ALLOWABILITY NOTICE
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
After further consideration, the finality of the last Office action was found to be inappropriate and, therefore, the finality of that action is withdrawn. Prosecution is reopened on the merits.
Receipt is acknowledged of amendment, filed 05/11/2026, wherein claims 2-5, 7, 8 and 10-13 are cancelled and claims 1, 6 and 9 were previously presented. Claims 1, 6 and 9 are currently pending.
It is noted that the amendment to the claims filed on 05/11/2026 does not comply with the requirements of 37 CFR 1.121(c) because claims 1 and 9 have previously entered amendments underlined as new amendments from the previously filed claim set. However, in the interest of compact prosecution, the amendment to the claims has been entered.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 6 and 9 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. This is a NEW rejection.
Enablement is considered in view of the Wands factors (MPEP 2164.01(A)). These include: the breadth of the claims, the nature of the invention, the state of the prior art, the level of one of ordinary skill, the level of predictability in the art, the amount of direction provided by the inventor, the existence of working examples, and the quantity of experimentation needed to make or use the invention. All of the Wands factors have been considered with regard to the instant claims, with the most relevant factors discussed below.
Nature of the invention: The claims are drawn to a method for visualized screening of gene edited Aspergillus strain comprising a Cas9 expression plasmid comprising a Cas9 gene, a single guide RNA expression cassette comprising either a Pu3 or Pu6 promoter, a corresponding Tu3 or Tu6 terminator and a screening marker. The method comprises transferring the Cas9 expression plasmid and the sgRNA expression cassette into the Aspergillus strain for co-expression and releasing sgRNA by interaction with endogenous tRNAs, thereby simultaneously knocking out genes (a) and (b) in the Aspergillus strain. The nature of the invention is complex in that the sequence identified within claim 1 for the sequence of the Cas9 gene is SEQ ID NO: 4, however, SEQ ID NO: 4 does not encode a Cas9 protein but instead is a Tu3 terminator. As well as the method recites “releasing sgRNA by interaction with endogenous tRNAs”, however there is no prior mention within the claim of the location of the tRNAs.
Breadth of the claims: The claims specifically require the sequence of SEQ ID NO: 4 as the sequence encoding the cas9 protein used within the method, however, SEQ ID NO: 4 does not encode a Cas9 protein but instead, is a Tu3 terminator [0019]. The claims recite “releasing sgRNA by interaction with endogenous tRNAs”, however there is no prior mention within the claim of the location of the tRNAs. The complex nature of the subject matter of this invention is greatly exacerbated by these specific limitations of the claims.
Guidance of the specification and existence of working examples: The specification does not include a full definition or example of how the Cas9 gene as well as the endogenous tRNAs are capable of their functions without specific structure/description of the respective plasmid constructs. The specification provides that the codon-optimized Cas9 gene sequence of Aspergillus niger is as set forth in SEQ ID NO:4 [0016]. However, the specification also provides that the Tu3 terminator has a nucleotide sequence as set forth in SEQ ID NO:4 [0019]. After further investigation, the specification suggests that a nuclear localization signal (NLS) sequence (CCCAAGAAGAAGCGCAAGGTC, SEQ ID NO:56) was added at a or a C-terminal of a gene encoding a Cas9 protein (as set forth in SEQ ID NO:1) [0056 and 0071]. However, the specification does not provide specifically the exact sequence of the Cas9 protein for the Cas9 plasmid for delivery to the Aspergillus strain. In addition, the specification provides that when multiple genes are edited, a first tRNA after a promoter is tRNAAla, a tRNA in a last sgRNA is tRNAArg or tRNAI1e; or a first tRNA after a promoter is tRNAA1a, a tRNA in a last sgRNA is tRNAArg or tRNAI1e and a Pu6 promoter and a Tu6 terminator are used to separately promote and terminate an expression of the last sgRNA [0032]. However, the specification does not provide where the sequences of the tRNAs are encoded and provided other than being endogenous to the Aspergillus strain. No specific guidance for using the method with the current claim limitations is provided and no working examples remedy the deficiencies of the embodiment or current claims.
Predictability and state of the art: For some relevant background of the Cas9 protein sequence, Wu et al (Quant Biol. 2014 Jun; 2(2): 1-19) teaches that Cas9 genome editing is highly specific to not only the cell type but the organism as well to limit off-target effects (Page 12, Paragraphs 2-5). Wu teaches specifically that Cas9 cutting becomes less specific at higher effective concentrations of Cas9/sgRNA complexes as well as in vivo the specificity (ratio of indel frequency at target vs off-target) increases when decreasing amounts of Cas9 and sgRNA plasmids are transfected into cells (Page 7, Paragraph 2).
Genbank Accession Number XM_745936.2 (NCBI GenBank; 2025, Pgs. 1/1-1/1) shows the instant sequence of SEQ ID NO: 4 is found as the Aspergillus fumigatus Af293 putative nonsense-mediated mRNA decay protein Upf3 (Page 1).
Genbank Accession Number ON911627.1 (NCBI GenBank; 2022, Pgs. 1/3-3/3) shows the instant sequence of SEQ IDNO: 1 is found to be the synthetic construct Cas9 codon-optimized gene for Aspergillus niger (Pages 2 and 3).
Wang et al (Computational and Structural Biotechnology Journal 17 (2019) 761–769) teaches that codon optimization of the Streptococcus pyogenes cas9 gene is a crucial step for achieving high-efficiency genome editing in Aspergillus species (Page 767, Column 1). Wang teaches that adapting the bacterial gene's sequence to match the highly biased codon usage preferences of filamentous fungi, significantly enhancing editing efficiency and improve plasmid stability (Page 764, Column 1 bridging Column 2).
For some relevant background of the tRNAs release of sgRNAs, Zhang et al (Nat Commun 10, 1053 (2019) Pages 1-10) teaches a gRNA-tRNA array cassette wherein the strategy includes each gRNA is flanked with cleavable RNA sequences, such as self-cleavable ribozyme sequences (e.g. Hammerhead ribozyme and HDV ribozyme), exogenous cleavage factor recognition sequences (e.g. Cys4), and endogenous RNA processing sequences (e.g. tRNA sequences and introns) for the release of multiple gRNAs for expression (Page 2, Column 1 and Page 3, Fig. 1). Zhang teaches the gRNA-tRNA array for CRISPR-Cas9 (GTR-CRISPR) that allows simultaneous disruptions of 8 genes in S. cerevisiae with 87% efficiency (Page 2, Column 2). Therefore, showing that the tRNAs must be within (or in conjunction with) the sgRNAs in order for processing to be possible.
Amount of experimentation necessary: In order to practice the claimed invention, an immense amount of experimentation would be required. As disclosed above, the specification itself provides only that a Cas9 gene is used within the system and that the tRNAs used are endogenous to the Aspergillus strain. The specification does not provide the full sequence of the Cas9 protein or clarity that SEQ ID NO: 1 is the full sequence of the Cas9 gene used in the system or how the endogenous tRNAs are capable of the releasing of sgRNA from the guide RNA cassette. Therefore, experiment could be conducted, but in view of the specification there does not appear to be any amount of experiment that would be sufficient to reliably produce the exact structures of the invention. Such experimentation would not be possible due to not having the exact Cas9 gene sequence for the claimed invention. Therefore, it would require immense amount of unpredictable experimentation to practice the claimed invention with such variants in the possible result.
In view of the breadth of the claims and the lack of guidance provided by the specification as well as the unpredictability of the art, the skilled artisan would have required an undue amount of experimentation to make and/or use the claimed invention. Therefore, claims 1, 6 and 9 are not considered to be fully enabled by the instant disclosure.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 6 and 9 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 1 recites the broad recitation of a method resulting in the “knocking out genes (a) and (b) in the Aspergillus strain”, and the claim also recites “when a single gene is edited” which is the narrower statement of the range/limitation. The phrase is unclear in that the claim requires two genes to be edited for the system therefore, there is not a condition where only a single gene would be edited. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims.
Response to Amendments - Claim Rejections - 35 USC § 112
The previous rejection of claim 13 under 35 U.S.C. 112(d), 4th paragraph, has been withdrawn in view of Applicant’s amendments filed on 05/11/2026.
Claim Rejections - 35 USC § 103
The previous rejection of claims 10, 11 and 13 under 35 U.S.C. 103 has been withdrawn in view of Applicant’s amendments filed on 05/11/2026.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA ROSE LIPPOLIS whose telephone number is (703)756-5450. The examiner can normally be reached Monday-Friday, 8:00am to 5:00pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ALEXANDRA ROSE LIPPOLIS/Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637