DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of SEQ ID NO: 7 and AON2, comprising of SEQ ID NO: 15-18 in the reply filed on Sep. 1, 2025 is acknowledged.
Claims 1-10 and 15-19 are pending and under review.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 5 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
MPEP 2173.05(d) states "Description of examples or preferences is properly set forth in the specification rather than the claims. If stated in the claims, examples and preferences may lead to confusion over the intended scope of a claim. In those instances where it is not clear whether the claimed narrower range is a limitation, a rejection under 35 U.S.C. 112(b) or pre-AIA 35 U.S.C. 112, second paragraph should be made."
Regarding Claim 5, the phrase "preferably" renders the claim indefinite because it is unclear whether the limitation following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-3 and 17-19 are rejected under 35 U.S.C. 101 because they are directed to a product of nature, the natural gene sequence of ABCA4.
Step 1:
Claim 1 recites, “An antisense oligonucleotide”, which is a composition of matter.
Step 2A:
Regarding Prong One, Claim 1 recites, “An antisense oligonucleotide for redirecting splicing that binds to and/or is complementary to a polynucleotide with the nucleotide sequence as shown in SEQ ID NO: 4. SEQ ID NO: 4 is identified in the instant application as “ABCA4 complete exon 36, intron 35, and exon 37” (p. 17, Table 1), and therefore, the BRI of Claim 1 includes part of the natural DNA sequence of ABCA4 because DNA are double stranded and complementary. The instant specification describes the antisense oligonucleotide may be “a DNA residue” (p. 5, lines 4-5). SEQ ID NO: 4 has 100% alignment with the sequence NG_009073.2 from positions 106389 to 110409, which is part of the natural gene sequence of human ABCA4.
Markedly Different Characteristics Analysis
MPEP 2106.04(c) recites, “When the nature-based product is derived from a naturally occurring thing, then the naturally occurring thing is the counterpart.” Therefore, the appropriate counterpart is the natural DNA sequence of ABCA4.
The identified appropriate characteristic for analysis is “the ability of complementary nucleotide sequences to bind to each other”.
The antisense oligonucleotide lacks markedly different characteristics because “ isolated but otherwise unchanged genes were not eligible, because they were not different enough from what exists in nature to avoid improperly tying up the future use” (MPEP 2164.04(c).II.C.2).
A fragment of a natural sequence also lacks markedly different characteristics: “The court disagreed, concluding that the primers’ structural characteristics were not markedly different than the corresponding strands of DNA in nature, because the primers and their counterparts had the same genetic structure and nucleotide sequence ... The patentee also argued that the primers had a different function than when they are part of the DNA strand because when isolated as a primer, a primer can be used as a starting material for a DNA polymerization process. The court disagreed, because this ability to serve as a starting material is innate to DNA itself, and was not created or altered by the patentee” (MPEP 2164.04(c).II.C.2).
Therefore, Claim 1 is directed to a product of nature.
Regarding Prong 2, Claim 1 does not recite additional elements that integrate the judicial exception into a practical application because it is a product claim of an antisense oligonucleotide that binds to a sequence and does not recite a particular treatment or prophylaxis.
Step 2B:
Claim 1 does not recite additional elements that amount to significantly more than the judicial exception. The natural DNA sequence of ABCA4 is within the BRI of Claim 1 with no modifications or inventive concepts.
Conclusion:
Therefore, Claim 1 is rejected under 35 USC 101 for claiming a product of nature.
Dependent Claims:
Regarding Claim 2, Claim 2 includes the product of nature as a “DNA residue” and is also rejected under 35 USC 101.
Regarding Claim 3, Claim 3 limits the size of the oligonucleotide, but the natural sequence of ABCA4 falls within the BRI of the claim. Therefore, Claim 3 is rejected under 35 USC 101.
Regarding Claims 17, 18 and 19, SEQ ID NO: 8-10, SEQ ID NO: 7 and SEQ ID NO: 16-18 have 100% identity with NG_009073.2, an antisense oligonucleotide complementary to those sequence would encompass the natural DNA, and therefore, also claim products of nature. Therefore, Claims 17, 18, and 19 are rejected under 35 USC 101.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-3, 5-8, 15, and 16 rejected under 35 U.S.C. 102(a)(1) as being anticipated by Aznarez, I. and Nash, H., WO 2017/106370 A1, published June 22, 2017.
Regarding Claim 1, Aznarez teaches an antisense oligonucleotide for redirecting splicing that binds to a polynucleotide: “[A]n antisense oligomer (ASO) complementary to a targeted portion of the RIC pre-mRNA encoding the target protein or functional RNA, whereby the retained intron is constitutively spliced from the RIC pre-mRNA encoding the target protein or functional RNA,” (p. 1, [0004]). Aznarez also teaches their invention increases expression of ABCA4 (p. 2, [0004]) and may target a region comprising at least 8 contiguous nucleic acids of SEQ ID NO. 26656 (p. 4, [0009]). SEQ ID NO. 26656 has 100% identity to SEQ ID NO: 4 of the instant application, see attached alignment. Therefore, Aznarez teaches an antisense oligonucleotide for redirecting splicing that binds to a polynucleotide with the sequence SEQ ID NO: 4. Therefore, Claim 1 is anticipated by Aznarez.
Regarding Claim 2, Aznarez teaches, “The nucleobase of an ASO may be any naturally occurring, unmodified nucleobase such as adenine, guanine, cytosine, thymine and uracil, or any synthetic or modified nucleobase” (p. 89, [00260], which includes an RNA residue, a DNA residue, or a nucleotide analogue or equivalent. Therefore, Claim 2 is anticipated by Aznarez.
Regarding Claim 3, Aznarez teaches an embodiment the antisense oligonucleotide may be “8 to 50 nucleobases” (p. 95, [00275]), which includes 8 to about 40 nucleotides. Therefore, Claim 3 is anticipated by Aznarez.
Regarding Claim 5, Aznarez teaches, “ the ASO comprises a phosphorothioate linkage or each ribose sugar moiety comprises a 2'O-methyl modification” (p. 91, [00266]) including “2'-O-Me, 2'F, and 2'MOE” (p. 91, [00265]), which includes a 2’-O-methyl modified ribose and a halogenated derivative. Therefore, Claim 5 is anticipated by Aznarez.
Regarding Claim 6, Aznarez teaches, “the backbone of the ASO comprises a phosphorothioate linkage” (p. 91, [00266]). Therefore, Claim 6 is anticipated by Aznarez.
Regarding Claim 7, Aznarez teaches, “delivery of agents by administration of an adenovirus vector” (p. 98, [00283]) as well as Claim 1. Therefore, Claim 7 is anticipated by Aznarez.
Regarding Claim 8, Aznarez teaches “pharmaceutical compositions comprising any of the aforementioned antisense oligomers and an excipient” (p. 9, [0015]). Therefore, Claim 8 is anticipated by Aznarez.
Regarding Claim 15, Aznarez teaches “methods of treating an eye disease in a subject” in which the method of treatment “comprises contact the cells of the subject with an antisense oligomer” for redirecting splicing and the eye disease is Stargardt disease and the target protein is ABCA4 (p. 1, [0004]; (p. 2, [0005]). Therefore, Claim 15 is anticipated by Aznarez.
Regarding Claim 16, Aznarez teaches their method is for the ABCA4-related disease Stargardt disease. Therefore, Claim 16 is anticipated by Aznarez.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 4, 17, 18, and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Aznarez, I. and Nash, H., WO 2017/106370 A1, published June 22, 2017 as applied to Claim 1 above, and further in view of Braun, T. et. al., Human Molecular Genetics, Vol. 22, No. 25, p. 5136-5145, Aug. 4, 2013 and Albert, S. et. al., The American Journal of Human Genetics, Vol. 102, p. 517-527, April 5, 2018.
Regarding Claim 4, 17, 18 and 19, Aznarez teaches Claim 1 including SEQ ID NO: 4. SEQ ID NO: 15, 9, 10, 7, and 16-18 have 100% alignment with SEQ ID NO: 4.
Aznarez does not teach an antisense oligonucleotide comprising or consisting of SEQ ID NO: 15, 9, 10, 7, and 16-18.
Aznarez teaches “Methods of identifying additional ASOs that enhance splicing” for ABCA4 (p. 100, [00290]). The method includes doing a round of screening performed by an “ASO-walk” described in Example 3 (p. 105, [00300]).
Braun teaches splice variants in ABCA4 that lead to Stargardt disease including c.5196+1137G>A in exon 36 and the alternate exon formed (p. 5193, Table 1). The alternate exon or pseudo-exon 36.1 taught by Braun (p. 5138, Figure 2) is complementary to SEQ ID NO: 15, SEQ ID NO: 10, SEQ ID NO: 7, and SEQ ID NO: 15-18. Braun also teaches the c.5196+1216C>A intronic splice site mutation leading to a 177bp segment called IVS36 in ABCA4, which is the target location of SEQ ID NO: 9. (Instant Specification, p. 17, Table 1; Braun, p. 5139, Table 1 and p. 5141, Figure 3).
SEQ ID NO: 15
Qy 1 CUUUCAGGUUCUGACCUCC 19
|:::||||::|:||||:||
Db 7 CTTTCAGGTTCTGACCTCC 29
SEQ ID NO: 10
Qy 47 CGAGGAAACACUCAUAAAUGCACGGGGAGGAGGUCAGAACCUGAAAGCCUUUCUUUGGAU 106
|:|||||||||:||:|||:||||||||||||||:|||||||:|||||||:::|:::|||:
Db 1 CRAGGAAACACTCATAAATGCACGGGGAGGAGGTCAGAACCTGAAAGCCTTTCTTTGGAT 60
Qy 107 AAGAGCAUCAACUGCAGGUACC 128
|||||||:||||:|||||:|:|
Db 61 AAGAGCATCAACTGCAGGTAMC 82
SEQ ID NO: 7
Qy 1 GAAACACUCAUAAAUGCACGGGGAGGAGGUCAGAACCUGAAAGCCUUUCUUUGGAUAAGA 60
|||||||:||:|||:||||||||||||||:|||||||:|||||||:::|:::|||:||||
Db 5 GAAACACTCATAAATGCACGGGGAGGAGGTCAGAACCTGAAAGCCTTTCTTTGGATAAGA 64
Qy 61 GCAUCAACUGCAG 73
|||:||||:||||
Db 65 GCATCAACTGCAG 77
SEQ ID NO: 16
Qy 1 GGAGGUCAGAACCUGAAAG 19
|||||:|||||||:|||||
Db 29 GGAGGTCAGAACCTGAAAG 47
SEQ ID NO: 17
Qy 1 GGGGAGGAGGUCAGAACCUGAAAGCCUUU 29
||||||||||:|||||||:|||||||:::
Db 24 GGGGAGGAGGTCAGAACCTGAAAGCCTTT 52
SEQ ID NO: 18
Qy 1 UGCACGGGGAGGAGGUCAGAACCUGAAAGCCUUUCUUUG 39
:||||||||||||||:|||||||:|||||||:::|:::|
Db 19 TGCACGGGGAGGAGGTCAGAACCTGAAAGCCTTTCTTTG 57
Albert teaches designing and using oligonucleotides that target and rescue aberrant splicing of ABCA4 by targeting a pseudo-exon (p. 519, Antisense Oligonucleotide Design).
Regarding Claim 4, it would have been obvious to try for one skilled in the art before the effective filing date to use the sequence taught by Aznarez and the psuedoexon taught by Braun to design an oligonucleotide for redirecting splicing wherein the antisense oligonucleotide comprises of SEQ ID NO: 15 by using the methods of Aznarez and Albert. Aznarez and Braun teach a recognized problem that aberrant splicing causes Stargardt disease. Aznarez and Albert teach a predictable solution to aberrant splicing by designing an antisense oligonucleotide that binds the pseudoexon, and Albert provides evidence the method solves the aberrant splicing. Braun teaches the pseudoexon is 82 nucleotides long (p. 5138, Figure 2) to rescue aberrant splicing such that a limited number of solutions exists with a reasonable expectation of success. Therefore, Claim 4 is obvious over Aznarez in further view of Braun and Albert.
Regarding Claim 17 with respect to SEQ ID NO: 9, it would have been obvious to try for one skilled in the art before the effective filing date to use the sequence taught by Aznarez and the intronic splice mutation taught by Braun to design an oligonucleotide for redirecting splicing wherein the antisense oligonucleotide comprises of SEQ ID NO: 9 by using the methods of Aznarez and Albert. Aznarez and Braun teach a recognized problem that aberrant splicing causes Stargardt disease. Aznarez and Albert teach a predictable solution to aberrant splicing by designing an antisense oligonucleotide that binds the mutation site, and Albert provides evidence the method solves the aberrant splicing. Braun teaches the target location is 177 nucleotides long (p. 5141, Figure 3) to rescue aberrant splicing such that a limited number of solutions exists with a reasonable expectation of success. Therefore, Claim 17 is obvious over Aznarez in further view of Braun and Albert.
Regarding Claim 17 with respect to SEQ ID NO: 10, it would have been obvious to try for one skilled in the art before the effective filing date to use the sequence taught by Aznarez and the psuedoexon taught by Braun to design an oligonucleotide for redirecting splicing wherein the antisense oligonucleotide comprises of SEQ ID NO: 10 by using the methods of Aznarez and Albert as described in the rejection of Claim 4 above. Therefore, Claim 17 is obvious over Aznarez in further view of Braun and Albert.
Regarding Claim 18, it would have been obvious to try for one skilled in the art before the effective filing date to use the sequence taught by Aznarez and the psuedoexon taught by Braun to design an oligonucleotide for redirecting splicing wherein the antisense oligonucleotide comprises of SEQ ID NO: 7 by using the methods of Aznarez and Albert as described in the rejection of Claim 4 above. Therefore, Claim 18 is obvious over Aznarez in further view of Braun and Albert.
Regarding Claim 19, it would have been obvious to try for one skilled in the art before the effective filing date to use the sequence taught by Aznarez and the psuedoexon taught by Braun to design an oligonucleotide for redirecting splicing wherein the antisense oligonucleotide comprises of SEQ ID NO: 16-18 by using the methods of Aznarez and Albert as described in the rejection of Claim 4 above. Therefore, Claim 19 is obvious over Aznarez in further view of Braun and Albert.
Claims 17 is rejected under 35 U.S.C. 103 as being unpatentable over Aznarez, I. and Nash, H., WO 2017/106370 A1, published June 22, 2017 as applied to Claim 1 above, and further in view of Schulz, H., et. al., Investigative Ophthalmology & Visual Science, Vol. 58, No. 1, p. 394-403, Jan. 1, 2017 and Albert, S. et. al., The American Journal of Human Genetics, Vol. 102, p. 517-527, April 5, 2018.
Regarding Claim 17, Aznarez teaches Claim 1 including SEQ ID NO: 4. SEQ ID NO: 8 has 100% alignment with SEQ ID NO: 4.
Aznarez does not teach an antisense oligonucleotide comprising or consisting of SEQ ID NO: 8.
Aznarez teaches “Methods of identifying additional ASOs that enhance splicing” for ABCA4 (p. 100, [00290]). The method includes doing a round of screening performed by an “ASO-walk” described in Example 3 (p. 105, [00300]).
Schulz teaches the mutation c.5196+1013A>G in ABCA4 which leads to aberrant splicing (p. 398, col. 2). The instant specification identifies SEQ ID NO: 8 as the target region c.5196+1013A>G (p. 17, Table 1).
Albert teaches designing and using oligonucleotides that target and rescue aberrant splicing of ABCA4 by targeting the region near or at the site of mutation (p. 519, Antisense Oligonucleotide Design).
Regarding Claim 17 with respect to SEQ ID NO: 8, it would have been obvious for one skilled in the art before the effective filing date of the claimed invention to try to use the sequence taught by Aznarez and the mutation taught by Schulz to design an oligonucleotide for redirecting splicing wherein the antisense oligonucleotide comprises of SEQ ID NO: 8 by using the methods of Aznarez and Albert. Aznarez and Schulz teach a recognized problem that aberrant splicing causes Stargardt disease. Aznarez and Albert teach a predictable solution to aberrant splicing by designing an antisense oligonucleotide that binds the mutation site, and Albert provides evidence the method solves the aberrant splicing. Schulz teaches the target location of the mutation such that a limited number of solutions exists with a reasonable expectation of success for designing an oligonucleotide complementary to the mutation. Therefore, Claim 17 is obvious over Aznarez in further view of Schulz and Albert.
Claims 9 and 10 are rejected under 35 U.S.C. 103 as being unpatentable over Aznarez, I. and Nash, H., WO 2017/106370 A1, published June 22, 2017 as applied to Claim 8 above, and further in view of Danis R., et. al., Current Eye Research, Vol. 26, No. 1, p. 45-54, Jan. 11, 2003.
Regarding Claims 9 and 10, Aznarez teaches Claim 8. Aznarez also teaches intravitreal administration of the pharmaceutical composition comprising of the antisense oligonucleotide of Claim 1 (p. 9, [0016]).
Aznarez does not teach the dosage of 0.05 mg to 5 mg of total antisense oligonucleotide or 0.1 to 1 mg of antisense oligonucleotide per eye.
Danis teaches the administration of antisense oligonucleotides to pigs receiving 34 or 180 μg per eye (p. 46, col. 2). The total dose is 0.078 or 0.360 mg of antisense oligonucleotide for two eyes. Danis teaches their method had activity in vivo and “significantly inhibited the neovascular response compared to control injections” (p. 49, col. 1).
Regarding Claim 9, it would be obvious to one skilled in the art before the effective filing date to combine the teachings of Aznarez to create the pharmaceutical composition of Claim 8 dosed for intravitreal administration with the teachings of Danis to use 0.078 mg or 0.360 mg of total antisense oligonucleotide, which is between 0.05 and 5 mg of total antisense oligonucleotide. One would be motivated to do so because Danis shows those dosages have activity in vivo and have predictable results. Therefore, Claim 9 is obvious over Aznarez and Danis.
Regarding Claim 10, it would be obvious to one skilled in the art before the effective filing date to combine the teachings of Aznarez to create the pharmaceutical composition of Claim 8 dosed for intravitreal administration with the teachings of Danis to use 0.180 mg of antisense oligonucleotide per eye, which is between 0.1 and 1 mg of total antisense oligonucleotide. One would be motivated to do so because Danis shows those dosages have activity in vivo and have predictable results. Therefore, Claim 10 is obvious over Aznarez and Danis.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Krishna Nuggehalli Ravindra whose telephone number is (571)272-2758. The examiner can normally be reached M-Th, alternate F, 8a-5p est.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/K.N.R./Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636