Prosecution Insights
Last updated: July 17, 2026
Application No. 17/616,350

OLIGONUCLEOTIDES AND METHODS OF USE FOR TREATING NEUROLOGICAL DISEASES

Final Rejection §103
Filed
Dec 03, 2021
Priority
Jun 03, 2019 — provisional 62/856,264 +3 more
Examiner
RAVINDRA, KRISHNA NUGGEHALLI
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Quralis Corporation
OA Round
2 (Final)
57%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
82%
With Interview

Examiner Intelligence

Grants 57% of resolved cases
57%
Career Allowance Rate
8 granted / 14 resolved
-2.9% vs TC avg
Strong +25% interview lift
Without
With
+25.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
10 currently pending
Career history
38
Total Applications
across all art units

Statute-Specific Performance

§101
5.6%
-34.4% vs TC avg
§103
59.3%
+19.3% vs TC avg
§102
7.4%
-32.6% vs TC avg
§112
20.4%
-19.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 14 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status This action is written in response to applicant' s correspondence received December 22, 2025. Claims 1, 3, 5, 7, 12, 19-29, 31, 35, and 36 are currently pending. The restriction requirement mailed April 24, 2025 is still deemed proper. Applicant has elected SEQ ID NO: 237 and SEQ ID NO: 912 without traverse in the reply filed June 24, 2025. Any rejection or objection not reiterated herein has been overcome by amendment. Applicant' s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1, 3, 5, 7, 12, 19, 20, 26-29, and 35 are rejected under 35 U.S.C. 103 as being unpatentable over Havens, M. et. al., WIREs RNA, Vol. 4, p. 247-266, Published online April 17, 2013; Melamed et al., Nature Neuroscience, Vol. 22, p. 180-190, Jan 14, 2019; and Khvorova, A. and Watts, J., Nature Biotechnology, Vol. 35, Issue 3, p. 238-248, Published online Feb 27, 2017. Regarding Claim 1, Havens teaches, “ASOs [antisense oligonucleotides] are short oligonucleotides, typically 15–25 bases in length, which are the reverse complement sequence of a specific RNA transcript target region” (p. 250, Col. 1), which reads as an oligonucleotide that may be at least 19 nucleotides long with a complementary sequence to a target RNA transcript. Regarding Claim 1, Havens teaches an oligonucleotide comprising linked nucleosides with at least a 19 contiguous nucleobases that 100% complementary to a target sequence: “ASOs [antisense oligonucleotides] are short oligonucleotides, typically 15–25 bases in length, which are the reverse complement sequence of a specific RNA transcript target region” (p. 250, Col. 1) Haven teaches that the target sequence may be near the splicing site of a pre-mRNA: “ASO binding to a target RNA sterically blocks access of splicing factors to the RNA sequence at the target site. Thus, an ASO targeted to a splice site will block splicing at the site, redirecting splicing to an adjacent site” (p. 250, Col. 1). Havens provides motivation to target distinct isoforms “to correct RNA expression for therapeutic benefit” (p. 250, Col. 2) and has an advantage of “high substrate specificity and low toxicity” (p. 250, Col. 2). Havens does not teach oligonucleotides with complementary sequence to an equal length portion of a nucleobase sequence within positions 144-276 of SEQ ID NO: 944 or non-natural linkages in oligonucleotides. Melamed teaches an alternate truncated mRNA sequence of stathmin-2 that comprises exon 2a, which is caused by TDP-43 dysfunction (p. 184, Figure 3d). Exon 2a has 100% sequence identity with SEQ ID NO: 944 positions 193-313. Melamed teaches sequence prior to exon 2a is the 3’ splice site, which aligns with SEQ ID NO: 944 positions 187-192. An alignment with the 3’ splice site, which is underlined and exon 2a is below. SEQ ID 944 TTGCAGGACTCGGCAGAAGACCTTCGAGAGAAAGGTAGAAAATAAGAATTTGGCTCTCTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Exon 2a TTGCAGGACTCGGCAGAAGACCTTCGAGAGAAAGGTAGAAAATAAGAATTTGGCTCTCTG SEQ ID 944 TGTGAGCATGTGTGCGTGTGTGCGAGAGAGAGAGACAGACAGCCTGCCTAAGAAGAAATG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Exon 2a TGTGAGCATGTGTGCGTGTGTGCGAGAGAGAGAGACAGACAGCCTGCCTAAGAAGAAATG SEQ ID 944 AATGTGAATGCGGCTTGTGGCACAGTTGACAAGGATGATAAATCAATAATGCAAGCT ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Exon 2a AATGTGAATGCGGCTTGTGGCACAGTTGACAAGGATGATAAATCAATAATGCAAGCT Melamed teaches restoring proper expression of stathmin-2 is a potential “therapeutic strateg[y] for ALS, FTD, and other neurodegenerative diseases affected by TDP-43 proteinopathy” (p. 189, col. 2). Khvorova teaches non-natural linkages: “The first chemical modification applied to antisense technology is still the most widely used: the phosphorothioate backbone. … Although originally incorporated to provide nuclease stability, the major impact of phosphorothioate modification has been on oligonucleotide trafficking and uptake” (p. 239, Col. 1). Regarding Claim 1, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to combine the teachings of Havens, Melamed, and Khvorova to create a oligonucleotide comprising 19 contiguous nucleobases, wherein at least one linkage is non-natural and has a 100% complementary sequence to an equal length portion of SEQ ID NO. 944 near the splice site at positions 187-192, which is within positions 144-276. One skilled in the art would motivated to combine the teachings of Havens and Melamed to create an antisense oligonucleotide that targeted the site of aberrant splicing in stathmin-2, which would create a transcript with a complementary sequence to SEQ ID NO: 944, and use the teachings of Khvorova to use non-natural linkages because Havens teaches that targeting the site of aberrant splicing with an antisense oligonucleotide will prevent the aberrant splicing, Melamed teaches that restoration of full length stathim-2 is possible therapeutic strategy for ALS, and Khvorova teaches that using a phosphorothioate backbone will improve uptake. One skilled in the art would have a reasonable expectation of success because Havens teaches the method to use antisense oligonucleotides to correct for aberrant splicing has been done successfully. Therefore, Claim 1 is obvious over Havens, Melamed and Khvorova. Regarding Claim 3, the applicant has elected SEQ ID NO: 237 and 912. Claim 1 is obvious over Havens, Melamed and Khvorova. Havens does not teach SEQ ID NO: 237 and 912. Melamed teaches exon 2a which is complementary to SEQ ID NO: 237 and 912. An alignment between Exon 2a taught by Melamed and SEQ ID NO: 237 and 912 is below. SEQ ID NO: 237 1 GCACACATGCTCACACAGAGAGCCA 25 ||||||||||||||||||||||||| Exon 2a 69 GCACACATGCTCACACAGAGAGCCA 45 SEQ ID NO: 912 1 GCACACATGCTCACACAGAGAGC 23 ||||||||||||||||||||||| Exon 2a 69 GCACACATGCTCACACAGAGAGC 47 It would have been obvious to one skilled in the art to try to use the methods taught by Havens and Khovrova to create an oligonucleotide that comprises of a sequence complementary to SEQ ID NO: 237 and at least one non-natural linkage using the sequence taught by Melamed. Melamed teaches that there is a recognized need to correct for aberrant splicing in stathim-2 pre-mRNA to help patients with neurodegenerative diseases. Melamed teaches an alternate spliced form of stathim-2, including Exon 2a, to target. Havens teaches a predictable potential solution in using an antisense oligonucleotide to target the site of aberrant splicing, which has been used successfully to target other aberrant spliced pre-mRNA. Havens teaches antisense oligonucleotides are 15-25 nucleotides long, and therefore, there are a finite number of possible complementary oligonucleotides generated through this method. One skilled in the art would have pursued the strategy of creating antisense oligonucleotide sequences to target Exon 2a using the methods of Havens and Khovrova and have a reasonable expectation of success in creating an oligonucleotide with identity to SEQ ID NO: 237 because SEQ ID NO: 237 has identity with Exon 2a, is 25 nucleotides long, and the methods of Havens and Khovrova have been used for other pre-mRNA successfully. Therefore, Claim 3 is obvious over Havens, Melamed, and Khvorova. Regarding Claim 5, SEQ ID NO: 237 is a reverse complementary sequence to the sequence taught by Melamed. Therefore, Claim 5 is obvious over Havens, Melamed, and Khvorova. Regarding Claim 7, SEQ ID NO: 912 is a reverse complementary sequence to the sequence taught by Melamed. Therefore, Claim 7 is obvious over Havens, Melamed, and Khvorova. Regarding Claim 12, Exon 2a, taught by Melamed, has 100% identity with SEQ ID NO: 944 from positions 193 to 363 of SEQ ID NO: 944, which includes positions 197-221, 237-261, 249-273, or 252-276. Therefore, Claim 12 is obvious over Havens, Melamed, and Khovrova. Regarding Claim 19, Havens teaches oligonucleotides are typically between 15-25 nucleotides long, which falls in the range 19 to 40 nucleotides long. Therefore, Claim 19 is obvious over Havens, Melamed, and Khovrova. Regarding Claim 20, Khovrova teaches the use of phosphorothioate linkages. Therefore, Claim 19 is obvious over Havens, Melamed, and Khovrova. Regarding Claims 26 and 27, Claim 1 is obvious over Havens, Melamed, and Khovrova. Havens does not teach 5-methyl cytosine. Khovrova teaches, “Methylation of the 5′-carbon to give (S)-5′-C-methyl-RNA has also been used to enhance 3′ exonuclease resistance” (p. 243, col. 2). It would have been obvious to one skilled in the art before the effective filing date to combine Havens, Melamed, and Khovrova to create the oligonucleotide of Claim 1 with a 5-methyl cytosine, a modified nucleobase, because 5-methyl cytosine enhances exonuclease resistance. Therefore, Claims 26 and 27 are obvious over Havens, Melamed, and Khovrova. Regarding Claims 28 and 29, Claim 1 is obvious over Havens, Melamed, and Khovrova. Havens does not teach modified sugar moieties. Khovrova teaches modified sugar moieties 2’-OMe and 2’MOE : “The 2′-O-methyl (2′-OMe) modification of RNA (2′-OMe-RNA), which occurs in nature, improves binding affinity and nuclease resist-ance and reduces immune stimulation … 2′-O-methoxyethyl (2′-MOE) emerged as one of the most useful analogs, providing a further increase in nuclease resistance and a jump in binding affinity (ΔTm) 0.9 °C to 1.7 °C per modified nucleotide” (p. 239, col. 1). Khovrova teaches sugar moieties have been used in approved drugs: “… approved anti-sense drug Kynamro, as well as numerous oligonucleotide drugs currently in clinical trials” (p. 239, col. 1).” It would have been obvious to one skilled in the art before the effective filing date to combine the teachings of Havens, Melamed, and Khovrova to create the oligonucleotide of Claim 1 with modified sugar moieties 2’-OMe or 2’-MoE because it improves binding affinity, improves nuclear resistance and reduces immune stimulation. One skilled in the art would expect a reasonable chance of success with modified sugar moieties 2’-OMe or 2’-MoE because Khovrova teaches the modification has been used in approved drugs. Therefore, Claims 28 and 29 are obvious over Havens, Melamed, and Khovrova. Regarding Claim 35, Khovrova teaches the use of 2’-MOE nucleosides. It would have been obvious to one skilled in the art prior to the effective filing date to modify all the nucleosides of Claim 1 with 2’-MOE nucleosides because binding affinity increases with each modified nucleoside with 2’-MOE. Therefore, Claim 35 is obvious over Havens, Melamed, and Khovrova. Claim 21 is rejected under 35 U.S.C. 103 as being unpatentable over Havens, M. et. al., WIREs RNA, Vol. 4, p. 247-266, published online April 17, 2013; Melamed et al., Nature Neuroscience, Vol. 22, p. 180-190, Jan 14, 2019; and Khvorova, A. and Watts, J., Nature Biotechnology, Vol. 35, Issue 3, p. 238-248, published online Feb 27, 2017 as applied to Claim 1 above, and further in view of Stein, C. et. al., Nucleic Acids Research, Vol. 16, Issue 8, p. 3209-3221, Apr 25, 1988. Regarding Claim 21, Claim 1 is obvious over Havens, Melamed, and Khovrova. Havens does not teach an oligonucleotide wherein at least 2 linkages of the oligonucleotide are phosphodiester bonds. Stein teaches phosphodiester bonds: “The Tm of AT base pairs with phosphorothioate substitution show a greater reduction than exhibited by GC base pairs. Consequently, a high GC content is preferable if hybridization is operative for the biological function of such an oligomer” (p. 3219, para 2), in which the substitution is over the normal phosphodiester bond. It would have been obvious to one skilled in the art before the effective filing date to combine the teachings of Havens, Melamed, and Khovrova to create the oligonucleotide of Claim 1. When incorporating the teachings of Khovrova to use phosphorothioate bonds, one skilled in the art would also combine the teachings of Stein to use two or more phosphodiester bonds as necessary to optimize for hybridization based on nucleotide content. One skilled in the art would have a reasonable expectation of success because optimizing binding affinity for biological activity is a routine optimization. Therefore Claim 21 is obvious over Havens, Melamed, and Khovrova in view of Stein. Claims 22 – 25, and 31 are rejected under 35 U.S.C. 103 as being unpatentable over Havens, M. et. al., WIREs RNA, Vol. 4, p. 247-266, Published online April 17, 2013; Melamed et al., Nature Neuroscience, Vol. 22, p. 180-190, Jan 14, 2019; and Khvorova, A. and Watts, J., Nature Biotechnology, Vol. 35, Issue 3, p. 238-248, Published online Feb 27, 2017 as applied to claim 1 above, and further in view of Eckstein, F., et. al., Nucleic Acid Therapeutics, Vol. 24, Issue 6, p. 374-387, Dec 24, 2014. Regarding Claim 22, Claim 1 is obvious over Havens, Melamed, and Khovrova. Havens does not teach an oligonucleotide comprising at least two modified antinucleoside linkages. Eckstein teaches the use of phosphonothioated bonds: “In order to bypass the requirement of a carrier for cellular uptake of the double stranded siRNA, a fully phosphorothioated single-stranded version has been developed … This strategy has found particular application in allele-selective inhibition of genes with an expanded CAG repeat such as in Huntington and Machado-Joseph diseases” (p. 379, col. 2 – p. 380, col. 1). It would have been obvious to one skilled in the art before the effective filing date to combine the teachings of Havens, Melamed, Khovrova, and Eckstein to create the oligonucleotide of Claim 1 fully phosphorothioated, which would have more than two modified linkages because the modified linkages would allow the oligonucleotide to bypass the requirement of a carrier for cellular uptake. One skilled in the art would have a reasonable expectation of success because Eckstein teaches using a fully phosphorothioated antisense oligonucleotide has been used successfully. Therefore, Claim 22 is obvious over Havens, Melamed, and Khovrova in view of Eckstein. Regarding Claims 23 and 24, it would be obvious to one skilled in the art before the effective filing date to combine the teachings of Havens, Melamed, Khovrova, and Eckstein to create the oligonucleotide of Claim 1 fully phosphorothioated, which would have more than two phosphonotioate linkages, because it would bypass the requirement of a carrier for cellular uptake. Therefore, Claims 23 and 24 are obvious over Havens, Melamed, and Khovrova in view of Eckstein. Regarding Claim 25, Eckstein teaches, “The chemical synthesis of the phosphorothioate oligonucleotides results in a roughly 1:1 mixture of the two diastereomers (Rp and Sp)” (p. 379, col. 1), which reads as a phosphonothioate linkage is inherently in either a Rp or Sp configuration. Therefore, Claim 25 is obvious over Havens, Melamed, and Khovrova in view of Eckstein. Regarding Claim 31, the broadest interpretation of Claim 31 is the oligonucleotide of Claim 1 which comprises one or more 2’-MOE modifications and are linked through phosphorothioate linkages. The narrowest interpretation of Claim 31 is oligonucleotide of Claim 1 where in all nucleotides contain the 2’MOE modification, all cytosines contain the 5’-methyl cytosine modification, and all linkages are phosphorothioate linkages. Havens does not teach 5’-methyl cytosine modification and phosphorothioate linkages. Khovrova teaches the use of 2’-MOE nucleosides to increase nuclease resistance and binding affinity and the use of 5-methyl cytosine for exonuclease resistance. Eckstein teaches the use of phosphonothioate linkages. It would have been obvious to one skilled in the art before the effective filing date to combine the teachings of Havens, Melamed, and Khovrova in view of Eckstein to create the oligonucleotide of Claim 1 with one or more 2’-MOE modifications linked with all phosphonothioate linkages because Khovrova teaches the use of 2’-MOE nucleosides to increase nuclease resistance and binding affinity and Eckstein teaches the use of phosphonothioate linkages for every linkage to bypass the requirement of a carrier for cellular uptake. It would also be obvious to one skilled in the art before the effective filing date to combine the teachings of Havens, Melamed, and Khovrova in view of Eckstein to create the oligonucleotide of Claim 1 where in all nucleotides contain the 2’MOE modification, all cytosines contain the 5’-methyl cytosine modification, and all linkages are phosphorothioate linkages because each Khovrova teaches that each modification improves binding affinity and exonuclease resistance and Eckstein teaches the use of phosphonothioate linkages for every linkage to bypass the requirement of a carrier for cellular uptake. Khovrova provides motivation for using multiple modifications: “This simple combination of backbone and sugar modification provides additional resistance to exonucleases—the primary effectors of RNA degradation—and an order-of-magnitude increase in oligonucleotide accumulation in vivo” (p. 243, col. 2). One skilled in the art would have a reasonable expectation of success because Khovrova teaches, “To achieve clinical productivity, the chemical architecture of the oligonucleotide needs to be optimized with a combination of sugar, backbone, nucleobase, and 3′- and 5′-terminal modifications. … minor chemical changes often translating into major improvements in clinical efficacy” (p. 238, Abstract). Therefore, Claim 31 is obvious over Havens, Melamed, and Khovrova in view of Eckstein in both Claim 31’s broadest and narrowest interpretation. Claim 36 is rejected under 35 U.S.C. 103 as being unpatentable over Havens, M. et. al., WIREs RNA, Vol. 4, p. 247-266, Published online April 17, 2013; Melamed et al., Nature Neuroscience, Vol. 22, p. 180-190, Jan 14, 2019; and Khvorova, A. and Watts, J., Nature Biotechnology, Vol. 35, Issue 3, Published online Feb 27, 2017 as applied to claim 1 above, and further in view of Hua, Y., et. al., Genes & Development, Vol 24, p. 1634-1644, Aug 1, 2010. Regarding Claim 36, Claim 1 is obvious over Havens, Melamed, and Khovrova. Havens teaches the use of antisense oligonucleotides for targeting pre-mRNA to modulate splicing upon administration to a cell: “ASO binding to a target RNA sterically blocks access of splicing factors to the RNA sequence at the target site. Thus, an ASO targeted to a splice site will block splicing at the site, redirecting splicing to an adjacent site” (p. 250, Col. 1). Melamed teaches that aberrant splicing of stathmin-2 pre-mRNA leads to truncated stathmin-2 transcripts. xxxxxx Melamed provides motivation to increase the amount of full-length transcript as it rescues regeneration of the neuron: “Despite the prior sustained (16 days) reduction in stathmin-2, subsequent restoration of stathmin-2 expression almost completely rescued regeneration after axotomy … restoration of stathmin-2 alone was sufficient to rescue regeneration after axotomy of TDP-43 depleted motor neurons” (p. 188, col 1). Havens, Melamed, and Khovrova do not teach at least a 30% increase in full length stathmin-2 transcript upon administration to a neuron. Hua recites the use of an oligonucleotide administered to a cell to correct for aberrant splicing to increase the amount of full length protein from 10% to 30-90%: “Increasing survival of motor neuron 2, centromeric (SMN2) exon 7 inclusion to express more full-length SMN protein in motor neurons is a promising approach…. Previously, we identified a potent 2′-O-(2-methoxyethyl) (MOE) phosphorothioate-modified antisense oligonucleotide (ASO) that blocks an SMN2 intronic splicing silencer element and efficiently promotes exon 7 inclusion in transgenic mouse peripheral tissues after systemic administration.” (p. 1634, Abstract); “After ASO infusion at 10 mg per day, exon 7 inclusion in the SMN2 transgene mRNA increased to >30%, compared with ~10% in saline-treated mice, and ~90% inclusion was achieved at a dose of 50 mg per day” (p. 1635, col. 2). It would have been obvious to one skilled in the art before the effective filing date to combine Havens, Melamed, and Khovrova to create an oligonucleotide of Claim 1 that would correct for aberrant splicing of stathmin-2 and Hua teaches using an oligonucleotide to correct for aberrant splicing may increase the amount of full length transcript in a cell from 10% to 30-90%. In view of Hua, it would predictable that upon treatment of a cell expressing truncated stathmin-2 that the amount of full-length transcript relative to the level prior to treatment would increase in a dose dependent manner and would exceed 30%. One skilled in the art would be motivated to create the oligonucleotide of Claim 36 because Melamed teaches restoration of full length stathmin-2 is a potential treatment for neurological diseases. Therefore Claim 36 is obvious over Havens, Melamed and Khovrova in further view of Hua. RE: Applicant’s Arguments Applicant argues “Melamed does not explicitly teach the particular range of positions 144-276 of SEQ ID NO: 944. This argument is not persuasive because, as described above for Claim 1, Havens teaches antisense oligonucleotides that bind near the splicing site, and Melamed teaches SEQ ID NO: 944 positions 187-313 including the 3’ splice site as SEQ ID NO: 944 positions 187-192. One skilled in the art would be motivated to create an antisense oligonucleotide near the splicing site which is within the claimed range. MPEP 2144.05.I recites, “In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists.” The ranges of 144-276 and 187-313 overlap 90 out of 133 positions, and therefore the requirements of MPEP 2144.05 are met. Applicant further argues, “The oligonucleotides that are complementary to the claimed target region … demonstrate surprising abilities to decrease the levels of STMN2 RNA with a cryptic exon and/or increase the relative quantity of full length STMN2 transcript. … the unexpected results achieved by the claimed oligonucleotides would be sufficient to rebut the prima facie case”. This argument is not persuasive because mere attorney arguments are not specific evidence. MPEP 716.02(b) recites, “The evidence relied upon should establish ‘that the differences in results are in fact unexpected and unobvious and of both statistical and practical significance.’ … [A]ppellants have the burden of explaining the data in any declaration they proffer as evidence of non-obviousness.” Havens teaches one skilled in the art would expect an antisense oligonucleotide targeting near an aberrant splice site would correct the splicing due to steric hindrance. Hua teaches approximately 30-90% recovery is possible with an antisense oligonucleotide used to correct for aberrant splicing. The applicant references Figs 2-22B, 25A-28B as evidence without explanation of how the results are unexpected over the prior art, and the increase in expression of full length transcript is within the range Hua teaches. Conclusion No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Krishna Nuggehalli Ravindra whose telephone number is (571)272-2758. The examiner can normally be reached M-Th, alternate F, 8a-5p est. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /K.N.R./Examiner, Art Unit 1636 /NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Dec 03, 2021
Application Filed
Aug 27, 2025
Non-Final Rejection mailed — §103
Dec 22, 2025
Response Filed
Apr 08, 2026
Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12668847
SYSTEM AND METHOD FOR COMBATING INFECTIONS DUE TO PATHOGENS BELONGING TO PHYLUM PROTEOBACTERIA
4y 7m to grant Granted Jun 30, 2026
Patent 12522829
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
1y 2m to grant Granted Jan 13, 2026
Patent 12486520
INSECT EXTRACELLULAR VESICLES FOR DELIVERY OF NUCLEIC ACIDS
3y 9m to grant Granted Dec 02, 2025
Patent 12460189
RNA-GUIDED NUCLEASES AND DNA BINDING PROTEINS
4y 6m to grant Granted Nov 04, 2025
Patent 12441999
HYBRID htiRNA / NANOPARTICLE COMPLEX AND USE THEREOF FOR TREATING A DISEASE OF THE DIGESTIVE SYSTEM
3y 9m to grant Granted Oct 14, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
57%
Grant Probability
82%
With Interview (+25.0%)
3y 6m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 14 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month