DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
Applicant’s remarks and amendments to the claims filed November 12, 2025 are acknowledged. Claims 2-3 were amended, and claim 1 was cancelled. Claims 2-27, and 31-37 are pending and under examination herein.
Applicant’s remarks and amendments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow. Any rejection or objection not reiterated herein has been overcome by amendment.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994).
The disclosure of the prior-filed provisional applications, Application Nos. 61/890,108, 61/891,313, 61/919,540, and 61/927,903, fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application. The prior-filed provisional applications do not disclose SEQ ID NOs: 1057-1318, 1366-1488, and 1492-1545 recited in instant claim 2. The first disclosure of the SEQ ID NOs is in Application No. 61/980,502, filed April 16, 2014. Accordingly, claim 2 has an effective filing date of April 16, 2014. Claims 3-27, and 31-37 have an effective filing date of October 11, 2013 (i.e., the filing date of Application No. 61/890,108).
Claim Rejections - 35 USC § 102 – Ciura
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 3-5, 7, 12-13, 31, 33, and 36 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Ciura (Ciura et al., 7 August 2013, Ann Neurol, 74:180-187 and Supplementary Material and Methods; of record) as evidenced by Gene Tools (Gene Tools, LLC, “Morpholino Antisense Oligos,” pg. 1-2, available 7 January 2012 according to Wayback Machine; of record). The following rejections are maintained and modified as necessitated by Applicant’s amendments to the claims.
Regarding claim 3, Ciura teaches a compound, comprising a modified oligonucleotide (“GAAGATACCCAAGCAAAGACCTTCT,” “spAMO”) consisting of 12 to 50 linked nucleosides (“CTGCATGC[AGAAGgtctttgcttgggtatcttc]cactc located in the second exons of two isoforms… of the zC9orf72”)(“Antisense Morpholino O[l]igonucleotides,” Supplementary Material and Methods). As shown in Fig. A below, the modified oligonucleotide has a nucleobase sequence comprising at least 8 consecutive nucleobases complementary to an equal length portion of nucleobases 1107-1520 of instant SEQ ID NO: 2 (underlined). Ciura teaches the modified oligonucleotide is a morpholino oligonucleotide purchased from Gene Tools (Supplementary Material and Methods). Gene Tools teaches that each nucleotide of a morpholino oligonucleotide comprises a modified sugar (“morpholine rings replacing the ribose or deoxyribose sugar moieties”), which are linked to adjacent nucleotides with a modified internucleoside linkage (“non-ionic phosphorodiamidate linkages replacing the anionic phosphates of DNA and RNA”)(pg. 1/2). Thus, as evidenced by Gene Tools, the morpholino oligonucleotide of Ciura meets the limitations of instant claim 3.
FIGURE A
ATTGTGGAGGACAGGCTGAAGACAT “C9AMOb”
TCAAGGTCTCGAACGATGTCCGACGCCAAC nts 1424-1417 of SEQ ID NO: 2 (reverse)
Regarding claim 4, Ciura’s modified oligonucleotide (“C9AMOb”) is a single-stranded modified oligonucleotide.
Regarding claims 5 and 7, as evidenced by Gene Tools, each internucleoside linkage of Ciura’s morpholino oligonucleotides are modified internucleoside linkages (“non-ionic phosphorodiamidate linkages”)(pg. 1/4).
Regarding claims 12-13, as evidenced by Gene Tools, each nucleoside of Ciura’s morpholino oligonucleotides comprises a modified sugar (“morpholine rings replacing the ribose or deoxyribose sugar moieties”)(pg. 1/4).
Regarding claim 31, as shown in Fig. B above, Ciura’s modified oligonucleotide has a nucleobase sequence complementary to a region of C9ORF72 other than a hexanucleotide repeat expansion comprising one of the recited sequences.
Regarding claim 33, Ciura’s compound consists of the modified oligonucleotide.
Regarding claim 36, Ciura teaches a composition comprising the modified oligonucleotide and at least one pharmaceutically acceptable carrier or diluent (“Microinjection into fertilized eggs of these AMOs… microinjection was performed at 0.25mM… and 0.9 mM,” Supplementary Material and Methods).
Claim Rejections - 35 USC § 102 - Bennett
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim 2-8, 10-12, 19, 22-23, 27, 31-33, and 36-37 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Bennett (Bennett et al., U.S. Patent No. 9,963,699 B2, effectively filed 15 October 2012; of record) as evidenced by Rothstein (Rothstein et al., U.S. Patent No. 10,577,604 B2, effectively filed 15 October 2012; of record). The following rejections are maintained and modified as necessitated by Applicant’s amendments to the claims.
The applied reference has a common Applicant and Inventor with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement.
Regarding instant claim 2, Bennett teaches compounds, “ISIS 577083” and “ISIS 577061,” which are fully phosphorothioated 5-10-5 gapmers, with a 10-nt 2’-deoxynucleoside gap flanked on either side by 5-nt 2’-O-methoxyethyl wings (col. 37, lines 15-40; Tables 6, 8). All cytosine residues throughout the gapmer are 5-methylcytosines (col. 37, lines 24-25). As evidenced by Rothstein (Table 7, col. 47), the nucleobase sequence of ISIS 577083 consists of “GGTAACTTCAAACTCTTGGG” which is 100% identical to instant SEQ ID NO: 382 recited in instant claim 2 as shown in Fig. A below. The nucleobase sequence of ISIS 577061 consists of “TACAGGCTGCGGTTGTTTCC” which is 100% identical to instant SEQ ID NO: 97 recited in instant claim 2 as shown in Fig. B below.
FIGURE B
GGTAACTTCAAACTCTTGGG ISIS 577083
GGTAACTTCAAACTCTTGGG SEQ ID NO: 382
TACAGGCTGCGGTTGTTTCC ISIS 577061
TACAGGCTGCGGTTGTTTCC SEQ ID NO: 97
Regarding instant claims 3-8, 10-12, 19, 22-23, 27, 31, and 33, as described above, ISIS 577061 is a fully phosphorothioated 5-10-5 gapmer, with a 10-nt 2’-deoxynucleoside gap flanked on either side by 5-nt 2’-O-methoxyethyl wings (col. 37, lines 15-40; Table 8). All cytosine residues throughout the gapmer are 5-methylcytosines (col. 37, lines 24-25). As evidenced by Rothstein (Table 7, col. 47), the nucleobase sequence of ISIS 577061 consists of “TACAGGCTGCGGTTGTTTCC” which comprises at least 8 consecutive nucleobases complementary to an equal length portion of nucleobases 1398-1424 of instant SEQ ID NO: 2 as shown below in Fig. C. The target sequence of ISIS 577061 also does not comprise a hexanucleotide repeat sequence recited in instant claim 31.
FIGURE C
CCTTTGTTGGCGTCGGACAT ISIS 577061 (reverse)
GGAAACAACCGCAGCCTGTA SEQ ID NO: 2 (nts 1406-1425)
Regarding instant claim 32, Bennett teaches conjugated antisense compounds comprising a modified oligonucleotide (col. 29, lines 45-67).
Regarding instant claim 36, Bennett teaches a composition comprising a modified oligonucleotide and at least one pharmaceutically acceptable carrier or diluent (col. 29, lines 14-27).
Regarding instant claim 37, Bennett teaches salts of a modified oligonucleotide (col. 29, lines 28-39).
Claim Rejections - 35 USC § 102 - Rothstein
Claims 2-8, 10-12, 19, 22-23, 27, 31-33, and 36-37 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Rothstein (Rothstein et al., U.S. Patent No. 10,577,604 B2, effectively filed 15 October 2012; of record). The following rejections are maintained and modified as necessitated by Applicant’s amendments to the claims.
The applied reference has a common Applicant and Inventor with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement.
Regarding claim 2, Rothstein teaches compounds, “ISIS 577083” and “ISIS 577061,” which are fully phosphorothioated 5-10-5 gapmers, with a 10-nt 2’-deoxynucleoside gap flanked on either side by 5-nt 2’-O-methoxyethyl wings (Table 7; col. 47, lines 9-21; Table 20, col. 69-70). All cytosine residues throughout the gapmer are 5-methylcytosines (col. 47, lines 20-21). As shown in Fig. B above, ISIS 577083 and ISIS 577061 are 100% identical to instant SEQ ID NOs: 382 and 97, respectively, recited in claim 2.
Regarding claims 3-8, 10-12, 19, 22-23, 27, 31, and 33, as described above, ISIS 577061 is a fully phosphorothioated 5-10-5 gapmer, with a 10-nt 2’-deoxynucleoside gap flanked on either side by 5-nt 2’-O-methoxyethyl wings (Table 7; col. 47, lines 9-21; Table 20, col. 69-70). All cytosine residues throughout the gapmer are 5-methylcytosines (col. 47, lines 20-21). Rothstein teaches the nucleobase sequence of ISIS 577061 consists of “TACAGGCTGCGGTTGTTTCC” (Table 7, col. 47), which comprises at least 8 consecutive nucleobases complementary to an equal length portion of nucleobases 1398-1424 of instant SEQ ID NO: 2 as shown above in Fig. C. The target sequence of ISIS 577061 also does not comprise a hexanucleotide repeat sequence recited in instant claim 31.
Regarding instant claim 32, Rothstein teaches a conjugated antisense compound comprising a modified oligonucleotide (col. 39, lines 33-55).
Regarding instant claim 36, Rothstein teaches a composition comprising a modified oligonucleotide and at least one pharmaceutically acceptable carrier or diluent (col. 39, lines 3-16).
Regarding instant claim 37, Rothstein teaches salts of a modified oligonucleotide (col. 39, lines 17-27).
Response to Remarks - 35 USC § 102
Applicant’s remarks regarding the § 102 rejections over Ciura, Rothstein, and Bennett as evidenced by Rothstein have been reviewed. Applicant argues that the amendments to the claims are sufficient to overcome the § 102 rejections raised in the prior action. Applicant argues that Examiner has not provided any evidence that the cited prior art meets the limitations of amended claims 2 and/or 3. Applicant’s amendments are not sufficient to distinguish the disclosure of Ciura from the instant claims for the reasons described above, i.e., the claims still encompass nucleobases in SEQ ID NO: 2 to which Ciura’s oligonucleotide is complementary as shown in Fig. A. Examiner acknowledges that the amendments to the claims remove the segment and SEQ ID NO to which the § 102 rejections over Rothstein, and Bennett as evidenced by Rothstein, were previously directed. However, the disclosures of Rothstein, and Bennett as evidenced by Rothstein still teach compounds which anticipate the amended claims as described in the preceding paragraphs. The rejections are maintained and modified, accordingly.
Notice to Joint Inventors
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim Rejections - 35 USC § 103 – Gendron in view of GenBank and Bhanot
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 2-12, 14-20, 22-24, 27, and 31-37 are rejected under 35 U.S.C. 103 as being unpatentable over Gendron (Gendron et al., 12 July 2013, Expert Opinion on Therapeutic Targets, 17(9):991-995; of record) in view of GenBank (Homo sapiens chromosome 9 open reading frame 72 (C9orf72), RefSeqGene on chromosome 9, NCBI Reference Sequence: NG_031977.1, available 28 March 2013; of record) and Bhanot (Bhanot and Shulman, WO 2011/156673 A2, published 15 December 2011; of record). The following rejections are maintained and modified as necessitated by Applicant’s amendments to the claims.
Gendron teaches that amyotrophic lateral sclerosis (ALS) can be caused by an expansion of the GGGGCC repeat in the C9ORF72 gene (pg. 991). Gendron teaches that strategies which target transcripts harboring the expansion “and result in their neutralization or degradation could effectively block an early culprit” in the putative mechanism of the disease (pg. 992, right col.; Fig. 1). Gendron teaches that “[a]ntisense oligonucleotides (ASOs)” and “small interfering RNAs (siRNAs)” may be used to target pathogenic RNAs (pg. 992, right col.). Gendron teaches the basic mechanisms of ASO and siRNA action, and provides evidence that both ASOs and siRNAs have shown success as therapeutic strategies in other repeat expansion diseases (pg. 992, right col. to pg. 993). Gendron teaches that these “studies provide compelling evidence that targeting pathogenic RNA is a promising therapeutic strategy for the treatment of disease in which RNA toxicity plays a role” (pg. 993, right col.). Gendron states that investigations targeting repeat-expanded C9ORF72 transcripts are “no doubt… underway since the discovery that mutant C9ORF72 causes c9FTD/ALS” (pg. 992, right col.). “Based on advances made in the development of therapeutic strategies for other repeat expansion disease marked by RNA toxicity,” Gendron concludes that “initial progress is expected to be relatively rapid” (pg. 992, right col.).
Gendron also provides guidance for therapeutic strategies targeting repeat-expanded C9ORF72 transcripts, including that “the secondary structure… must be taken into account… [which] may negatively influence the ability of ASOs to bind the transcript” (pg. 994, left col.), and the “effects of RNA-targeting therapies on the wild-type allele should… be carefully monitored” (pg. 994, right col.). Gendron teaches that “ASOs and siRNAs are expected to preferentially cause the degradation of RNA from the expanded allele” (pg. 994, left col.); however, Gendron teaches that the mechanistic role of expanded C9ORF72 transcripts in disease remains underexplored (pg. 994). Accordingly, Gendron teaches that “the development of.. ASOs and the like that target GGGGCCexp RNA may not only lead to the development of potential therapies, but would also serve as valuable tools to decipher the many questions still unanswered” (pg. 994, right col.).
Gendron does not teach specific design principles for modified oligonucleotides targeting a nucleic acid encoding C9ORF72, or a nucleic acid sequence encoding C9ORF72.
However, Bhanot teaches design principles for modified oligonucleotides that promote inhibition of a target nucleic acid encoding a different target molecule (“PEPCK-M”)(pg. 3, line 21 to pg. 4, line 3). Bhanot’s disclosure provides “antisense compounds useful for modulating gene expression and associated pathways via antisense mechanisms of action such as RNase H, RNAi, and dsRNA enzymes, as well as other antisense mechanisms based on target degradation or target occupancy,” which are the same antisense mechanisms described by Gendron (pg. 4, lines 5-8). Bhanot teaches that while previous inhibitors of the target molecule have been disclosed, “none of the… disclosures describe a specific mechanism of antisense inhibition” for the molecule in treatment of a disease associated with the molecule (pg. 3, line 25-27). Bhanot teaches that “[a]ntisense technology is emerging as an effective means for reducing the expression of certain gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation” of the transcript (pg. 3, lines 27-29). Bhanot designed many modified oligonucleotides using the principles described throughout the disclosure (see for example Tables 2-7). Bhanot demonstrates that modified oligonucleotides designed to many different locations in a target nucleic acid achieve target nucleic acid inhibition (see “% inhibition” in each of Tables 2-7). Bhanot demonstrates that modified oligonucleotides also function in vivo, including in the relief of symptoms of a disease associated with the target molecule ((Example 4, pg. 62-64).
With respect to the specific design principles recited in instant claims 2-3, Bhanot teaches modified oligonucleotides consisting of 12 to 30 linked nucleosides (“12 to 30,” pg. 25, lines 1-4). Bhanot teaches nucleobase sequences 100% complementary to an equal length portion of the target nucleic acid (“the antisense compound has a nucleobase sequence at least 100% complementary… as measured over the entirety of said antisense compound,” pg. 66, claims 8). Bhanot also teaches modified oligonucleotides comprising a nucleobase sequence with at least 8, or at least 12, nucleobases complementary to an equal length portion of the target nucleic acid (“The modified oligonucleotide… can have a nucleobase sequence comprising at least 8 contiguous nucleobases complementary to an equal length portion… at least 12… contiguous nucleobases,” pg. 4, lines 16-22).
While Bhanot discloses that the modified oligonucleotides were designed to target nucleic acid sequences disclosed by “GenBank,” which encode the target molecule (pg. 22, line 34-35; Table 1), Bhanot does not teach any nucleic acid encoding C9ORF72.
However, GenBank teaches the nucleic acid sequence encoding human C9ORF72. As shown in the alignments of record, instant SEQ ID NO: 2 recited in claim 3 is 100% identical to the known C9ORF72 sequence taught by GenBank. The SEQ ID NOs recited in instant claim 2 are 100% complementary to regions of instant SEQ ID NO: 2, which is taught by GenBank.
Regarding claims 2 and 3, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have designed compounds comprising modified oligonucleotides targeting a nucleic acid encoding human C9ORF72, using design principles taught by Bhanot, so as to arrive at the compounds recited in claims 2-3. It would have amounted to applying known design principles for preparing antisense compounds, to a known target nucleic acid sequence, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in preparing the modified oligonucleotides because as evidenced by Bhanot I) it was well-within the purview of the skilled artisan, and routine in the art, to design and test oligonucleotides 12 to 30 linked nucleosides in length which are 100% complementary to a known target nucleic acid, and identify modified oligonucleotides that effectively inhibit the target nucleic acid, and II) applying known design principles to a known target nucleic acid yields functional modified oligonucleotides in vitro and in vivo, including modified oligonucleotides which relieve symptoms of disease associated with the encoded molecule. These oligonucleotides can be identified even when no such antisense mechanism has been previously described in the art for treatment of the disease (see Bhanot, pg. 3, line 25-27). Furthermore, Gendron teaches that ASOs and siRNAs would be predicted to preferentially degrade repeat-expanded C9ORF72 transcripts.
The skilled artisan would have been motivated to design modified oligonucleotides targeting a known nucleic acid encoding human C9ORF72 because Gendron teaches that repeat expansion of C9ORF72 is causal to amyotrophic lateral sclerosis, although the mechanism(s) remain underexplored. Thus, as described by Gendron, “the development of.. ASOs and the like that target GGGGCCexp RNA may not only lead to the development of potential therapies, but would also serve as valuable tools to decipher the many questions still unanswered.” Coupled with Gendron’s teachings that potential secondary structures of repeat-expanded C9ORF72 transcripts may negatively impact the effect of modified oligonucleotides, and that the wild-type transcript levels would ideally remain uninhibited in methods of treatment, the skilled artisan would have been motivated to design, prepare, and test modified oligonucleotides between 12 to 30 linked nucleosides which are 100% complementary to the C9ORF72 nucleic acid taught by GenBank.
Regarding instant claim 4, Bhanot teaches a single-stranded modified oligonucleotide (“the compound… consists of a single-stranded modified oligonucleotide,” pg. 19, lines 26-27).
Regarding instant claims 5-6, Bhanot teaches at least one internucleoside linkage is a modified internucleoside linkage, wherein the linkage is a phosphorothioate linkage (“at least one internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage,” pg. 19, lines 31-32).
Regarding instant claims 7-8, Bhanot teaches each internucleoside linkage is a modified internucleoside linkage, wherein each linkage is a phosphorothioate linkage (“each internucleoside linkage is a phosphorothioate internucleoside linkage,” pg. 19, lines 32-33).
Regarding instant claim 9, Bhanot does not explicitly teach that at least one internucleoside linkage is a phosphodiester linkage. However, Bhanot teaches modified oligonucleotides in which one or more internucleoside linkages are modified, wherein a modified linkage is a substitution of a naturally-occurring phosphodiester linkage (pg. 32, line 27 to pg. 33, line 6). Because Bhanot teaches that modified internucleoside linkages substitute a naturally-occurring phosphodiester linkage, and Bhanot teaches modified oligonucleotides comprising one modified internucleoside linkage, Bhanot inherently teaches modified oligonucleotides with at least one naturally-occurring phosphodiester linkage.
Regarding instant claims 10-11, Bhanot teaches at least one nucleobase comprises a modified nucleobase, wherein the modified nucleobase is a 5-methylcytosine (“each cytosine is a 5-methylcytosine,” pg. 42, lines 14-16; “at least one nucleoside of said antisense oligonucleotide comprises a modified nucleobase… wherein the modified nucleobase is a 5-methylcytosine,” pg. 67, claims 17-18).
Regarding instant claims 12 and 14, Bhanot teaches at least one nucleoside comprises a modified sugar, wherein the modified sugar is a bicyclic sugar (“at least one nucleoside of the modified oligonucleotide comprises a modified sugar… at least one modified sugar is a bicyclic sugar,” pg. 19, line 34 to pg. 20, line 3).
Regarding instant claim 15, Bhanot teaches the bicyclic sugar comprises a chemical bridge between the 4’ and 2’ positions of the sugar, wherein the chemical bridge is 4’-CH(R)-O-2’, and wherein R is H (“antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4’ to 2’ bridge… 4’-(CH2)-O-2’ (LNA),” pg. 33, lines 31-34; pg. 33, line 9 to pg. 39, line 5).
Regarding instant claims 16-18, Bhanot teaches at least one chemical bridge is 4’-CH(R)-O-2’and R is H, methyl, or CH2-O-CH3 (“4’-(CH2)-O-2’ (LNA)… “4’-CH(CH3)-O-2’ and 4’-CH(CH2OCH3)-O-2’”, pg. 33, lines 34-35).
Regarding instant claim 19, Bhanot teaches at least one modified sugar comprises a 2’-O-methoxyethyl group (“antisense compounds comprise one or more nucleosides having modified sugar moieties… the modified sugar moiety is 2’-MOE,” pg. 41, lines 17-18).
Regarding instant claim 20, Bhanot teaches at least one modified sugar comprises a 2’-O-methyl group (“Antisense compounds… can optionally contain one or more nucleosides wherein the sugar group has been modified… modified sugar moieties include without limitation… 2’-OCH3,” pg. 33, lines 8-28).
Regarding instant claim 22, Bhanot teaches gapmers (pg. 26, line 8 to pg. 27, line 30).
Regarding instant claim 23, Bhanot teaches a modified oligonucleotide comprising a gap segment consisting of 10 linked deoxynucleosides positioned between 3’ and 5’ wing segments, wherein each wing segment consists of 5 linked nucleosides, and wherein each nucleoside of each wing comprises a modified sugar (“Thus, gapmers include… 5-10-5,” pg. 1-3; pg. 26, line 8 to pg. 27, line 30; “The antisense oligonucleotides in Tables 5 and 6 are 5-10-5 gapmers where the gap segment comprises ten 2’-deoxynucleosides and each wing segment comprises five 2’-MOE nucleosides,” pg. 57, line 14-15; claim 20, pg. 67-68).
Regarding instant claim 24, Bhanot teaches a modified oligonucleotide comprising a gap segment consisting of 8 linked deoxynucleosides positioned between 3’ and 5’ wing segments, wherein each wing segment consists of 5 linked nucleosides, and wherein each nucleoside of each wing comprises a modified sugar (“Thus, gapmers include… 5-8-5,” pg. 27, lines 1-3; pg. 26, line 8 to pg. 27, line 30; “the modified oligonucleotide comprises: a) a gap segment consisting of linked deoxynucleosides; b) a 5' wing segment consisting of linked nucleosides; and c) a 3' wing segment consisting of linked nucleosides. The gap segment is positioned between the 5' wing segment and the 3' wing segment and each nucleoside of each wing segment comprises a modified sugar,” pg. 4, lines 23-26).
Regarding instant claim 27, Bhanot teaches a modified oligonucleotide consisting of 17, 18, 19, or 20 linked nucleosides (pg. 19, lines 28-30).
Regarding instant claim 31, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have designed the modified oligonucleotide to target a region other than a hexanucleotide repeat expansion. It would have amounted to applying known design principles for preparing antisense compounds, to a known target nucleic acid sequence, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in preparing the modified oligonucleotides for the reasons described in paragraph 30 above. The skilled artisan would have been motivated to design modified oligonucleotides to a region of C9ORF72 other than a hexanucleotide repeat expansion because Gendron teaches that potential secondary structures of the repeat expansion may negatively impact modified oligonucleotide efficacy. It would, therefore, be beneficial to design modified oligonucleotides to regions other than a hexanucleotide repeat expansion in order to identity the most effective compounds for inhibition of repeat-expanded C9ORF72 transcripts.
Regarding instant claim 32, Bhanot teaches a conjugated antisense compound comprising a modified oligonucleotide (pg. 43, lines 5-19).
Regarding instant claim 33, Bhanot teaches a compound consisting of the modified oligonucleotide (“the compound… consists of a single-stranded modified oligonucleotide,” pg. 19, lines 26-27).
Regarding instant claim 34, Bhanot teaches a double-stranded compound (“Oligomeric compounds include… siRNAs,” pg. 24, lines 27-30).
Regarding instant claim 35, as stated above, Bhanot teaches conjugated compounds (pg. 43, lines 5-19).
Regarding instant claim 36, Bhanot teaches a composition comprising a modified oligonucleotide and at least one pharmaceutically acceptable carrier or diluent (pg. 42, lines 22-24).
Regarding instant claim 37, Bhanot teaches salts of a modified oligonucleotide (pg. 42, lines 30-36).
Claim Rejections - 35 USC § 103 – Gendron, GenBank and Bhanot in view of Kole
Claims 13 and 21 are rejected under 35 U.S.C. 103 as being unpatentable over Gendron (Gendron et al., 12 July 2013, Expert Opinion on Therapeutic Targets, 17(9):991-995; of record), GenBank (Homo sapiens chromosome 9 open reading frame 72 (C9orf72), RefSeqGene on chromosome 9, NCBI Reference Sequence: NG_031977.1, available 28 March 2013; of record) and Bhanot (Bhanot and Shulman, WO 2011/156673 A2, published 15 December 2011; of record) as applied to claims 2-12, 14-20, 22-24, 27, and 31-37, further in view of Kole (Kole et al., 20 January 2012, Nature Reviews Drug Discovery, 11, pg. 125-140; of record). The following rejections are maintained and modified as necessitated by Applicant’s amendments to the claims.
The teachings of Gendron, GenBank, and Bhanot are described above in paragraphs 26-51 and applied as to claims 2-12, 14-20, 22-24, 27, and 31-37 therein. In addition, Gendron teaches that aggregation-prone peptides translated from repeat-expanded C9ORF72 transcripts, and the resultant neurotoxicity and loss-of-function of proteins/systems within the affected cell, are likely causal to ALS associated with C9ORF72 mutation (pg. 922, right col.). Gendron also teaches that a steric blocking oligonucleotide (“CAG25”) has been effective in a mouse model of a different repeat-expansion associated disease (pg. 992, right col.).
None of Gendron, GenBank, or Bhanot teach that each nucleoside comprises a modified sugar (claim 13), wherein each modified sugar comprises a 2’-O-methoxyethyl group or a 2’-O-methyl group (claim 21).
Kole teaches that oligonucleotides fully substituted with nucleosides comprising a 2’-O-methoxyethyl group or a 2’-O-methyl group are not recognized by RISC or RNase H and therefore do not lead to RNA degradation (Fig. 1 and description). Kole teaches that instead, these oligonucleotides lead to downregulation of gene expression via steric blockade of ribosome access to mRNA and therefore, suppression of protein translation (Fig. 1 and description). Kole teaches that fully modified 2’-substituted oligonucleotides have been used in clinical trials (pg. 130, right col.).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted each nucleoside of the modified oligonucleotides rendered obvious above with a nucleoside comprising either a 2’-O-methoxyethyl or 2’-O-methyl modified sugar in view of Kole. It would have amounted to a simple substitution of known chemical modification patterns for antisense oligonucleotides, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in preparing and using fully 2’-O-methoxyethyl or 2’-O-methyl substituted oligonucleotides, because means to synthesize these oligonucleotides and their mechanisms of action were known in the prior art, and as evidenced by Kole, these oligonucleotides have also been used in chemical trials. Gendron teaches that aggregation-prone peptides translated from repeat-expanded C9ORF72 transcripts are likely causal to ALS associated with C9ORF72 mutation. Gendron also teaches that a steric blocking oligonucleotide has been effective in a mouse model of a different repeat-expansion associated disease. The skilled artisan, seeking to decrease the amount of translated repeat-expanded C9ORF72, would have been motivated to prepare a fully 2’-O-methoxyethyl or 2’-O-methyl substituted oligonucleotide because as evidenced by Gendron and Kole, these oligonucleotides were known to sterically block access of proteins to a target mRNA and suppress protein translation.
Claim Rejections - 35 USC § 103 – Gendron, GenBank and Bhanot in view of Østergaard
Claim 25 is rejected under 35 U.S.C. 103 as being unpatentable over Gendron (Gendron et al., 12 July 2013, Expert Opinion on Therapeutic Targets, 17(9):991-995; of record), GenBank (Homo sapiens chromosome 9 open reading frame 72 (C9orf72), RefSeqGene on chromosome 9, NCBI Reference Sequence: NG_031977.1, available 28 March 2013; of record) and Bhanot (Bhanot and Shulman, WO 2011/156673 A2, published 15 December 2011; of record) as applied to claims 2-12, 14-20, 22-24, 27, and 31-37, in view of Østergaard (Østergaard et al., 19 August 2013, Nucleic Acids Research, Vol. 41, No. 21, pg. 9634-9650; of record). The following rejections are maintained and modified as necessitated by Applicant’s amendments to the claims.
The teachings of Gendron, GenBank, and Bhanot are described above in paragraphs 26-51 and applied as to claims 2-12, 14-20, 22-24, 27, and 31-37 therein. As stated above, Gendron teaches that RNA-targeting therapies for ALS would ideally selectively decrease expression of the repeat-expanded C9ORF72 transcripts; while preserving expression of the wild-type transcripts (“purportedly protective intervention could contribute to a loss of C9ORF72 function… The effects of RNA-targeting therapies on the wild-type allele should therefore be carefully monitored,” pg. 994). Bhanot teaches fully phosphorothioated modified oligonucleotides with a 10-nt 2’-deoxynucleoside gap, flanked on either end by a 5-nt 2’-O-methyoxyethyl wing (see at least Tables 2-6).
None of Gendron, GenBank, or Bhanot teach that the modified oligonucleotide comprises one of the recited sugar modification patterns recited in claim 25.
Østergaard teaches design strategies to prepare modified oligonucleotides that selectively decrease expression of a disease-causing allele (Abstract). Østergaard teaches the design strategies are relevant for “some forms of familial amyotrophic lateral sclerosis… caused by a gain of function mutant protein and/or RNA” (pg. 9634, right col.). Østergaard’s design strategies leverage different chemical modification patterns to enhance selective suppression of an exemplary repeat-expanded allele of HTT (“muHTT”). For example, Østergaard teaches oligonucleotide A1, which is a 15mer with a 9-nt 2’-deoxynucleoside gap supporting RNase H cleavage of the target mRNA, flanked on either end by 2’-O-methyoxyethyl and cEt nucleosides which “improve affinity of the ASO for target RNA and stabilize the ASO from exo-nuclease mediated degradation” (pg. 9638, left col.; Fig. 1A). Oligonucleotide A1 is fully phosphorothioated, which Østergaard teaches “stabilizes the ASO from nuclease digestion and facilitates internalization of the ASO into cells” (pg. 9638, left col.). Østergaard teaches that oligonucleotide A1 has ~5-fold selectivity for the repeat-expanded allele of HTT (pg. 9638, left col.).
Østergaard teaches that introducing chemical modifications to a modified oligonucleotide which interfere with RNase H action at potential cleavage sites within the wild-type allele can improve selectivity of the oligonucleotide (pg. 9639, left col.). Østergaard teaches that “the optimal location for introducing chemical modifications into the ASO could not be predicted a priori,” (pg. 9639, right col.). Accordingly, Østergaard sequentially replaced nucleosides in oligonucleotide A1 with chemically modified nucleosides, and tested the selectivity of the resulting modified oligonucleotides. For example, Østergaard teaches that incorporation of cEt at positions 5 or 6 in oligonucleotide A1 (i.e., within a few nucleotides of the major RNase H cleavage site positioned within the 2’-deoxynucleoside gap) improved selectivity of the oligonucleotide for the repeat-expanded allele (pg. 9643, Fig. 6). Østergaard also teaches that shortening the 2’-deoxynucleoside gap of oligonucleotide A1 (e.g., from 9-nt to 8-nt or 7-nt) improves selectivity of the oligonucleotide for the repeat-expanded allele (pg. 9644, left col.; Fig. 7C-D).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have applied the design strategy of Østergaard to the modified oligonucleotides rendered obvious above, to arrive at the sugar medication patterns recited in instant claim 25. It would have amounted to applying a known chemical modification design strategy, to an obvious modified oligonucleotide, by known means to yield predictable results. Bhanot teaches fully phosphorothioated modified oligonucleotides with a 10-nt 2’-deoxynucleoside gap, flanked on each end by a 5-nt 2’-O-methyoxyethyl wing (see at least Tables 2-6). Østergaard teaches that incorporating cEt nucleosides near the RNase H cleavage site in the 2’-deoxynucleoside gap, and shortening the length of the 2’-deoxynucleoside gap improves selectivity of an oligonucleotide for a disease-causing repeat expanded allele. Østergaard teaches that determining the optimal location for chemical modifications cannot be predicted a priori, and demonstrates that through sequential replacement of nucleosides within a “base” modified oligonucleotide, the skilled artisan can identify oligonucleotides highly selective for a repeat-expanded allele. Accordingly, the skilled artisan would have had a reasonable expectation of success in applying Østergaard’s design strategies to the modified oligonucleotides rendered obvious above over Gendron, GenBank, and Bhanot. Østergaard demonstrates that replacing nucleosides with cEt and shortening the 2’-deoxynucleoside gap can greatly improve allele selectivity of an oligonucleotide, and teaches that optimal chemical modification patterns cannot be determined a priori. In view of Gendron’s teaching that RNA-targeting therapies for ALS should selectively decrease expression of the repeat-expanded C9ORF72 transcripts, and preserve expression of the wild-type transcripts, the skilled artisan would have been motivated to test a variety of cEt modified- and gap-shortened oligonucleotides to identity the most effective modified oligonucleotides for selectively reducing expression of repeat-expanded C9ORF72 transcripts.
Claim Rejections - 35 USC § 103 – Gendron, GenBank, Bhanot, and Østergaard in view of Peng Ho
Claim 26 is rejected under 35 U.S.C. 103 as being unpatentable over Gendron (Gendron et al., 12 July 2013, Expert Opinion on Therapeutic Targets, 17(9):991-995; of record), GenBank (Homo sapiens chromosome 9 open reading frame 72 (C9orf72), RefSeqGene on chromosome 9, NCBI Reference Sequence: NG_031977.1, available 28 March 2013; of record), Bhanot (Bhanot and Shulman, WO 2011/156673 A2, published 15 December 2011; of record), and Østergaard (Østergaard et al., 19 August 2013, Nucleic Acids Research, Vol. 41, No. 21, pg. 9634-9650; of record) as applied to claims 1-12, 14-20, 22-25, 27, and 31-37, in view of Peng Ho (Peng Ho et al., 1998, Molecular Brain Research, 1998, pg. 1-11; of record). The following rejections are maintained and modified as necessitated by Applicant’s amendments to the claims.
The teachings of Gendron, GenBank, Bhanot, and Østergaard are described above in paragraphs 57-61 and applied as to claims 2-12, 14-20, 22-25, 27, and 31-37 therein.
None of Gendron, GenBank, Bhanot, or Østergaard teach the internucleoside linkage patterns recited in instant claim 26.
Peng Ho teaches that while phosphorothioate modifications promote stability of modified oligonucleotides, increasing evidence indicates that phosphorothioate modified oligonucleotides cause CNS-specific toxicities (pg. 1, right col.; section 3.1). In contrast, Peng Ho demonstrates that phosphodiester oligonucleotides have lower efficacy, but are less toxic (section 3.3). Peng Ho teaches that “chimeric” phosphorothioate oligonucleotides, in which central phosphodiester linkages are replaced with phosphorothioate linkages, have improved efficacy and no apparent toxicity (section 3.4). Peng Ho also teaches that an oligonucleotide can be protected from exonuclease-mediated degradation by incorporating one to two phosphorothioate linkages at the ends (pg. 8, right col. to pg. 9, left col.).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have applied the phosphorothioate linkage designs of Peng Ho to the modified oligonucleotides rendered obvious above, to arrive at the internucleoside linkage patterns recited in instant claim 26. It would have amounted to applying a known chemical modification design strategy, to an obvious modified oligonucleotide, by known means to yield predictable results. Bhanot teaches fully phosphorothioated modified oligonucleotides, as well as modified oligonucleotides comprising one or more phosphorothioate internucleoside linkages (pg. 33, lines 3-6). Peng Ho teaches that phosphorothioate internucleoside linkages are associated with CNS-specific toxicities, and that limiting the phosphorothioate linkages to the central region of an oligonucleotide reduces toxicity and preserves efficacy. Peng Ho also teaches that ends of an oligonucleotide can be protected with one-two phosphorothioate linkages. Based on the teachings of Bhanot and Peng Ho, it was well-within the purview of the skilled artisan to design, prepare, and test modified oligonucleotides comprising one or more phosphorothioate linkages. Accordingly, the skilled artisan would have had a reasonable expectation of success in applying Peng Ho’s designs to the modified oligonucleotides rendered obvious above over Gendron, GenBank, and Bhanot. Given that the modified oligonucleotides rendered obvious above would be potential therapeutics for a nervous system disease (i.e., ALS), the skilled artisan would have been motivated to apply the phosphorothioate linkage designs of Peng Ho to the modified oligonucleotides, to arrive at the patterns recited in claim 26 which have one-two phosphorothioate linkages at the ends, and phosphorothioate linkages in the center of the oligonucleotide.
Response to Remarks - 35 USC § 103
Applicant’s remarks regarding the § 103 rejections raised in the prior action, which are maintained and modified above, have been thoroughly reviewed. Applicant argues that the burden to make a prima facie case of obviousness has not been met, because “the present rejection never actually arrives at the compounds recited in the claims.” Applicant contends that the rejection amounts to a “mere statement that the claimed invention is within the capabilities of one of ordinary skill in the art,” which is “not sufficient by itself to establish prima facie obviousness.” Applicant also argues that the rejection “resort[s] to impermissible hindsight in an attempt to cure the deficiencies of the cited documents.” In support of these arguments, Applicant cites Gendron, and alleges that “one of ordinary skill reading Gendron would have understood that targeting C9ORF72, by any mechanism, including use of an ASO, in a subject that has ALS presents numerous and significant challenges.” Applicant also alleges that neither Gendron or Bhanot, the latter of which describes modified oligonucleotides directed to “a different target molecule (‘PEPCK-M’),” “would not have suggested Applicant’s SEQ ID NOs or regions as recited in instant claims 2 and 3, let alone a modified oligonucleotide antisense compound targeting a specific region of a C9ORF72 nucleic acid.” These arguments are not found convincing for the reasons that follow.
As described above, the skilled artisan would have understood that modified oligonucleotides, i.e., antisense oligonucleotides (ASOs) and siRNAs, are a successful therapeutic strategy in repeat expansion diseases, and that, based on Gendron, repeat-expanded C9ORF72, which causes ALS, was a promising target for such therapeutics. The skilled artisan would have understood that means to design modified oligonucleotides to successfully target a nucleic acid, including to target a repeat expanded allele, were well known. The skilled artisan would have had ample guidance to design modified oligonucleotides consisting of 12 to 30 linked nucleotides and 100% complementary to a target nucleic acid based on the disclosure of Bhanot. The skilled artisan would have recognized that Bhanot’s teachings, despite being directed to a different target, were applicable to C9ORF72 because Bhanot’s modified oligonucleotides are directed to the “same antisense mechanisms described by Gendron,” and because Bhanot demonstrates that successful oligonucleotides can be prepared, even when antisense-based therapeutics have not yet be used for the target molecule.
The skilled artisan, therefore, could have easily used the known sequence of C9ORF72 taught by GenBank, to design modified oligonucleotides using Bhanot’s design principles with a reasonable expectation of success. The skilled artisan would have been highly motivated to design and identify modified oligonucleotides based on the teachings of Gendron with respect to I) the underexplored mechanism of repeat-expanded C9ORF72 in ALS, II) the effect of secondary structures on the modified oligonucleotides, and III) the need to maintain wild-type C9ORF72 transcript levels in potential therapeutic applications. As stated in the prior action with respect to claims 2-3, and as reiterated above, the sequence of GenBank is 100% identical to instant SEQ ID NO: 2 recited in instant claim 3. The SEQ ID NOs recited in claim 2 are 100% complementary to instant SEQ ID NO: 2. Thus, by applying Bhanot’s design principles to the known sequence of C9ORF72 taught by GenBank (i.e., 12 to 30 linked nucleosides with 100% complementarity), the skilled artisan would have arrived at the modified oligonucleotides.
Regarding Applicant’s allegations of hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). The rejection describes how the skilled artisan, utilizing only the disclosures of Gendron, Bhanot, and GenBank, would have arrived at compounds comprising a modified oligonucleotide 12 to 30 nucleosides in length, and 100% complementary to the C9ORF72 sequence taught by GenBank. Instant claim 2 is directed to compounds comprising a modified oligonucleotide 12 to 30 nucleosides in length, comprising at least 12 consecutive nucleobases of any of the recited SEQ ID NOs. The recited SEQ ID NOs are 100% complementary to instant SEQ ID NO: 2, which as stated above, is taught by GenBank. Applying Bhanot’s principles to GenBank’s sequence (i.e., 12 to 30 linked nucleosides, 100% complementarity), the skilled artisan would have arrived at the modified oligonucleotides as claimed in claim 2. Instant claim 3 is directed to compounds comprising a modified oligonucleotide 12 to 30 nucleosides in length, comprising at least 8 nucleobases complementary to any of the recited segments of SEQ ID NO: 2. Instant SEQ ID NO: 2 is taught by GenBank. Applying Bhanot’s principles to GenBank’s sequence (i.e., 12 to 30 linked nucleosides, 100% complementarity), the skilled artisan would have arrived at the modified oligonucleotides as claimed in claim 3. Thus, Examiner respectfully disagrees that the rejection “never actually arrives at the compounds recited in the claims,” or amounts to a “mere statement that the claimed invention is within the capabilities of one of ordinary skill in the art.” Examiner also notes that, in contrast to Applicant’s allegations, the instant claims are not directed to compounds comprising modified oligonucleotides of “specific sequences.” The instant claims are directed to broad genera of modified oligonucleotides 12 to 30 nucleosides in length, comprising 12 or more consecutive nucleobases of any recited SEQ ID NO (claim 2), or comprising 8 or more consecutive nucleobases complementary to a segment of SEQ ID NO: 2 (claim 3). For the reasons described above, the skilled artisan would have arrived at these modified oligonucleotides.
Applicant’s arguments regarding the challenges discussed by Gendron are also not convincing. The instant claims are not directed to a method of treatment, and the compounds are not limited to a specific use. Several of the challenges identified by Applicant were also cited in the rejection as motivation that the skilled artisan would have arrived at the claimed compounds. For example, based on Gendron, the skilled artisan would have known that they would need to design and test modified oligonucleotides to circumvent potential impacts due to secondary structure, and, for therapeutic purposes, selectively degrade the repeat-expanded C9ORF72 allele. The skilled artisan would have also known that modified oligonucleotides targeting C9ORF72 would be useful for non-therapeutic applications, e.g., deciphering the mechanistic role of repeat-expanded C9ORF72 transcripts in disease. The skilled artisan would not have been deterred by Gendron’s teachings regarding therapeutic challenges related to delivery or off-target effects, which are also known features of virtually any antisense-based therapy. Indeed, Gendron explicitly states that investigations targeting repeat-expanded C9ORF72 transcripts are “no doubt… underway since the discovery that mutant C9ORF72 causes c9FTD/ALS” (pg. 992, right col.). “Based on advances made in the development of therapeutic strategies for other repeat expansion disease marked by RNA toxicity,” Gendron concludes that “initial progress is expected to be relatively rapid” (pg. 992, right col.). There is no convincing evidence that the skilled artisan would fail to arrive at the instant invention based on the challenges referred to by Applicant, which the skilled artisan would understand could be overcome by routine experimentation, or were well-known features of virtually any antisense-based therapy.
Finally, Applicant contends that none of Kole, Østergaard, or Peng Ho remedy the alleged deficiencies of Gendron, Bhanot, or GenBank. The alleged deficiencies of the rejection made over Gendron, Bhanot, and GenBank are addressed above. Applicant’s arguments were not found convincing for the reasons described therein. The rejections made in further view of Kole, Østergaard, and Peng Ho are maintained and modified, as necessitated by Applicant’s amendments to the claims. Taken together, Applicant’s remarks are not sufficient to overcome the rejections, which are maintained and modified above.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
U.S. Patent No. 11,339,393 B2
Claim 2 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 2, 4-8, 11-20, and 22-25 of U.S. Patent No. 11,339,393 B2. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This rejection is maintained from the prior action with modification necessitated by Applicant’s amendments.
Patented claim 2 recites “A compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 consecutive nucleobases complementary to an equal length portion of nucleobases 7860-7906 or 7907-7944 of SEQ ID NO: 2.”
Instant claim 2 recites oligonucleotides comprising SEQ ID NOs targeting the ranges recited in patented claim 2. For example, instant SEQ ID NO: 1063 targeting nucleobases 7907-7924 of SEQ ID NO: 2, and others described in instant Table 53 (see pg. 171 of instant specification). As another example, SEQ ID NO: 1443 targeting nucleobases 7913-7932 of SEQ ID NO: 2, and others described in instant Table 58 (see pg. 181 of instant specification). Patented claim 2 encompasses oligonucleotides recited in instant claim 2, and thereby, anticipates instant claim 2.
U.S. Patent No. 10,221,414 B2
Claim 2 is rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of U.S. Patent No. 10,221,414 B2. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This rejection is maintained from the prior action.
While the instant application was filed as a continuation of 16/248,612, which issued as U.S. Patent No. 11,339,393 B2 (directly above), which is a divisional of 15/028,626, which issued as U.S. Patent No. 10,221,414 B2, Section 121 does not shield claims against double patenting when consonance does not exist. See MPEP 804.1.
Patented claim 1 recites “A compound comprising a modified oligonucleotide consisting of 15 to 30 linked nucleosides and having a nucleobase sequence that is at least 90% complementary to an equal length portion of nucleobases 8213-8325 of SEQ ID NO: 2.”
Instant claim 2 recites oligonucleotides comprising SEQ ID NOs targeting the range recited in patented claim 1. For example, instant SEQ ID NO: 603 targeting nucleobases 8310-8329 of SEQ ID NO: 2, or instant SEQ ID NO: 1366 targeting nucleobases 8260-8277 of SEQ ID NO: 2. Patented claim 1 encompasses oligonucleotides recited in instant claim 2, and thereby, anticipates instant claim 2.
U.S. Patent No. 9,963,699 B2
Claims 2-27, and 31-37 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-28 of U.S. Patent No. 9,963,699 B2. Claims 23-24, 27, and 31-37 are in view of Gendron (Gendron et al., 12 July 2013, Expert Opinion on Therapeutic Targets, 17(9):991-995; of record) and Bhanot (Bhanot and Shulman, WO 2011/156673 A2, published 15 December 2011; of record). Claim 21 is in view of Kole (Kole et al., 20 January 2012, Nature Reviews Drug Discovery, 11, pg. 125-140; of record). Claim 25 is in view of Østergaard (Østergaard et al., 19 August 2013, Nucleic Acids Research, Vol. 41, No. 21, pg. 9634-9650; of record). Claim 26 is in further view of Peng Ho (Peng Ho et al., 1998, Molecular Brain Research, 1998, pg. 1-11; of record). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This rejection is maintained from the prior action with modification necessitated by Applicant’s amendments.
Patented claim 5 recites “A method of reducing the percent of cells with foci and/or reducing the number of foci per cell in an animal identified as having foci comprising administering to the animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide is at least 90% complementary to a C9ORF72 nucleic acid, and wherein the modified oligonucleotide is not complementary to a C9ORF72 hexanucleotide repeat expansion; and thereby reducing the percent of cells with foci and/or reducing the number of foci per cell” wherein “the nucleobase sequence of the modified oligonucleotide is 100% complementary to an equal length portion of a C9ORF72 nucleic acid,” wherein “the C9ORF72 nucleic acid has the nucleobase sequence of any of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10.” Patented SEQ ID NO: 2 and instant SEQ ID NO: 2 are 100% identical. Patented claim 5 encompasses the oligonucleotides recited in instant claims 2-3.
Patented claim 6 meets the limitations of instant claim 4. Patented claims 8-11 meet the limitations of instant claims 5-9. Patented claims 12-13 meet the limitations of instant claims 10-11. Patented claims 14-15 meet the limitations of instant claims 12-13. Patented claims 16-24 meet the limitations of instant claims 14-18. Patented claims 25-26 meet the limitations of instant claims 19-20. Patented claim 7 meets the limitations of instant claim 22.
Regarding instant claims 21, 23-27, and 31-37, the teachings of Gendron, Bhanot, Kole, Østergaard, and Peng Ho are described above. The obviousness of arriving at the instant claims in view of Gendron, Bhanot, Kole, Ostergaard, and Peng Ho is described in paragraphs 30, 45, 56, 61, and 66, and applied herein with respect to instant claims 21, 23-27, and 31-37.
U.S. Patent No. 10,577,604 B2
Claims 2-27, and 31-37 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 4-19 of U.S. Patent No. 10,577,604 B2. Claims 7-8, 20, 23-24, 27, and 31-37 are in view of Gendron (Gendron et al., 12 July 2013, Expert Opinion on Therapeutic Targets, 17(9):991-995; of record) and Bhanot (Bhanot and Shulman, WO 2011/156673 A2, published 15 December 2011; of record). Claims 13 and 21 are in view of Kole (Kole et al., 20 January 2012, Nature Reviews Drug Discovery, 11, pg. 125-140; of record). Claim 25 is in view of Østergaard (Østergaard et al., 19 August 2013, Nucleic Acids Research, Vol. 41, No. 21, pg. 9634-9650; of record). Claim 26 is in further view of Peng Ho (Peng Ho et al., 1998, Molecular Brain Research, 1998, pg. 1-11; of record). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This rejection is maintained from the prior action with modification necessitated by Applicant’s amendments.
Patented claim 4 recites “A method comprising contacting a cell of a patient with a neurodegenerative disease with a compound comprising an oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the oligonucleotide is at least 90% complementary to a C9ORF72 nucleic acid, wherein the compound reduces nuclear retention of any of ADARB2, CYP2C9, DPH2, HMGB2, JARID2, MITF, MPP7, NDST1, NUDT6, ORAOV1, PGA5, PTER, RANGAP1, SOX6, TCL1B, TRIM32, WBP11, or ZNF695 in the cell,” “wherein the C9ORF72 nucleic acid has the nucleobase sequence of any of SEQ ID Nos: 1-10” and “wherein the oligonucleotide is a modified oligonucleotide.” Patented SEQ ID NO: 2 and instant SEQ ID NO: 2 are 100% identical. Patented claim 4 encompasses modified oligonucleotides which meet the limitations of instant claims 2-3.
Patented claim 5 meets the limitations of instant claim 4. Patented claims 7-8 meet the limitations of instant claims 5-6, and 9. Patented claims 9-10 meet the limitations of instant claims 10-11. Patented claims 11-12 meet the limitations of instant claims 12 and 14. Patented claims 13-16 meet the limitations of instant claims 15-18. Patented claim 17 meets the limitations of instant claim 19. Patented claim 6 meets the limitations of instant claim 22.
Regarding instant claims 7-8, 13, 20-21, 23-27, and 31-37, the teachings of Gendron, Bhanot, Kole, Østergaard, and Peng Ho are described above. The obviousness of arriving at the instant claims in view of Gendron, Bhanot, Kole, Ostergaard, and Peng Ho is described in paragraphs 30, 45, 56, 61, and 66, and applied herein with respect to instant claims 7-8, 13, 20-21, 23-27, and 31-37.
U.S. Patent No. 10,443,052 B2
Claim 2 is rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of U.S. Patent No. 10,443,052 B2. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This rejection is maintained from the prior action with modification necessitated by Applicant’s amendments.
Patented claim 1 recites “A compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of SEQ ID NO: 300 or SEQ ID NO: 301, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar, a sugar surrogate, and a modified internucleoside linkage.” SEQ ID NOs: 300 and 301 are 100% complementary to instant SEQ ID NO: 2 at nucleobases 1552-1571 and 1553-1572, respectively. The patented claim anticipates instant claim 2.
U.S. Patent No. 9,605,263 B2
Claims 2-6, 9-12, 21-22, 27, 31-33, and 36-37 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 9,605,263 B2. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This rejection is maintained from the prior action with modification necessitated by Applicant’s amendments.
Patented claims 1-2, and 13 recite compounds comprising a modified oligonucleotide, wherein the modified oligonucleotide sequence is 18-nts length and 100% complementary to nucleobases 1444-1461 of instant SEQ ID NO: 2, which do not comprise a hexanucleotide repeat sequence recited in instant claim 31. The patented oligonucleotides anticipate each limitation of instant claims 2-6, 9-12, 21-22, 27, 31-33, and 36-37.
U.S. Patent No. 10,138,482 B2
Claims 2-6, 9-12, 21-22, 27, 31-33, and 36-37 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 10,138,482 B2. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This rejection is maintained from the prior action with modification necessitated by Applicant’s amendments.
Patented claims 1, 9, and 13 recite compounds comprising a modified oligonucleotide, wherein the modified oligonucleotide sequence is 20-nts in length and 100% complementary to nucleobases 1371-1389 of instant SEQ ID NO: 2, which do not comprise a hexanucleotide repeat sequence recited in instant claim 31. The patented oligonucleotides anticipate each limitation of instant claims 2-6, 9-12, 21-22, 27, 31-33, and 36-37.
U.S. Patent No. 10,815,483 B2
Claim 2 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 10,815,483 B2. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This rejection is maintained from the prior action with modification necessitated by Applicant’s amendments.
Patented claims 1-2, and 13 recite compounds comprising a modified oligonucleotide comprising at least 12 consecutive nucleotides of SEQ ID NOs recited in instant claim 2, e.g., SEQ ID NO: 483, 485-486. Patented claim 2 encompasses oligonucleotides recited in instant claim 2, and thereby, anticipates instant claim 2.
Co-pending Application No. 16/948,435
Claims 2-6, 9-12, 19, 22, 24, 27, 31-33, and 36 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 88-93 and 98-102 of co-pending Application No. 16/948,435. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. This rejection is maintained from the prior action with modification necessitated by Applicant’s amendments.
Co-pending claims 88 and 98 recite a compound or modified oligonucleotide, wherein the 18-nt modified oligonucleotide sequence (i.e., SEQ ID NO: 33) is 18-nts in length and 100% complementary to nucleobases 1444-1461 of instant SEQ ID NO: 2, which do not comprise a hexanucleotide repeat sequence recited in instant claim 31. The co-pending claims anticipate the limitations of instant claims 2-6, 9-12, 19, 22, 24, 27, 31-33, and 36.
Response to Remarks – Double Patenting
Applicant requests that the nonstatutory double patenting rejections be held in abeyance until the claims are otherwise allowable. Applicant’s remarks do not address the propriety of the nonstatutory double patenting rejections raised in the prior action. As described in the preceding paragraphs, the claims remain indistinct from the patented and co-pending claims. No terminal disclaimers have been filed. The nonstatutory double patenting rejections remain outstanding.
Conclusion
No claims are allowed.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JENNA L PERSONS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600