DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 2/17/26 has been entered.
Claims 89-109 and 111 are pending.
Claims 89, 94-96, and 111 have been amended by Applicant.
Claims 96 and 111 are withdrawn from further consideration by the examiner under 37 CFR 1.142(b) as being drawn to a non-elected invention.
Claims 89-95 and 97-109 are currently under examination.
Elected species is SEQ ID NO: 291 and previously rejoined species is SEQ ID NO: 150. SEQ ID NO: 296 is now rejoined. No other species have been rejoined.
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claim Interpretation
Claim 89 is drawn to a composition comprising a labeled polynucleotide, wherein said labeled polynucleotide detects a mutated calreticulin allele comprising a recited sequence and does not detect a wild-type calreticulin allele in a calreticulin exon 9 nucleic acid sequence (SEQ ID NO:435) under allele-specific conditions.
Elected mutated calreticulin allele sequences include elected SEQ ID NO: 291 and previously rejoined SEQ ID NO:150, which are both full-length calreticulin cDNA allele sequences (each comprising a mutated exon 9 region).
Previously rejoined SEQ ID NO:150 is cDNA of a full-length mutated calreticulin allele comprising newly rejoined SEQ ID NO: 296.
SEQ ID NO:435 is not a full-length calreticulin sequence; rather, SEQ ID NO:435 is a wild-type calreticulin exon 9 nucleic acid sequence.
The examiner interprets any labeled polynucleotide that would hybridize anywhere on mutated calreticulin sequence comprising a recited SEQ ID NO or complement thereof, due to having a sequence 100% complementary to the mutated sequence (or complement thereof), and that would not hybridize to a wild-type calreticulin allele in a calreticulin exon 9 sequence due reduction in sequence complementary to wild-type calreticulin allele in a calreticulin exon 9 sequence as a polynucleotide that “detects” a mutated calreticulin allele comprising a recited sequence and does not detect a wild-type calreticulin allele in a calreticulin exon 9 nucleic acid sequence (SEQ ID NO:435) under allele-specific conditions because (i) the labeled polynucleotide would adhere to the mutated calreticulin allele (or complement thereof) due to the presence of a 100% complementary sequence, (ii) the labeled polynucleotide would not detect/adhere to a wild-type calreticulin allele in a calreticulin exon 9 sequence (SEQ ID NO:435) due to a reduction in sequence complementary to a wild-type calreticulin allele in a calreticulin exon 9 sequence, and (iii) the labeled polynucleotide would not adhere to other alleles lacking sequence complementary to the labeled polynucleotide sequence.
Comparison of instant SEQ ID NO:296 and instant SEQ ID NO:150:
PNG
media_image1.png
343
594
media_image1.png
Greyscale
Rejection Withdrawn
All previous rejections are withdrawn.
New Rejections
Claim Rejections - 35 USC § 102
Claim(s) 89-94 and 97-109 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Bennett et al (WO 02/068688 A1; 9/6/02).
Bennett et al teaches a composition comprising a labeled polynucleotide probe (FAM-CCAGACGCTGGTGGTGCAGTTCAC-TAMRA; SEQ ID NO: 6) for Northern blotting to detect calreticulin polynucleotides amplified using the forward primer SEQ ID NO:4 and the reverse primer SEQ ID NO:5 (lines 7-13 on page 80, in particular). On a Northern blot, the probe would detect calreticulin mRNA, cDNA, and genomic DNA generated from frameshift-mutated calreticulin alleles comprising recited sequences including instant SEQ ID NO:296 under allele-specific conditions in any sample due to 100% homology between the probe of Bennett et al and a 24-nucleotide segment of instant SEQ ID NO:150 (cDNA of a full-length mutated calreticulin allele comprising newly rejoined and recited SEQ ID NO: 296). At the last paragraph on page 54, the instant specification defines SEQ ID NO:435 as “The wild-type nucleic acid sequence of exon 9 of the calreticulin gene.” On a Northern blot, the probe would not detect mRNA, cDNA, or genomic DNA generated from the wild-type calreticulin allele in a calreticulin exon 9 nucleic acid sequence (SEQ ID NO:435) under allele-specific conditions in any sample due to the low homology between instant SEQ ID NO:435 and SEQ ID NO:6 (or complements thereof). Further, (i) the labeled polynucleotide would adhere to the mutated calreticulin allele (or complement thereof) due to the presence of a 100% complementary sequence, (ii) the labeled polynucleotide would not detect/adhere to a wild-type calreticulin allele in a calreticulin exon 9 sequence (SEQ ID NO:435) due to a reduction in sequence complementary to a wild-type calreticulin allele in a calreticulin exon 9 sequence, and (iii) the labeled polynucleotide would not adhere to other alleles lacking sequence complementary to the labeled polynucleotide sequence.
Comparison of instant SEQ ID NO:150 (mutated calreticulin cDNA comprising SEQ ID NO:296) and Northern probe (labeled SEQ ID NO:6) of Bennett:
Query Match 1.9%; Score 24; DB 1; Length 24;
Best Local Similarity 100.0%;
Matches 24; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 264 CCAGACGCTGGTGGTGCAGTTCAC 287
Db 1 CCAGACGCTGGTGGTGCAGTTCAC 24
Comparisons of instant SEQ ID NO:435 and Northern probe (labeled SEQ ID NO:6) of Bennett et al (result 1 is best alignment of sequences; result 2 is best alignment of complementary sequences):
RESULT 1
NASEQ2_06242025_102521
Query Match 1.3%; Score 10.2; DB 1; Length 24;
Best Local Similarity 80.0%;
Matches 12; Conservative 0; Mismatches 3; Indels 0; Gaps 0;
Qy 589 CAGAAGGGGGTGGTG 603
Db 2 CAGACGCTGGTGGTG 16
RESULT 2
NASEQ2_06242025_102521/c
Query Match 1.0%; Score 8; DB 1; Length 24;
Best Local Similarity 58.3%;
Matches 14; Conservative 0; Mismatches 10; Indels 0; Gaps 0;
Qy 578 GAGGAGGGCAGCAGAAGGGGGTGG 601
Db 24 GTGAACTGCACCACCAGCGTCTGG 1
Claim Objections
Claim 95 is objected to for being dependent upon a rejected claim.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SEAN E AEDER whose telephone number is (571)272-8787. The examiner can normally be reached M-F 9am-6pm ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Samira Jean-Louis can be reached at (571)270-3503. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SEAN E AEDER/Primary Examiner, Art Unit 1642