DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant' s correspondence received August 25, 2025. Claims 1, 10, 12-14, 16, 17, 21, 23, 25, 57-60, 62, 64, 68, and 69 are currently pending.
Any rejection or objection not reiterated herein has been overcome by amendment. Applicant' s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 21, 23, 57, and 58 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding Claims 21, 23, 57, and 58, the claims recite a limitation for “Table 1”. MPEP 2173.05(s) states "Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table "is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience." Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993) (citations omitted)." Table 1 recites a reasonable amount of entries such that the applicant can directly list the claims limitations in the claim language.
RE: 35 USC § 112(b) - Applicant’s Arguments
Applicant argues, “Table 1 is about 9 pages long and lists a substantial number of diseases, transcripts, and codons. Listing the contents of Table 1in the claims would not be practical.” The applicant’s argument is not persuasive because the diseases, transcripts, and codons are present in duplicate such that the claim language would not be 9 pages, and applicant has shown that it is practical in Claim 25 by listing out the disorders.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1, 10, 12-14, 16, 17, 59, 60, 62, 68 and 69 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Kirchner, S. et. al., PLOS Biology, Vol. 15, No. 5, p. 1-29, published May 16, 2017 referenced as Kirchner 2.
Regarding Claim 1, the instant specification defines a tRNA-based effector molecule, or TREM as “an RNA molecule comprising a structure or property from (a)-(v) below, and which is recombinant TREM, a synthetic TREM or a TREM expressed from a heterologous cell” (p. 52, lines 26-28). Property (g) states “a tertiary structure”. A TREM may be any one of SEQ ID NO: 1-451 in Table 2, which are the natural human tRNA sequences (p. 78; p.79-107). Therefore, a TREM is interpreted to include natural human tRNA sequences and RNA sequences with a tertiary structure which is recombinant, synthetic or expressed from a heterologous cell.
Claim 1 also recites “tRNA moiety”. The instant specification provides, “a tRNA
moiety comprises an endogenous tRNA and/or a TREM”. Therefore, a “tRNA moiety” is an endogenous tRNA or TREM molecule.
Regarding Claim 1, Kirchner 2 teaches a method of modulating a tRNA pool in a cell or a subject comprising an endogenous open reading frame, in which the ORF comprises a codon having a first sequence comprising acquiring knowledge of the abundance one or more tRNA moieties having different anticodons that each pair with a codon of an ORF by “using tRNA-tailored microarrays” including measuring tRNA isoacceptors (p. 8). Kirchner 2 also teaches their method includes contacting the cell with a composition comprising a tRNA molecule that pairs with a first codon in which the transfection of a tRNA modulates the relative amounts of the transfected tRNA moiety to another tRNA moiety and the TREM mediates acceptance and incorporation of an amino acid in the elongation of a peptide chain: “tRNAs were transfected with Lipofectamine 2000 “ (p. 15); “the transfected tRNAThr(CGU) was translationally active” (p. 11). Kirchner 2 teaches tRNAThr has a 75 nucleotide sequence (p. 15). Therefore, Claim 1 is anticipated by Kirchner 2.
Regarding Claim 10, Kirchner 2 teaches that their method is in response to a synonymous single nucleotide polymorphism which introduces a codon pairing to a low-abundance tRNA, thereby having acquired knowledge of the abundance of the tRNA (p. 1, Author summary). Therefore, Claim 10 is anticipated by Kirchner 2.
Regarding Claim 12, Kirchner 2 teaches tRNAThr(CGU) which pairs with ACG and is not a stop codon. Therefore, Claim 12 is anticipated by Kirchner 2.
Regarding Claim 13, Kirchner 2 teaches a method of modulating a tRNA pool in a cell comprising transfection of tRNAThr(CGU) into a cell with a codon comprising a SMC: “we selected only synonymous SNPs in the CFTR coding sequence” (p. 3). Kirchner 2 teaches, “The T2562G sSNP exchanges the Thr854-ACT codon for a Thr854-ACG triple”, which the tRNAThr(CGU) pairs with, and therefore teaches a TREM isoacceptor moiety that pairs with the SMC. Kirchner 2 teaches tRNAThr has a 75 nucleotide sequence (p. 15). Kirchner 2 further teaches the tRNAThr(CGU) incorporates the amino acid associated in nature with the anti-codon of the TREM for elongation in a peptide chain: “Enhanced tRNAThr (CGU) levels rescue the effects of the T2562G mutation”; “Moreover, the transfected tRNAThr (CGU) was translationally active” (p. 10-11). Therefore, Claim 13 is anticipated by Kirchner 2.
Regarding Claim 14, Kirchner 2 teaches the method of modulating a tRNA pool in a cell with endogenous tRNA that pairs with both the SMC and other codons. Therefore, Claim 14 is anticipated by Kirchner 2.
Regarding Claim 16, a subject is interpreted to include a cell. Kirchner 2 teaches a method of treating a cell having an endogenous ORF comprising a codon comprising a SMC, CFTR- T2562G, in which the method comprises providing a tRNA comprising an isoacceptor tRNA moiety having an anticodon that pairs with the SMC, contacting the cell with the composition comprising a TREM for sufficient time to treat the cell. Kirchner 2 teaches tRNAThr has a 75 nucleotide sequence (p. 15) and incorporates Thr for elongation in a peptide chain, which rescues expression of the peptide and treats the cell. Therefore, Claim 16 is anticipated by Kirchner 2.
Regarding Claim 17, a subject is interpreted to include a cell. Kirchner 2 teaches a method of acquiring knowledge of the SMC in a cell, and in response to that knowledge, contacting the cell with a composition comprising a tRNA, which has a moiety that pairs with the SMC, is at least 73 nucleotides long, and incorporates an amino acid for elongation of a peptide chain, which rescues expression of the peptide and treats the cell. Therefore, Claim 17 is anticipated by Kirchner 2.
Regarding Claim 59, Kirchner 2 teaches the transfection of a TREM in which the natural tRNA is present (p. 7) and therefore, the first moiety may comprise of the TREM and endogenous tRNA. Therefore, Claim 59 is anticipated by Kirchner 2.
Regarding Claim 60, Kirchner 2 teaches the transfection of a TREM in which the natural tRNA is present (p. 7) with respect to an isoacceptor moiety, and therefore, the second moiety may comprise of the TREM and endogenous tRNA. Therefore, Claim 60 is anticipated by Kirchner 2.
Regarding Claim 62, the ORF used in the method of Kirchner 2 is for the CFTR protein (p. 3), which is a polypeptide. Therefore, Claim 62 is anticipated by Kircher.
Regarding Claim 68, Kirchner 2 teaches a tRNA performing a cognate adaptor function by binding to Thr and incorporating into the peptide chain. Therefore, Claim 68 is anticipated by Kircher.
Regarding Claim 69, Kirchner 2 teaches the sequence of tRNAThr(CGU) which comprises of a sequence with 100% identity to SEQ ID NO: 217. An alignment is provided below.
Qy 1 GGCGCGGTGGCCAAGTGGTAAGGCGTCGGTCTCGTAAACCGAAGATCACGGGTTCGAACC 60
|||||||||||||||||||||||||||||||||||||||||||||||:||||||||||||
Db 1 GGCGCGGTGGCCAAGTGGTAAGGCGTCGGTCTCGTAAACCGAAGATCRCGGGTTCGAACC 60
Qy 61 CCGTCCGTGCCT 72
||||||||||||
Db 61 CCGTCCGTGCCT 72
Therefore, Claim 69 is anticipated by Kirchner 2.
RE: Response to Applicant’s Arguments - 35 USC § 102
Applicant’s arguments with respect to claims 1, 10, 12-14, 21, 23, 25, 57-60, 62, 68 and 69 have been considered but are moot because the new ground of rejection does not rely on any reference applied in the prior rejection of record for any teaching or matter specifically challenged in the argument.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 21, 23, and 25 are rejected under 35 U.S.C. 103 as being unpatentable over Kirchner, S. et. al., PLOS Biology, Vol. 15, No. 5, p. 1-29, published May 16, 2017 referenced as Kirchner 2 as applied to Claim 1 above, and further in view of Sauna, Z. and Kimchi-Sarfaty, C., Nature Reviews Genetics, Vol. 12, p. 683-691, published August 21, 2011.
Regarding Claim 21, Kirchner 2 anticipates Claim 1. Kirchner 2 teaches, “Genome-wide association studies link sSNPs [SMCs] with ~50 diseases in humans” (p. 2, para 2). Kirchner 2 further teaches “provide the first direct evidence for the central role of tRNA in mediating the effects of an sSNP” providing a suggestion to examine the role of tRNA for mediating the effects of a SMC.
Kirchner 2 does not teach the disorders or symptoms from Table 1.
Sauna teaches a list of 44 diseases caused by SMCs including Alzheimer’s, depression and Crohn’s Disease (Table S-1), which are listed in Table 1 of the instant application.
It would be obvious to one skilled in the art before the effective filing date to try the teachings of Kirchner 2 to create the method of Claim 1 with respect to the diseases listed by Sauna. Kirchner 2 teaches there is a need in the art to identify methods to understand and ameliorate diseases caused by SMCs. Kirchner 2 provides a method by transfecting tRNA molecules into a cell which correspond to the SMC such that the mutant gene is correctly expressed. Sauna provides a limited list of potential targets, of which several overlap with Table 1 of the instant application. One skilled in the art would have a reasonable expectation of success because Kirchner 2 was able to rescue expression in a cell with a SMC. Therefore, Claim 21 is obvious over Kirchner 2 in further view of Sauna.
Regarding Claim 23, Sauna teaches the ORF codons in which without contact with a TREM, there is a disorder or symptom from Table 1. Therefore, Claim 23 is obvious over Kirchner 2 in further view of Sauna.
Regarding Claim 25, Sauna teaches Alzheimer’s disease, depression, and Crohn’s disease. Therefore, Claim 25 is obvious over Kirchner 2 in further view of Sauna.
Claim 64 is rejected under 35 U.S.C. 103 as being unpatentable over Kirchner, S. et. al., PLOS Biology, Vol. 15, No. 5, p. 1-29, published May 16, 2017 referenced as Kirchner 2 as applied to Claim 1 above, and further in view of Pappalardo, J., et. al., WO 2014/055941 A2, published April 10, 2014.
Regarding Claim 64, Kirchner 2 anticipates Claim 1.
Kirchner 2 does not teach pharmaceutical compositions.
Pappalardo teaches a pharmaceutical composition including tRNAs: “the disclosure includes the pharmaceutical composition … composition further comprises an active substance … for example, an immunomodulator. Immunomodulators include … tRNA” (p. 22, [0079]).
It would be obvious to one skilled in the art before the effective filing date to combine the teachings of Kirchner 2 with the teachings of Pappalardo to create the method of Claim 1 in which the TREM is in a pharmaceutical composition. Kirchner 2 teaches Claim 1 including the use of a tRNA as a TREM, and Pappalardo teaches how to create a pharmaceutical composition with tRNA. One of ordinary skill in the art could have combined these methods and each step can be performed separately. The results would be predictable because pharmaceutical compositions are well known in the art, and Kirchner 2 was able to use a TREM to continue protein elongation and expression. Therefore, Claim 62 is obvious over Kirchner 2 in further view of Pappalardo.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Krishna Nuggehalli Ravindra whose telephone number is (571)272-2758. The examiner can normally be reached M-Th, alternate F, 8a-5p est.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/K.N.R./Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636