Prosecution Insights
Last updated: October 02, 2026
Application No. 17/601,581

COMPOSITIONS AND METHODS FOR IN UTERO GENE EDITING FOR MONOGENIC LUNG DISEASE

Final Rejection §103§112
Filed
Oct 05, 2021
Priority
Apr 05, 2019 — provisional 62/830,032 +1 more
Examiner
BATES, KEENAN ALEXANDER
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Trustees of the University of Pennsylvania
OA Round
4 (Final)
46%
Grant Probability
Moderate
5-6
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 46% of resolved cases
46%
Career Allowance Rate
35 granted / 77 resolved
-14.5% vs TC avg
Strong +80% interview lift
Without
With
+79.5%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
53 currently pending
Career history
151
Total Applications
across all art units

Statute-Specific Performance

§101
4.2%
-35.8% vs TC avg
§103
38.6%
-1.4% vs TC avg
§102
20.2%
-19.8% vs TC avg
§112
27.4%
-12.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 77 resolved cases

Office Action

§103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION The amended claims filed on July 2, 2026, have been acknowledged. Claims 3-5, 7, and 10-22 were cancelled. Claims 1-2 were amended. Claim 23 is new. Claims 1-2, 6, 8-9, and 23 are pending and examined on the merits. Notice of Non-responsive Amendment The reply filed on July 2, 2026, is not fully responsive to the prior Office Action because of the following omission(s) or matter(s): the claims are not considered to be in compliance with 37 CFR § 1.121, recited here: § 1.121(c) Manner of making amendments in applications. Amendments to a claim must be made by rewriting the entire claim with all changes (e.g., additions and deletions) as indicated in this subsection, except when the claim is being canceled. Each amendment document that includes a change to an existing claim, cancellation of an existing claim or addition of a new claim, must include a complete listing of all claims ever presented, including the text of all pending and withdrawn claims, in the application. The claim listing, including the text of the claims, in the amendment document will serve to replace all prior versions of the claims, in the application. In the claim listing, the status of every claim must be indicated after its claim number by using one of the following identifiers in a parenthetical expression: (Original), (Currently amended), (Canceled), (Withdrawn), (Previously presented), (New), and (Not entered). (1) Claim listing. All of the claims presented in a claim listing shall be presented in ascending numerical order. Consecutive claims having the same status of "canceled" or "not entered" may be aggregated into one statement (e.g., Claims 1–5 (canceled)). The claim listing shall commence on a separate sheet of the amendment document and the sheet(s) that contain the text of any part of the claims shall not contain any other part of the amendment. (c)(2) When claim text with markings is required. All claims being currently amended in an amendment paper shall be presented in the claim listing, indicate a status of “currently amended,” and be submitted with markings to indicate the changes that have been made relative to the immediate prior version of the claims. The text of any added subject matter must be shown by underlining the added text. The text of any deleted matter must be shown by strike-through except that double brackets placed before and after the deleted characters may be used to show deletion of five or fewer consecutive characters. The text of any deleted subject matter must be shown by being placed within double brackets if strike-through cannot be easily perceived. Only claims having the status of “currently amended,” or “withdrawn” if also being amended, shall include markings. If a withdrawn claim is currently amended, its status in the claim listing may be identified as “withdrawn— currently amended.” The claim amendment submitted July 2, 2026, lists claim 23 as previously presented when it is a new claim. While it would be appropriate to reject entry of the present amendment for noncompliance with 37 CFR § 1.121, applicant is instead respectfully reminded to properly note the status of each and all claims previously presented in order to avoid the issuance of a Notice of Non-Compliant Amendment, which would delay prosecution and potentially have an adverse effect on any patent term adjustment should the claims proceed to issue. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings (Figures 1F-1G, 2A, and 8A) are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings. Required response – Applicant must provide: Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers; AND/OR A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Claim Rejections - 35 USC § 112(a) New Matter The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-2, 6, 8-9, and 23 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Claim 1, amended on July 2, 2026, recites SEQ ID NOs: 91-92 and 94-98 have a three nucleotide PAM sequence. Clear support for the new limitation cannot be found in the instant application or priority documents. Page 50 of the instant specification and the sequence listing identify these sequences as having a two nucleotide PAM sequence and not a three nucleotide PAM sequence as identified in the amended claims. Accordingly, the amendments to Claim 1 are considered to constitute new matter. MPEP 2163.06 notes “If new matter is added to the claims, the examiner should reject the claims under 35 U.S.C. 112, first paragraph - written description requirement. In re Rasmussen, 650 F.2d 1212, 211 USPQ 323 (CCPA 1981).” MPEP 2163.02 teaches that “Whenever the issue arises, the fundamental factual inquiry is whether a claim defines an invention that is clearly conveyed to those skilled in the art at the time the application was filed...If a claim is amended to include subject matter, limitations, or terminology not present in the application as filed, involving a departure from, addition to, or deletion from the disclosure of the application as filed, the examiner should conclude that the claimed subject matter is not described in that application”. MPEP 2163.06 further notes “When an amendment is filed in reply to an objection or rejection based on 35 U.S.C. 112, first paragraph, a study of the entire application is often necessary to determine whether or not “new matter” is involved. Applicant should therefore specifically point out the support for any amendments made to the disclosure” (emphasis added). In the remarks filed on July 2, 2026, Applicant identifies that the amendments find support throughout the application. However, as identified above, page 50 of the instant specification and the sequence listing identify SEQ ID NOs: 91-92 and 94-98 as having a two nucleotide PAM sequences and not a three nucleotide PAM sequence as currently claimed. If Applicant believes that support for the new limitations, as now recited in Claim 1, is present and clearly envisaged in the instant application or earlier filed priority documents, applicant must, in responding to this Office Action, point out with particularity, where such support may be found. Declarations and new references cannot demonstrate possession of a concept after the fact. Claims 2, 6, 8-9, and 23 are also rejected because of their dependency on claim 1. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 1-2, 6, 8-9, and 23 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. This a new rejection made in response to Applicant’s amendments to claim 1 that is similar to a previous rejection of record. Applicant’s traversal is addressed below. Where applicant acts as his or her own lexicographer to specifically define a term of a claim contrary to its ordinary meaning, the written description must clearly redefine the claim term and set forth the uncommon definition so as to put one reasonably skilled in the art on notice that the applicant intended to so redefine that claim term. Process Control Corp. v. HydReclaim Corp., 190 F.3d 1350, 1357, 52 USPQ2d 1029, 1033 (Fed. Cir. 1999). The term “guide RNA is SEQ ID NO: 90” in claim 2 is used by the claim to mean “guide RNA target sequence is SEQ ID NO: 90,” while the accepted meaning is “guide RNA is encoded by SEQ ID NO: 90.” The term is indefinite because the specification does not clearly redefine the term. Applicant identifies SEQ ID NOs: 84-98 in specification as gRNA sequences (pages 50-51). However, the specification also identifies SEQ ID NOs: 1-9 as being a protospacer sequence and a PAM sequence and SEQ ID NOs: 1-9 are identified in the sequence listing in the same manner as SEQ ID NOs 84-98 (20 nucleotide sequence with a 3 nucleotide PAM sequence). Protospacer sequences are part of the target sequence and not the gRNA sequence. Furthermore, Figure 2A identifies SEQ ID NO: 1 as corresponding to the protospacer sequence and the PAM sequence and Figure 8A identifies SEQ ID NOs: 2 and SEQ ID NO: 6 as corresponding to the protospacer sequence and the PAM sequence which is in line with what is described in Table 1 for these sequences. Additionally, these figures seem to identify a separate gRNA binds to these protospacer sequences to cut the DNA (see sgRNA-1 or sgRNA-5B). Therefore, as SEQ ID NOs: 1-9 and 84-98 are identified in the same manner, this suggests that SEQ ID NOs: 1-9 and 84-98 are all 20 nucleotide protospacer sequences with 3 nucleotide PAM sequences. As such, SEQ ID NOs: 84-98 are, in fact, gRNA target sequences. As can be seen in Figures 1 of Richardson et al. (Nature Biotechnology 34: 339-344. 2016) and Sun et al. (Transl Perioper & Pain Med 1: 22-32. 2016), the PAM sequence is associated with the opposite strand (identified as the non-target strand in Richardson and target strand in Sun) that is not bound by the gRNA. Therefore, the gRNA would not include the PAM sequence. Based on the above evidence found in the instant specification and the art, SEQ ID NOs: 84-98 are considered guide RNA target sequences that include a PAM sequence and are not considered gRNA target sequences. Claims 2, 6, 8-9, and 23 are also rejected because of their dependency on claim 1. Response to Arguments Applicant's arguments filed July 2, 2026, are acknowledged. Applicant argues that the definiteness of claim language may not be analyzed in the abstract, but must be considered in light of the teachings of the prior art and of the particular application disclosure, as it would be interpreted by one having ordinary skill in the art. In re Moore, supra. Applicant strenuously disagrees with the Examiner's assertion that Applicant is attempting to redefine the phrase "guide strand". At page 19, lines 1-3 Applicant discloses, "In general, a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence specific binding of a CRISPR complex to the target sequence. Indeed, claim 1 currently recites a) a first regulatory element operable in a eukaryotic lung cell operably linked to at least one nucleotide sequence encoding a CRISPR-Cas system guide RNA that hybridizes with the target sequence where the target sequence is a DNA molecule in a eucaryotic cell harboring at least one mutated gene product in lung Surfactant protein C (SFTPC). As the skilled person is aware, the CRISPR-SpCas9 system comprises a guide RNA (gRNA) and SpCas9 nuclease, which together form a ribonucleoprotein (RNP) complex. The presence of a specific protospacer adjacent motif (PAM) in the genomic DNA molecule targeted by the guide helps direct the editor complex to the target sequence. The Cas9 nuclease then makes a double-strand break in the DNA (denoted by the scissors). Endogenous repair mechanisms triggered by the strand break can result in knock-in of a desired sequence if a DNA template is present. Applicant cites to Figure 8A to show a schematic of genomic sequence of Sftpc WT locus of interest, the sgRNA sequence (grey), and the PAM site. Applicant is aware that the PAM sequence is not part of the guide RNA (gRNA) and is found on the targeted DNA molecule, adjacent to the 20-nucleotide target sequence as shown in the figure above. However, it is conventional to list the CRISPR-Cas system guide strand RNA that hybridizes with the target sequence along with an appropriate PAM sequence as shown in Table 1, Table 6, page 50, lines 13 to 27. The amendment to the claims identifying the PAM sequences, make clear that SEQ ID NOS: 84-98 are gRNA strand sequences and PAM sequences rather than guide RNA target sequences as alleged by the Examiner. The amendments to claims I and 2 serve to remove any perceived ambiguity as they clearly identify the guide strand sequences and the PAM nucleotide sequences. Applicant's arguments have been fully considered but they are not persuasive. As identified in the rejection above, the definiteness of claim language has been considered in light of the teachings of the prior art and of the instant specification. As part of Applicant’s arguments, they specifically cite to Table 1 and Figure 8 to assert that this shows it is conventional to list the CRISPR-Cas system guide strand RNA that hybridizes with the target sequence along with an appropriate PAM sequence. However, analysis of Table 1 clearly identify SEQ ID NOs: 1-9 as being a protospacer sequence and a PAM sequence and SEQ ID NOs: 1-9 are identified in the sequence listing in the same manner as SEQ ID NOs 84-98 (20 nucleotide sequence with a 3 nucleotide PAM sequence). Protospacer sequences are part of the target sequence and not the gRNA sequence. Furthermore, Figure 8A identifies SEQ ID NOs: 2 and SEQ ID NO: 6 as being part of the endogenous sftpc gene, either exon 1 or exon 5. Therefore, Figure 8 also suggests the sequences corresponding to the protospacer sequence and the PAM sequence as described in Table 1, and not as the gRNA sequence. Additionally, Figure 8 seems to identify a separate gRNA binds to these protospacer sequences to cut the DNA (see sgRNA-1 or sgRNA-5B). Therefore, as SEQ ID NOs: 1-9 and 84-98 are identified in the same manner, this suggests that SEQ ID NOs: 1-9 and 84-98 are all 20 nucleotide protospacer sequences with 3 nucleotide PAM sequences. As such, SEQ ID NOs: 84-98 are, in fact, gRNA target sequences. As can be seen in Figures 1 of Richardson et al. (Nature Biotechnology 34: 339-344. 2016) and Sun et al. (Transl Perioper & Pain Med 1: 22-32. 2016), the PAM sequence is associated with the opposite strand (identified as the non-target strand in Richardson and target strand in Sun) that is not bound by the gRNA. Therefore, the gRNA would not include the PAM sequence. Based on the above evidence found in the instant specification and the art, SEQ ID NOs: 84-98 are considered guide RNA target sequences that include a PAM sequence and are not considered gRNA target sequences. Therefore, Applicant’s arguments are considered unpersuasive. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1-2, 6, 8-9, and 23 are rejected under 35 U.S.C. 103 as being unpatentable over World Intellectual Property Organization Application No. 2017/070633 (Liu; identified in IDS), Alapati et al. (American Journal of Respiratory Cell and Molecular Biology 56: 283-290. 2017; previous art of record), Sun et al. (Transl Perioper & Pain Med 1: 22-32. 2016), and World Intellectual Property Organization Patent Application No. 2017205423 (Curiel). This a new rejection made in response to Applicant’s amendments to claim 1 that is substantially similar to a previous rejection of record. Any aspect of Applicant’s traversal that is relevant to the new rejection of record is addressed below. Regarding the 112b issue in claims 1 and 2, SEQ ID NOs: 84-98, are interpreted to correspond to the target strand sequence containing the PAM sequence and not the gRNA sequence. Regarding claims 1-2, Liu teaches a method of treating a disease in a subject (such as a human, i.e. eukaryotic cells) with a T to C point mutation by delivering a Cas9 fusion protein to a cell to correct the point mutation through deamination, wherein the target DNA sequence is the 218T to C (Ile73Thr) point mutation in the SFTPC gene (a monogenic mutant gene expressed in lung cells that cause neonatal respiratory distress (Alapati, page 284)). The deamination of the mutant C results in a change of the amino acid encoded by the mutant codon back to the wild-type amino acid. This method can be performed in vivo or ex vivo. Liu teaches that the Cas9 fusion protein and gRNA can be comprised within a vector with a promoter (a regulatory element) driving expression. Liu teaches that the gRNA can be 15-100 nucleotides long and comprises a sequence of at least 10 contiguous nucleotides that is complementary to a target sequence. In Table 6, SEQ ID NO. 1437 shows that the gRNA target sequence is the mutant gene sequence for sequence-specific binding and deamination of the mutant C in the gene to a T (the wild type nucleotide) (page 300). Liu teaches SEQ ID NO:1437 which has a sequence 100% (bottom line) identical (underlined) to SEQ ID NO: 90 for the 20 nucleotide gRNA target sequence and the 3 nucleotide PAM sequence of the instant application (upper line) as shown below and that sequence corresponds to the mutant SFTPC gene (page 300). The H corresponds to an A, T, or C and is at position 218 of the SFTPC gene and would be a C in the point mutant associated with surfactant deficiency: 1 GGAGATGAGCACTGGGGCGC 20 21 CGG 23 |||||||||||||||||||| ||| 15 GGAGATGAGCACTGGGGCGC 34 35 CGG 37 Liu teaches that the Cas9 can be derived from a multitude of different species, including S. pyogenes (paragraphs 0070-0071, 0099, 00115, 00121, 00210-00224, and 00271 and Table 6, page 300, SEQ ID NO. 1437). Liu teaches SEQ ID NO: 1437 is a target sequence for a gRNA but does not specifically teach a gRNA targeting this sequence, only that one could create a gRNA to target this sequence for correcting the T to C mutation back to a T by deamination. However, Alapati teaches that because many genetic lung diseases are monogenic in nature, they are promising targets for treatment using gene editing technologies. Moreover, pulmonary genetic disorders are uniquely amenable to targeted gene-editing therapy because the lung is a barrier organ and is in direct contact with the external environment. In addition, in the case of SFTPB and SFTPC deficiency syndromes, the proteins are expressed primarily in the lungs, and extrapulmonary organs are unaffected by the underlying mutations, leaving open the possibility that lung-specific therapy could lead to a clinical cure, such as for the I73T mutation in SFTPC, which is the most common mutation of SFTPC. Sun teaches that recognition of a genomic DNA target is mediated through base pairing with a 20-base gRNA. The latter further recruits the Cas9 endonuclease protein to the target site and creates double-stranded breaks in the target DNA (page 22, column 1, paragraph 1 and Figure 1). Therefore, it would have been obvious to one of ordinary skill in the art that one could make a gRNA based on the target sequence of SEQ ID NO. 90 as the ordinary artisan would have recognized that there are a finite number of identifiable, predictable S. pyogenes gRNA target sequences and corresponding PAM sequences that could be made based on the identified 51 nucleotide target sequence of SEQ ID NO: 1437 and that SEQ ID NO: 90 of the instant application would be one of them and would be readily conceived as one of the options. Furthermore, Liu and Alpati have identified the I73T (T218C) mutation as a region of interest for CRISPR based correction of the mutation, Liu identified that their gRNA could be between 15-100 nucleotides, and Sun has identified a 20 bp region with a 3 bp PAM sequence (as used in SEQ ID NO: 90) as commonly used as the target sequence for a S. pyogenes Cas9 system (which is also identified by Liu as a Cas9 species that can be used in their method). The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. Therefore, it would have been well understood that one could make a gRNA targeting the sequence of SEQ ID NO. 90 based on the 51 nucleotide target region identified by Liu and the known requirements for making an S. pyogenes based gRNA. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Although Liu teaches that the Cas9 can be linked to a promoter, it is silent as to whether the gRNA also is under the control of a promoter and the type of promoter. However, Curiel teaches an adenoviral vector comprising a Cas9 and a gRNA for targeting pulmonary cells (abstract and page 2, paragraph 3-page 5, paragraph 1). As can be seen in Figure 4, the Cas9 can be under the control of a CMV promoter and the gRNA can under the control of a U6 promoter within the same adenoviral vector. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of with a T to C point mutation by delivering a Cas9 fusion protein and gRNA to a lung cell to correct the point mutation through deamination by encoding the Cas9 and gRNA within the same adenoviral vector under the control of a CMV and a U6 promoter, respectively, to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to modify with a reasonable expectation of success because Liu teaches that the Cas9 and gRNA can be comprised within a vector under the control of a promoter and Curiel teaches vector constructions comprising a Cas9 under the control of a CMV promoter and a gRNA under the control of a U6 promoter for gene editing in pulmonary cells, the cell type that would contain the I73T (T218C) mutation associated with SFTPC deficiency. Therefore, it would have been obvious that the vector construction of Curiel could be used for delivering the CRISP-Cas system of the combined teachings of Liu, Alapati, and Sun to gene edit pulmonary cells for treating SFTPC deficiency. Regarding claim 6, Liu teaches that the Cas9 can be fused to a nuclear localization sequence (paragraph 0061). Regarding claim 8, Curiel teaches that the Cas9 can be codon optimized for mammalian cells (page 3, paragraph 1). As the Cas9 of Liu is meant for mammalian cell gene editing, it would have been obvious to codon optimize the Cas9 of Liu for expression in a mammalian cell (e.g. a eukaryotic lung cell). Regarding claim 9, Liu, as stated supra, teaches that the method of treating can be used in humans either in vivo or ex vivo (paragraphs 00115 and 00210-00224). Regarding claim 23, Liu is silent as to which tissues are targeted by the vector comprising the Cas9 and gRNA but Curiel teaches that their vector systems target pulmonary cells for gene editing. Furthermore, Alapati teaches that prenatal therapy may provide the best opportunity to treat SFTPC mutations before the rapid disease progression that occurs immediately after birth in SP deficiency (such as the I73T mutation in SFTPC, which is the most common mutation, a monogenic cause of neonatal respiratory distress) and thus improve both mortality and morbidity. Furthermore, widespread availability of prenatal diagnostics for early diagnosis of these conditions increases the feasibility of such an approach. Furthermore, delivery of gene-editing reagents early in life before exposure to natural infection and when the immune system is still immature overcomes the immunogenic potential of viral vectors and immune-mediated diminution of the transgene and/or viral vectors. Therapeutic intervention in the fetal period may induce immune tolerance and improve efficiency. Finally, prenatal application is feasible via the intraamniotic, vitelline vein, or by fetal intratracheal injection. The presence of fetal breathing movements combined with direct contact between the developing airways and amniotic fluid suggests that CRISPR/Cas9 administered via the intraamniotic route could reach the lung epithelium. Taken together, genome editing in fetal lungs represents a promising therapeutic strategy for lethal SP deficiency disorders (page 286, column 1, paragraph 2-column 2, paragraph 2). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the method of correcting a mutation in the SFTPC gene using CRISPR-Cas9 in vivo of Liu with the method of correcting SP deficiencies in vivo of Alapati to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to combine with a reasonable expectation of success because Liu teaches that SFTPC mutations in human cells can be corrected by delivering CRISPR-Cas9 to the cells and deaminating the mutant C to a T, fixing the deficiency caused by the mutation. Alapati provides clear justification for correcting the mutation in fetuses prior to birth. Alapati teaches that prenatal therapy may provide the best opportunity to treat the disease before the rapid disease progression that occurs immediately after birth in SP deficiency and thus improve both mortality and morbidity. Furthermore, delivery of gene-editing reagents early in life overcomes the immunogenic potential of viral vectors and immune-mediated diminution of the transgene and/or viral vectors. The presence of fetal breathing movements combined with direct contact between the developing airways and amniotic fluid suggests that CRISPR/Cas9 administered via the intraamniotic route could reach the lung epithelium. Taken together, genome editing in fetal lungs represents a promising therapeutic strategy for lethal SP deficiency disorders. As such, it would have been obvious to perform the method of correcting SFTPC mutations with CRISPR-Cas9 of Liu in vivo to treat fetuses to prevent neonatal death or preclude the need for lung transplantation to keep the newborn alive. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Response to Arguments Applicant's arguments filed July 2, 2026, are acknowledged. Applicant argues that Liu does not teach a gRNA targeting SEQ ID NO: 1437, only that it represents a target sequence for the gRNA. Liu does not teach which PAM sequence would be most suitable, either. Applicant also notes that Liu et al. teach a plethora of PAM sequences and suggests that guide strands can be about 15-100 nucleotides. Applicant notes SEQ ID NO: 1437 of Liu is a DNA containing 51 bases. As noted above, this sequence does not encode the guide strand sequences presently claimed and amounts to no more than an invitation to experiment to achieve what Applicant has done. Similarly, Alapati merely provides information on the mutations to be targeted and amounts to no more than an invitation to experiment. Indeed, no guide strands are disclosed in Alapati. Sun reports generally on use of the CRISPR/Cas9 system for gene editing and is relied upon for teaching that recognition of the genomic DNA target is mediated through base pairing with a 20-base gRNA in the CRISPR/Cas9 system. No guide strands directed to an SFTPC mutation are disclosed. Curiel is cited for teaching an adenoviral vector encoding a Cas9 and a gRNA for targeting pulmonary cells which requires the presence of a pulmonary targeting coding sequence. Curiel does not provide a guide strand which targets a mutated SFTPC gene for successful editing of the same in fetal lung cells. Applicant's editor reaches the lung cell via intra-amniotic delivery to a fetus in utero. It is noted that the vector system of Curiel requires the presence of a "pulmonary targeting sequence" which is a myeloid binding protein (MBP) for successful targeting, a feature which is not present in the base editing method currently claimed (page 8, paragraph 3-page 10, paragraph 2). Applicant's arguments have been fully considered but they are not persuasive. As an initial matter, it is noted that Applicant’s argument that the presence of a "pulmonary targeting sequence" which is a myeloid binding protein (MBP) for successful targeting is a feature which is not present in the base editing method currently claimed is unpersuasive as the term "comprising" is open-ended and allows for additional, unrecited elements in the claims. MPEP 2111.03 specifically sets forth that the transitional term "comprising", which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). Applicant fails to specifically exclude pulmonary targeting sequences in either the claims or the specification. As such, the additional pulmonary targeting sequences used by Curiel in the adenovirus to deliver Cas9 and gRNA to pulmonary cells do not teach away from the present invention as claims use the term comprising which allows for non-recited components and there is no requirement to exclude this additional element. As stated in the rejection above, it would have been obvious to one of ordinary skill in the art that one could make a gRNA based on the target sequence of SEQ ID NO. 90 as the ordinary artisan would have recognized that there are a finite number of identifiable, predictable S. pyogenes gRNA target sequences and corresponding PAM sequences that could be made based on the identified 51 nucleotide target sequence of SEQ ID NO: 1437 and that SEQ ID NO: 90 of the instant application would be one of them and would be readily conceived as one of the options. Furthermore, Liu and Alpati have identified the I73T (T218C) mutation as a region of interest for CRISPR based correction of the mutation and Sun has identified a 20 bp region with a 3 bp PAM sequence (as used in SEQ ID NO: 90) as commonly used as the target sequence for a S. pyogenes Cas9 system (which is also identified by Liu as a Cas9 species that can be used in their method). Therefore, it would have been well understood that one could make a gRNA targeting the sequence of SEQ ID NO. 90 based on the 51 nucleotide target region identified by Liu and the known requirements for making an S. pyogenes based gRNA. As can be seen in the comparison of SEQ ID NO: 90 and SEQ ID NO: 1437, the 20 nucleotide protospacer (gRNA target sequence) and 3 nucleotide PAM sequence (for S. pyogenes CRISPR/Cas systems) are 100% identical. As such, one of ordinary skill in the art would readily identify the region of the 51 nucleotide SEQ ID NO: 1437 corresponding to SEQ ID NO: 90 as being a S. pyogenes target sequence as it fits all the known criteria for Cas9 based targeting and editing of that target sequence (20 nucleotide protospacer region with a 3 nucleotide PAM (NGG) sequence). Therefore, Applicant’s arguments are considered unpersuasive. Applicant further argues that the Examiner appears to be disregarding the section related to "multiple technical and biological roadblocks to overcome" as described at page 287, first full paragraph. These include appropriate levels of editing of the target gene, ensuring low levels of off target effects, ethical considerations, the need for short and long term studies and risk of subsequent cancer development. Applicant further cites to teachings from Sun regarding the challenges associated with CRISPR based gene editing in vivo, including off-target effects, in vivo delivery vectors, and immune responses (page 9, paragraph 1-page 10, paragraph 1). Applicant's arguments have been fully considered but they are not persuasive. The Examiner’s has not disregarded the known challenges associated with CRISPR Cas editing systems. As can be seen in Alapati and Sun, both identify off-target effects and viral vector safety concerns as important considerations when considering treating a disease using CRISPR Cas gene editing. However, it is important to note that both Alapati and Sun identify potential solutions to overcome each of their identified challenges. For example, Alapati identifies the challenge of off-target effects and solutions including the use of paired Cas9 nickases to induce single-stranded breaks, and other endonucleases that do not require transactivating crRNA and cleave DNA in a staggered pattern to create sticky ends. Similarly, Alapati identifies safety challenges associated with the use of lentiviral vectors for delivering Cas9/gRNA as lentiviruses can cause lentiviral-induced insertional mutagenesis that can lead to cancer and potential solutions, such as using AAV vectors to circumvent this challenge (page 287, column 1, paragraph 1-ppage 288, column 2, paragraph 1). Therefore, although the art has identified these as known challenges associated with CRISPR Cas gene editing, they also identify potential solutions to overcome these known challenges. Furthermore, the Alapati paper is explicitly directed to potential uses of CRISPR to treat monogenic lung diseases. As such, Alapati understands the potential challenges but still considers treating monogenic lung diseases, such as SFTPC deficiency, with CRISPR as a viable treatment consideration. Therefore, although there are known challenges associated with CRISP Cas gene editing systems, Alapati and Sun have considered these challenges and offered potential solutions to overcome them and do not undermine the motivation for using CRISPR Cas editing systems to treat monogenic lung diseases. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEENAN A BATES whose telephone number is (571)270-0727. The examiner can normally be reached M-F 7:30-5:00. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Doug Schultz can be reached on (571) 272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /KEENAN A BATES/Examiner, Art Unit 1631
Read full office action

Prosecution Timeline

Show 3 earlier events
Apr 08, 2025
Response Filed
Jun 11, 2025
Final Rejection mailed — §103, §112
Nov 12, 2025
Response after Non-Final Action
Dec 11, 2025
Request for Continued Examination
Dec 16, 2025
Response after Non-Final Action
Mar 02, 2026
Non-Final Rejection mailed — §103, §112
Jul 02, 2026
Response Filed
Sep 15, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12723061
METHOD FOR PREVENTING OR TREATING CANCER BY BLOCKING EXCESSIVE PRODUCTION OF PHOSPHORYLATED VIMENTIN
3y 4m to grant Granted Sep 01, 2026
Patent 12674150
TARGET-SPECIFIC CRISPR MUTANT
1y 1m to grant Granted Jul 07, 2026
Patent 12655380
FLUIDIC DEVICE
4y 9m to grant Granted Jun 16, 2026
Patent 12617828
GENETICALLY MODIFIED IMMUNE CELL, PREPARATION METHOD THEREFOR, AND APPLICATION
4y 7m to grant Granted May 05, 2026
Patent 12605467
RECOMBINANT AAV VECTORS FOR TREATING NEURODEGENERATIVE DISORDERS
1y 6m to grant Granted Apr 21, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

5-6
Expected OA Rounds
46%
Grant Probability
99%
With Interview (+79.5%)
3y 6m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 77 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month