling the requirements of the limitation.
Liu teaches SEQ ID NO: 1437 is a target sequence for a gRNA but does not specifically teach a gRNA targeting this sequence, only that one could create a gRNA to target this sequence for correcting the T to C mutation back to a T by deamination.
However, Alapati teaches that because many genetic lung diseases are monogenic in nature, they are promising targets for treatment using gene editing
technologies. Moreover, pulmonary genetic disorders are uniquely amenable
to targeted gene-editing therapy because the lung is a barrier organ and is
in direct contact with the external environment. In addition, in the case of
SFTPB and SFTPC deficiency syndromes, the proteins are expressed primarily in the
lungs, and extrapulmonary organs are unaffected by the underlying mutations, leaving open the possibility that lung-specific therapy could lead to a clinical cure, such as for the I73T mutation in SFTPC, which is the most common mutation of SFTPC.
Sun teaches that recognition of a genomic DNA target is mediated through base pairing with a 20-base gRNA. The latter further recruits the Cas9 endonuclease protein to the target site and creates double-stranded breaks in the target DNA (page 22, column 1, paragraph 1 and Figure 1).
Therefore, it would have been obvious to one of ordinary skill in the art that one could make a gRNA based om the target sequence of SEQ ID NO. 90 as the ordinary artisan would have recognized that there are a finite number of identifiable, predictable gRNA sequences that could be made based on the identified target sequence of SEQ ID NO: 1437 and that SEQ ID NO: 90 of the instant application would be one of them and would be readily conceived as one of the options. Furthermore, Liu and Alpati have identified the I73T (T218C) mutation as a region of interest for CRISPR based correction of the mutation, Liu identified that their gRNA could be between 15-100 nucleotides, and Sun has identified a 20 bp region with a 3 bp PAM sequence (as used in SEQ ID NO: 90) as commonly used as the target sequence for a S. pyogenes Cas9 system (which is also identified by Liu as a Cas9 species that can be used in their method).
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Although Liu teaches that the Cas9 can be linked to a promoter, it is silent as to whether the gRNA also is under the control of a promoter and the type of promoter.
However, Curiel teaches an adenoviral vector comprising a Cas9 and a gRNA for targeting pulmonary cells (abstract and page 2, paragraph 3-page 5, paragraph 1). As can be seen in Figure 4, the Cas9 can be under the control of a CMV promoter and the gRNA can under the control of a U6 promoter within the same adenoviral vector.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of with a T to C point mutation by delivering a Cas9 fusion protein and gRNA to a cell to correct the point mutation through deamination by encoding the Cas9 and gRNA within the same adenoviral vector under the control of a CMV and a U6 promoter, respectively, to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to modify with a reasonable expectation of success because Liu teaches that the Cas9 and gRNA can be comprised within a vector under the control of a promoter and Curiel teaches vector constructions comprising a Cas9 under the control of a CMV promoter and a gRNA under the control of a U6 promoter for gene editing in pulmonary cells, the cell type that would contain the I73T (T218C) mutation associated with SFTPC deficiency. Therefore, it would have been obvious that the vector construction of Curiel could be used for delivering the CRISP-Cas system of the combined teachings of Liu, Alapati, and Sun to gene edit pulmonary cells for treating SFTPC deficiency.
Regarding claim 6, Liu teaches that the Cas9 can be fused to a nuclear localization sequence (paragraph 0061).
Regarding claim 8, Curiel teaches that the Cas9 can be codon optimized for mammalian cells (page 3, paragraph 1). As the Cas9 of Liu is meant for mammalian cell gene editing, it would have been obvious to codon optimize the Cas9 of Liu for expression in a mammalian cell (e.g. a eukaryotic lung cell).
Regarding claim 9, Liu, as stated supra, teaches that the method of treating can be used in humans either in vivo or ex vivo (paragraphs 00115 and 00210-00224).
Regarding claim 10, Liu is silent as to which tissues are targeted by the vector comprising the Cas9 and gRNA but Curiel teaches that their vector systems target pulmonary cells for gene editing.
Furthermore, Alapati teaches that prenatal therapy may provide the best opportunity to treat SFTPC mutations before the rapid disease progression that occurs immediately after birth in SP deficiency (such as the I73T mutation in SFTPC, which is the most common mutation, a monogenic cause of neonatal respiratory distress) and thus improve both mortality and morbidity. Furthermore, widespread availability of prenatal diagnostics for early diagnosis of these conditions increases the feasibility of such an approach. Furthermore, delivery of gene-editing reagents early in life before exposure to natural infection and when the immune system is still immature overcomes the immunogenic potential of viral vectors and immune-mediated diminution of the transgene and/or viral vectors. Therapeutic intervention in the fetal period may induce immune tolerance and improve efficiency. Finally, prenatal application is feasible via the intraamniotic, vitelline vein, or by fetal intratracheal injection. The presence of fetal breathing movements combined with direct contact between the developing airways and amniotic fluid suggests that CRISPR/Cas9 administered via the intraamniotic route could reach the lung epithelium. Taken together, genome editing in fetal lungs represents a promising therapeutic strategy for lethal SP deficiency disorders (page 286, column 1, paragraph 2-column 2, paragraph 2).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the method of correcting a mutation in the SFTPC gene using CRISPR-Cas9 in vivo of Liu with the method of correcting SP deficiencies in vivo of Alapati to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to combine with a reasonable expectation of success because Liu teaches that SFTPC mutations in human cells can be corrected by delivering CRISPR-Cas9 to the cells and deaminating the mutant C to a T, fixing the deficiency caused by the mutation. Alapati provides clear justification for correcting the mutation in fetuses prior to birth. Alapati teaches that prenatal therapy may provide the best opportunity to treat the disease before the rapid disease progression that occurs immediately after birth in SP deficiency and thus improve both mortality and morbidity. Furthermore, delivery of gene-editing reagents early in life overcomes the immunogenic potential of viral vectors and immune-mediated diminution of the transgene and/or viral vectors. The presence of fetal breathing movements combined with direct contact between the developing airways and amniotic fluid suggests that CRISPR/Cas9 administered via the intraamniotic route could reach the lung epithelium. Taken together, genome editing in fetal lungs represents a promising therapeutic strategy for lethal SP deficiency disorders. As such, it would have been obvious to perform the method of correcting SFTPC mutations with CRISPR-Cas9 of Liu in vivo to treat fetuses to prevent neonatal death or preclude the need for lung transplantation to keep the newborn alive. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEENAN A BATES whose telephone number is (571)270-0727. The examiner can normally be reached M-F 7:30-5:00.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Doug Schultz can be reached on (571) 272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEENAN A BATES/Examiner, Art Unit 1631