DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of SEQ ID NO: 1-51 with respect to Claims 2 and 3 in the reply filed on July 11, 2025 is acknowledged.
Claims 1-12 and 15-17 are pending and under review.
Claim Objections
Claim 10 is objected to because of the following informalities:
Regarding Claim 10, the closing parenthesis for “(Previously Presented” is missing. To overcome this rejection, the applicant may amend the claim to “(Previously Presented)”
Appropriate correction is required.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 4 and 5 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding Claims 4 and 5, in the phrase “region upstream of an AUG site (start codon)”, it is unclear if the parenthetical “(start codon)” is a limitation on the claims. Start codons are not limited to the AUG site, and the AUG site may be present as a codon other than the start codon.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-12 and 15-17 are rejected under 35 U.S.C. 103 as being unpatentable over Carninci, P. et. al., US 2014/0107187 A1, published April 17, 2014 and Nabhan, J., et. al., Scientific Reports, Vol. 6, p. 1-10, February 17, 2016.
Regarding Claim 1, the instant specification defines a “functional nucleic acid molecule” as a nucleic acid molecule capable of enhancing the translation of a target mRNA (p. 3, Definitions). Therefore, the nucleic acid molecule in Claim 1 must enhance the translation of fraxatin.
Carninci teaches “a functional nucleic acid molecule … compris[ing] … antisense sequence to a target sequence in the protein-encoding RNA for which protein synthesis efficiency is to be increased and … a regulatory sequence having an activity of increasing of the protein synthesis efficiency” (p. 1, [0017-0019], which reads as a nucleic acid molecule enhancing translation of a target mRNA. The regulatory sequence may comprise of “an RNA, which is encoded by a DNA … shown in SEQ ID NO: 1 (SINE/B2 in AS Uchl1)” (p. 2, [0022]). Carninci further teaches how to develop an antisense sequence to a target sequence, in which the antisense sequence “can hybridize to the target sequence in the protein-encoding RNA” (p. 5, [0089]) and provides example antisense sequences that “are complementary to protein coding mRNAs” (p. 31, [0053]). Carninci provides further guidance with respect to the antisense sequence for a length from 8 to 249 nucleotides, but most preferably 15 to 30 nucleotides in length (p. 4, [0087]), and a target region including the 5’-UTR, coding region and both the 5’ UTR and coding region (p. 5, [0090-0091]). Regarding the target mRNA, Carninci teaches the invention with “is not especially limited in regard to its sequence, origin, and the like” with respect to the target mRNA (p. 4, [0083]), and “may be endogenous RNA of biological origin (for example, mRNA)” (p. 4, [0086]). Carninci teaches their invention may be used “for treatment of a disease caused by a quantitative decrease in a predetermined normal protein” including “neurodegenerative disease” (p. 8, [0128]).
Carninci does not teach the frataxin mRNA sequence or a complementary sequence to frataxin mRNA.
Nabhan teaches the frataxin (FXN) mRNA sequence: “We then generated FXN mRNA…” (p. 2, para 3). Nabhan also teaches that frataxin is an endogenous RNA of biological origin to humans: “heterozygous patients have ~50% FXN compared to non-carriers” (p. 1, para 2). Nabhan further teaches that the disease Friedreich’s ataxia is “predominantly a neurodegenerative disease” caused by reduction of FXN protein levels (p. 1, para 1) and has three different therapeutic strategies for treatment, of which one is “upregulation of endogenous FXN levels” (p. 5, Discussion).
Regarding Claim 1, it would have been obvious to one skilled in the art before the effective filing date to have substituted into the functional nucleic acid molecule of Carninci, comprising an antisense sequence and at least one regulatory sequence comprising an RNA comprising a SINE B2 element, an antisense sequence to frataxin mRNA, which is taught by Nabhan. The functional nucleic acid molecule of Carninci allows for the substitution of any antisense sequence, and it would be predictable to one skilled in the art that the substitution would work as Carninci provides evidence that an antisense sequence paired with a SINE/B2 regulatory sequence increases protein synthesis efficiency. One would be motivated to substitute in an antisense sequence complementary to frataxin mRNA because Carnninci teaches their invention is for treatment of neurodegerative diseases caused by reduced expression of a protein, and Nabhan teaches that upregulated frataxin levels is an established strategy for treating Friedreich’s ataxia, a neurodegerative disease. Therefore, Claim 1 is obvious over Carninci and Nabhan.
Regarding Claims 2 and 3, SEQ ID NO: 1 of Carninci teaches a DNA that encodes the RNA SEQ ID NO: 1 and SEQ ID NO: 2 of the instant application with 100% identity. Carninci teaches SEQ ID NO: 1 of its own application as SINE B2 in AS Uchl1 (p.2, [0022]). The instant specification teaches the instant SEQ ID NO: 1 and 2 as elements of the inverted SINE B2 element in AS Uchl1 (p. 8). Alignments are below:
SEQ ID NO: 1 aligned to SEQ ID NO: 1 of Carninci
Qy 1 CAGUGCUAGAGGAGGUCAGAAGAGGGCAUUGGAUCCCCCAGAACUGGAGUUAUACGGUAA 60
|||:||:||||||||:||||||||||||::|||:||||||||||:||||::|:||||:||
Db 84 CAGTGCTAGAGGAGGTCAGAAGAGGGCATTGGATCCCCCAGAACTGGAGTTATACGGTAA 143
Qy 61 CCUCGUGGUGGUUGUGAACCACCAUGUGGAUGGAUAUUGAGUUCCAAACACUGGUCCUGU 120
||:||:||:||::|:|||||||||:|:|||:|||:|::|||::||||||||:||:||:|:
Db 144 CCTCGTGGTGGTTGTGAACCACCATGTGGATGGATATTGAGTTCCAAACACTGGTCCTGT 203
Qy 121 GCAAGAGCAUCCAGUGCUCUUAAGUGCUGAGCCAUCUCUUUAGCUCC 167
|||||||||:||||:||:|::|||:||:||||||:|:|:::|||:||
Db 204 GCAAGAGCATCCAGTGCTCTTAAGTGCTGAGCCATCTCTTTAGCTCC 250
SEQ ID NO: 2 aligned to SEQ ID NO: 1 of Carninci
Qy 1 GAACUGGAGUUAUACGGUAACCUCGUGGUGGUUGUGAACCACCAUGUGGAUGGAUAUUGA 60
||||:||||::|:||||:||||:||:||:||::|:|||||||||:|:|||:|||:|::||
Db 124 GAACTGGAGTTATACGGTAACCTCGTGGTGGTTGTGAACCACCATGTGGATGGATATTGA 183
Qy 61 GUUCCAAACACUGGUCC 77
|::||||||||:||:||
Db 184 GTTCCAAACACTGGTCC 200
Therefore, Carninci teaches a regulatory sequence comprising a sequence with 100% identity to SEQ ID NO: 1 and 2, and Claim 2 and 3 are obvious over Carninci and Nabhan.
Regarding Claims 4 and 5, Claims 4 and 5 are rejected under 112(b) for indefiniteness. For compact prosecution, Claims 4 and 5 are interpreted as “region upstream of an AUG start codon”. Carninci teaches the target binding sequence is an antisense sequence that preferably has a length more than 7 nucleotides (p. 4, [0087]), which includes at least 10 nucleotides. The sequence may be designed to be reverse complementary to the 5’ UTR, coding sequence, or “both the 5’ UTR and a part of the other functional part of the sequence, like the coding sequence” (p. 5, [0090-0091]), which falls with in the range of 0 to 50 nucleotides reverse complementary to the 5’ UTR and 0 to 40 nucleotides reverse complementary of the coding sequence or 0 to 80 nucleotides reverse complementary of the region upstream of the AUG start codon and 0 to 40 nucleotides reverse complementary of the coding sequence. This also falls within the range of at least 14 nucleotides long compromising a sequence reverse complementary to 0 to 40 nucleotides of the 5’ UTR and 0 to 32 nucleotides of the coding sequence or a 0 to 70 nucleotide of the region upstream of AUG start codon and 0 to 4 nucleotides of the coding sequence. One skilled in the art would be able to use the teachings of Carninci to design a functional nucleic acid as described in Claims 4 and 5 using the frataxin mRNA sequence taught by Nabhan, and it would be predictable as reverse complementary binding is well known. Therefore, Claims 4 and 5 are obvious over Carninci and Nabhan.
Regarding Claim 6, Carninici teaches “a linker sequence … for connecting the target determinant sequence and the regulatory sequence” (p. 6, [0110]). Therefore Claim 6 is obvious over Carninci and Nabhan.
Regarding Claim 7, Carninci teaches the invention may be “an RNA vector comprising … functional RNA molecules” (p. 6, [0114]) and may be a RNA plasmid (p. 6, [0116]), which is circular. Therefore, Claim 7 is obvious over Carninci and Nabhan.
Regarding Claim 8, Carninci teaches “[a] DNA molecule according to the present invention encod[ing] any one of the aforementioned functional nucleic acid molecules according to the present invention” (p. 2, [0035]). Therefore, Claim 8 is obvious over Carninci and Nabhan.
Regarding Claim 9, Carninci teaches an expression vector comprising the functional nucleic acid (p. 6, [0116]). Therefore, Claim 9 is obvious over Carninci and Nabhan.
Regarding Claim 10, a composition comprising Claim 1 or an expression vector comprising Claim 1 is interpreted as not providing any additional structural limitation to Claim 1. Therefore, Claim 1 is obvious over Carninci and Nabhan.
Regarding Claim 11, Carninci teaches “[a] method for increasing the protein synthesis efficiency … compris[ing] the step of allowing any one of the aforementioned functional nucleic acid molecules or the aforementioned expression vector” (p. 2, [0038]) and “the method may comprise the step of transfecting ( or transducing) into a cell any one of the aforementioned functional nucleic acid molecules” (p. 2, [0039]). The functional nucleic acid molecule according to Claim 1 is obvious over Carninci and Nabhan. It would be obvious to one skilled in the art to use the functional nucleic acid molecule of Claim 1 with the method of Carninci because the functional nucleic acid molecule’s role is to change the expression of a target molecule, frataxin. It would be predictable because Carninci teaches that their method works for increasing protein synthesis efficiency. Therefore, Claim 11 is obvious over Carninci and Nabhan.
Regarding Claim 12, Nabhan teaches cells which exhibit a level of frataxin that is lower than the level of frataxin in a normal cell in FRDA patients: “In FRDA patients, FXN protein levels have been shown to be reduced in all tested cell types” (p. 1, para 1). It would be obvious to one skilled in the art to use the method according to Claim 11 with cells that express lower levels of frataxin because raising frataxin levels is a strategy for treating FRDA. The results would be predictable as Carninci teaches their method increases protein synthesis efficiency for a target RNA. Therefore, Claim 12 is obvious over Carninci and Nabhan.
Regarding Claim 15, Carninci teaches “[a] method for treating a disease according to the present invention, wherein the disease is caused by a quantitative decrease in a predetermined normal protein” Nabhan teaches that methods for treating FRDA includes raising frataxin levels (p. 5, Discussion). Claim 1 is obvious over Carninci and Nabhan. It would be obvious to one skilled in the art to use the method and functional nucleic acid molecule of Carninci with the teachings of Nabhan to create a functional nucleic acid molecule to increase the translation efficiency of frataxin because Carninci teaches their method may be use for diseases caused by low expression of a protein and Nabhan teaches FRDA is caused by low expression levels of frataxin. It would be predictable because Nabhan teaches that increasing frataxin levels in FRDA patients is a strategy for treating the disease. Therefore, Claim 15 is obvious over Carninci and Nabhan.
Regarding Claim 16, Nabhan teaches low level of frataxin occurs in human cells with FRDA, a mammalian cell. Therefore, Claim 16 is obvious over Carninci and Nabhan.
Regarding Claim 17, Carninci teaches the administration of the functional nucleic acid molecule can be “carried out in vivo” (p. 7, [0118]). Therefore, Claim 17 is obvious over Carninci and Nabhan.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1 and 2 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 2 and 3 of U.S. Patent No. 9353370 B2, referred as Forrest, issued May 31, 2016 in view of Nabhan, J., et. al., Scientific Reports, Vol. 6, p. 1-10, February 17, 2016.
Regarding Claim 1, Forrest claims in Claim 2 “a functional nucleic acid molecule … comprising: (a) target determinant sequence that is antisense to a target sequence in the protein encoding RNA .. and (b) a regulatory sequence … comprising a SINE derived sequence, wherein the SINE derived sequence is a SINE-B2 derived sequence”.
Forrest does not teach the frataxin mRNA sequence.
Nabhan teaches the frataxin mRNA sequence (p. 2, para 3).
It would be obvious to one skilled in the art to substitute in the frataxin mRNA sequence taught by Carninci for the target sequence in Claim 2 of Forrest to produce a functional nucleic acid molecule comprising a target binding sequence reverse complementary to a frataxin mRNA and a regulatory sequence comprising an RNA compromising a SINE B2 element. It would predictable as Forrest claims any target sequence in a protein encoding RNA will work for their invention. Therefore, Claim 2 is obvious over Forrest and Nabhan.
Regarding Claim 2, Forrest claims in Claim 3 “… wherein the regulatory sequence is .. an RNA, which is encoded by a DNA consisting of the nucleotide sequence shown in SEQ ID NO: 1”. SEQ ID NO: 1 has 100% identity to SEQ ID NO: 1 and 2 of the instant application. Alignments are shown below:
SEQ ID NO: 1 aligned to SEQ ID NO: 1 of Forrest
Qy 1 CAGUGCUAGAGGAGGUCAGAAGAGGGCAUUGGAUCCCCCAGAACUGGAGUUAUACGGUAA 60
|||:||:||||||||:||||||||||||::|||:||||||||||:||||::|:||||:||
Db 84 CAGTGCTAGAGGAGGTCAGAAGAGGGCATTGGATCCCCCAGAACTGGAGTTATACGGTAA 143
Qy 61 CCUCGUGGUGGUUGUGAACCACCAUGUGGAUGGAUAUUGAGUUCCAAACACUGGUCCUGU 120
||:||:||:||::|:|||||||||:|:|||:|||:|::|||::||||||||:||:||:|:
Db 144 CCTCGTGGTGGTTGTGAACCACCATGTGGATGGATATTGAGTTCCAAACACTGGTCCTGT 203
Qy 121 GCAAGAGCAUCCAGUGCUCUUAAGUGCUGAGCCAUCUCUUUAGCUCC 167
|||||||||:||||:||:|::|||:||:||||||:|:|:::|||:||
Db 204 GCAAGAGCATCCAGTGCTCTTAAGTGCTGAGCCATCTCTTTAGCTCC 250
SEQ ID NO: 2 aligned to SEQ ID NO: 1 of Forrest
Qy 1 GAACUGGAGUUAUACGGUAACCUCGUGGUGGUUGUGAACCACCAUGUGGAUGGAUAUUGA 60
||||:||||::|:||||:||||:||:||:||::|:|||||||||:|:|||:|||:|::||
Db 124 GAACTGGAGTTATACGGTAACCTCGTGGTGGTTGTGAACCACCATGTGGATGGATATTGA 183
Qy 61 GUUCCAAACACUGGUCC 77
|::||||||||:||:||
Db 184 GTTCCAAACACTGGTCC 200
Therefore, Claim 2 is obvious over Forrest and Nabhan.
Claims 1 and 8-10 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 10, 11 and 13 of U.S. Patent No. 11649456 B2, referred as Gustincich for clarity, issued May 31, 2016 in view of Nabhan, J., et. al., Scientific Reports, Vol. 6, p. 1-10, February 17, 2016.
Regarding Claim 1, Gustincich claims in claim 1 “A trans-acting functional nucleic acid molecule comprising: a target binding sequence comprising a sequence reverse complementary to a eukaryotic target mRNA sequence … and a regulatory sequence comprising an internal ribosome entry site (IRES) sequence”.
Gustinich does not teach the frataxin mRNA sequence.
Nabhan teaches the frataxin mRNA sequence (p. 2, para 3).
It would be obvious to one skilled in the art to substitute into the functional nucleic acid claimed by Gustincich the frataxin mRNA as the target sequence to produce a functional nucleic acid molecule comprising a target binding sequence reverse complementary to a frataxin mRNA and a regulatory sequence comprising an RNA compromising a IRES sequence. It would be predictable is Gustincich allows for the substitution for any target mRNA sequence. Therefore, Claim 1 is obvious over Gustinich and Nabhan.
Regarding Claim 8, Gustinich claims in claim 10, “A DNA molecule encoding the trans-acting functional nucleic acid molecule according to claim 1”. Therefore, Claim 8 is obvious over Gustinich and Nabhan.
Regarding Claim 9, Gustinich claims in claim 11, “An expression vector comprising the DNA molecule according to claim 10”. Therefore, Claim 9 is obvious over Gustinich and Nabhan.
Regarding Claim 10, Gustnich claims in claim 13, “A composition comprising (a) the trans-acting functional nucleic acid molecule according to claim 1 … or (c) an expression vector comprising a DNA molecule encoding the trans-acting functional nucleic acid molecule according claim 1”. Therefore, Claim 10 is obvious over Gustnich and Nabhan.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Krishna Nuggehalli Ravindra whose telephone number is (571)272-2758. The examiner can normally be reached M-Th, alternate F, 8a-5p est.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/K.N.R./Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636