DETAILED ACTION
The examiner for your application at the USPTO has changed. Examiner Abigail VanHorn can be reached at 571-270-3502.
Election/Restrictions
Applicant’s election without traverse of Group I and lipophilic monomer of
PNG
media_image1.png
130
630
media_image1.png
Greyscale
in the reply filed on October 9 2025 is acknowledged.
Upon searching, the elected lipophilic monomer is free of prior art. Also free of prior art are the following lipophilic monomers:
PNG
media_image2.png
120
440
media_image2.png
Greyscale
PNG
media_image3.png
406
648
media_image3.png
Greyscale
Therefore, the species election has been expanded to:
PNG
media_image4.png
316
354
media_image4.png
Greyscale
Claim 4 and 11 were/stand cancelled. Claims 1-3, 5-10 and 12-23 are pending in the application. Claims 20-23 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on October 9 2025. Accordingly, claims 1-3, 5-10 and 12-19 are being examined on the merits herein.
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
This application is a CON of PCT/US2020/059070 (11/05/2020) which claims benefit of 62/913,392 (10/10/2019) as reflected in the filing receipt issued on May 20 2022.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on October 9 2025 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Drawings
The drawings are objected to for the following reasons: 37 CFR 1.84 (u)(1) states “View numbers must be preceded by the abbreviation "FIG."”
In the current case, the view numbers for Figures 1-25 are preceded by the word "Figure" instead of the abbreviation "FIG.".
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Objections
Claim 14 is objected to because of the following informalities: the recitation “the antisense” should recite “the antisense strand” for consistency. Appropriate correction is required.
Claim 14 is objected to because of the following informalities: The acronym “GNA” is not defined in the claims. When an acronym is used in a claim set, it should be defined the first time it appears in the claims. For the purposes of examination, the term “GNA” is interpreted to mean glycerol nucleic acid. Appropriate correction is required.
Claim 16 is objected to because of the following informalities: the recitation “the antisense” should recite “the antisense strand” for consistency. Appropriate correction is required.
Claim 16 is objected to because of the following informalities: the recitation “comprises at a GNA” is ungrammatical. The recitation should be “comprises a GNA”. Appropriate correction is required.
Claim 18 is objected to because of the following informalities: The acronym “LDL” is not defined in the claims. When an acronym is used in a claim set, it should be defined the first time it appears in the claims. For the purposes of examination, the term “LDL” is interpreted to mean low density lipoprotein. Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 14 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 14 recites the limitation "the seed region" in line 2. There is insufficient antecedent basis for this limitation in the claim. Claim 14 depends from claim 1 and claim 1 merely refers to a double stranded RNAi agent, sense strand or antisense strand. Firstly, there does not appear to be a limiting definition of seed region in the instant specification as some times the seed region is at position 5-7 from the 5’-end of the antisense strand (see page 10 of the specification) or at positions 2-8 of the 5’-end of the antisense strand (page 97 of the specification). Secondly, while specific oligonucleotides might contain a seed region not every oligonucleotide necessarily contains a seed region and thus the recitation cannot be said as being implicit.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-3, 5-10, 12-13 and 17-18 are rejected under 35 U.S.C. 103 as being unpatentable over Zimmermann et al. (USPGPUB No. 20170029817, cited on PTO Form 1449) in view of Acevedo et al. (US Patent No. 5714606) and Manoharan et al. (USPGPUB No. 20050164235).
Applicant Claims
The instant application claims a double stranded RNAi agent comprising a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to part of an mRNA encoding transthyretin (TTR), wherein each strand independently has 14 to 30 nucleotides; wherein the double stranded RNAi agent comprises one or more lipophilic monomer
The instant application claims a double stranded RNAi agent for inhibiting expression of transthyretin (TTR) in a cell, wherein the double stranded RNAi agent comprises a sense strand and an antisense strand forming a double stranded region; wherein the sense strand comprises the nucleotide sequence 5’ – UGGGAUUUCAUGUAACCAAGA – 3’ (SEQ ID NO: 12) and the antisense strand comprises the nucleotide sequence 5’- UCUUGGUUACAUGAAAUCCCAUC -3’ (SEQ ID NO: 13); wherein the double stranded RNAi agent comprises one or more lipophilic monomer.
Lipophilic monomers claimed include:
PNG
media_image4.png
316
354
media_image4.png
Greyscale
Determination of the Scope and Content of the Prior Art
(MPEP §2141.01)
Zimmermann et al. is directed to transthyretin (TTR) iRNA compositions and methods of use thereof for treating TTR-associated diseases. Claimed is a double stranded ribonucleic acid (RNAi) agent for inhibiting expression of transthyretin (TTR) in a cell, wherein said RNAi agent comprises a sense strand complementary to an antisense strand, wherein said antisense strand comprises a region complementary to SEQ ID NO:2, wherein each strand is about 14 to about 30 nucleotides in length,
wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides,
wherein the sense strand comprises no more than 8 2′-fluoro modifications;
wherein the antisense strand comprises no more than 6 2′-fluoro modifications;
wherein the sense strand and the antisense strand each independently comprise two phosphorothioate linkages at the 5′-terminus; and wherein the sense strand is conjugated to at least one ligand (claim 1). Ligands include lipids or an RGD peptide or peptide mimetic (paragraph 0308). The ligand may be attached to the polynucleotide via carrier. The carriers include at least one backbone attachment point which refers to a functional group such as a hydroxyl group or generally a bond available for and that is suitable for incorporation of the carrier into the backbone. The carrier can be a cyclic group such as pyrrolidinyl (paragraph 0301-0302).
Ascertainment of the Difference Between Scope the Prior Art and the Claims
(MPEP §2141.02)
While Zimmermann et al. suggest the carrier can be a cyclic group such as pyrrolidinyl, Zimmermann et al. does not teach the lipophilic monomers are claimed. However, this deficiency is cured by Acevedo et al. and Manoharan et al.
Acevedo et al. is directed to pyrrolidine-containing monomers and oligomers.
PNG
media_image5.png
298
644
media_image5.png
Greyscale
which reads on the instant claims when n is 0, Q is G3 which is C(O) and Z is L1 which is an alkyl having 1 to about 20 carbon atoms. X and Y can be H or oligonucleotides (columns 4-5, lines 8-67, 1-67; claim 1). The compounds are capable of hybridizing to nucleic acids of interest in the etiology of disease (column 6, lines 13-24). Exemplified is incorporation in oligonucleotides.
Manoharan et al. is directed to modified iRNA agents. Taught are iRNA agents which include a monomer in which the ribose moiety has been replaced by a moiety other than ribose. The inclusion of such a monomer can allow for modulation of a property of the iRNA agent into which it is incorporated. The non-ribose moiety can also serve as a point to which a ligand or other entity, e.g. a carbohydrate can be directly or indirectly tethered (paragraph 0002). Taught is a ribose replacement modification subunit (RRMS) can alter the lipophilicity of the iRNA agent (paragraph 007). Subunits taught include:
PNG
media_image6.png
212
584
media_image6.png
Greyscale
wherein X can be a N(CO)R7 wherein R7 is a ligand such as a C1-C20 alkyl, Y can be absent, Z is CR11R12 wherein R11 and R12 can be H. R5 and R6 can be H. R1, R2, R3 and R4 can be H and (CH2)nORa(or b) wherein n can be 1, Ra/b are phosphates which are connected to a strand, OH or results in a triphosphate (paragraphs 0008-0025; claims; Fig. 3).
Finding of Prima Facie Obviousness Rationale and Motivation
(MPEP §2142-2143)
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Zimmermann et al., Acevedo et al. and Manoharan et al. and incorporate a ribose replacement modification subunit such as that taught in Acevedo et al. into the RNAi agent of Zimmermann et al. One skilled in the art would have been motivated to incorporate a ribose replacement modification subunit in order to manipulate the properties of the RNAi and/or to tether a ligand to the oligonucleotide as taught by Manoharan et al. One skilled in the art would have a reasonable expectation of success as the ribose replacement modification subunits taught by Acevedo et al. and Manoharan et al. are pyrrolidines and Zimmermann et al. teaches carriers for the ligand can be a cyclic group such as pyrrolidinyl. Furthermore, Zimmermann et al. teaches an RNAi agent and Manoharan et al. teaches the ribose replacement modification submits can be incorporated in RNAi agents. Furthermore, Zimmermann et al. claims (claim 8) the RNAi conjugated to a ligand via the following molecule:
PNG
media_image7.png
273
380
media_image7.png
Greyscale
this molecule is of the same structure (albeit a different alkyl length C10 in Zimmermann et al. vs C15 in instant claims) than instantly claimed
PNG
media_image8.png
164
460
media_image8.png
Greyscale
suggesting a reasonable expectation of success in using the pyrrolidine of Acevedo et al. and/or Manoharan et al.
Regarding the claimed lipophilic monomer, both Acevedo et al. and Manoharan et al. suggest that the monomer is a five-membered nitrogen containing ring, e.g. a pyrrolidine. Both Acevedo et al. and Manoharan et al. suggest incorporation in an oligonucleotide via an O or CH2O at the same positions in the pyrrolidone of the instantly claimed monomers. Both Acevedo et al. and Manoharan et al. teach that the group attached to the N of the pyrrolidine can be C(O)-alkyl wherein the alkyl is from 1 to 20 carbons. This overlaps the length of the alkyl chain in the instantly claimed lipophilic monomers. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05. It would have been obvious to one of ordinary skill in the art to try any of the specifically taught substituents as a person with ordinary skill has good reason to pursue known options within his or her technical grasp. Note: MPEP 2141 KSR International CO. v. Teleflex Inc. 82 USPQ 2d 1385 (Supreme Court 2007). Manoharan et al. expressly teaches that the ribose replacement modification submits can be used to modify the properties of the RNAi agent and this includes the lipophilicity of the compound as well as serving as a tether to ligands. Therefore, one skilled in the art would manipulate the length of the alkyl chain, which would be expected to modify the lipophilicity of the compound and the substituents attached depending on whether a ligand would be required to be incorporated into the RNAi agent.
Regarding the claimed sense and antisense strand and SEQ ID NO: 11 of claim 2, Zimmermann et al. claims a sense strand complementary to an antisense strand wherein the antisense strand comprises a region complementary to SEQ ID No: 2.
As shown below: instantly claimed SEQ ID No: 11 (Qy) has 100% identity to SEQ ID No: 2 (Db). Therefore, formation of a sequence complementary to SEQ ID NO: 2 as suggested by Zimmermann et al. would results in an antisense strand comprising a sequence complementary to SEQ ID No: 11.
PNG
media_image9.png
122
620
media_image9.png
Greyscale
Regarding claim 3, Zimmermann et al. claims wherein the sense strand comprises no more than 8 2′-fluoro modifications; wherein the antisense strand comprises no more than 6 2′-fluoro modification (claim 1). Claim 3 is interpreted as each strand comprises less than 10 2’-fluoro modified nucleotides. These amounts read on this limitation. If the claim is intended to encompass the combined number of 2’-fluoro modified nucleotides in the sense and antisense strands is less than 10, then the amounts claimed by Zimmermann et al. overlap the instant claims. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05.
Regarding claim 5, Zimmermann et al. teaches that the sense and/or antisense strand contains no more than 2 2’-fluoro modifications (paragraph 0122) which encompasses 0 modifications and thus overlaps the instant claims. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05.
Regarding claim 6 and 10, Zimmermann et al. claims the sense strand and the antisense strand each independently comprise two phosphorothioate linkages at the 5′-terminus (claim 1). It is taught that the RNAi agent has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5’-end of the sense strand and 3’-end of the antisense strand (paragraph 0213).
Regarding claims 7-8, the modification on the nucleotides include deoxy-nucleotides, 2’-O-methyl modified nucleotides, 2’-deoxy modified nucleotides (claim 4). At least two different modifications are typically present on the sense strand and antisense strand (paragraph 0222). As shown in claim 9, over 50% of the antisense strand contains O-Me modifications. As shown in table 1, the sense and antisense strand contain more than 50% O-Me modifications. While the majority of nucleotides are ribonucleotides, each or both strands can also include one or more non-ribonucleotides, e.g. a deoxyribonucleotide and/or a modified nucleotide (paragraph 0139).
Regarding claim 9, Zimmermann et al. claims a sense strand complementary to an antisense strand wherein the antisense strand comprises a region complementary to SEQ ID No: 2. As shown below: instantly claimed SEQ ID No: 12 (Qy) is the same as SEQ ID NO: 2 (Db)
PNG
media_image10.png
122
632
media_image10.png
Greyscale
Zimmermann et al. teaches the antisense polynucleotide sequence is SEQ ID NO: 3 (Db) (paragraph 0158) which is the same as instantly claimed SEQ ID No: 13 (Qy).
PNG
media_image11.png
132
630
media_image11.png
Greyscale
Regarding claims 12-13, the double stranded RNAi agent further comprises a 5’-phosphate or a 5’-phosphate mimic at the 5’ nucleotide of the antisense strand wherein the 5’-phosphate mimic is a 5’-vinyl phosphate (5’-VP) (paragraph 0028-0029).
Regarding claims 17-18, Zimmermann et al. claims the RNAi agent is conjugated to a ligand. Ligands include lipids or an RGD peptide or peptide mimetic. These ligands are a cell or tissue targeting agent (paragraph 0308).
Claims 14-16 are rejected under 35 U.S.C. 103 as being unpatentable over Zimmermann et al. in view of Acevedo et al. and Manoharan et al. as applied to claims 1-3, 5-10, 12-13 and 17-18 above in further view of Schlegel et al. (JACS, 2017).
Applicant Claims
The instant application claims the antisense strand comprises at least one GNA in the seed region. The instant application claims the seed region is at position 5-7 from the 5’-end of the antisense strand. The instant application claim the GNA at position 7 from the 5’-end of the antisense strand. GNA is interpreted as a glycol/glycerol nucleic acid.
Determination of the Scope and Content of the Prior Art
(MPEP §2141.01)
The teachings of Zimmermann et al., Acevedo et al. and Manoharan et al. are set forth above. Zimmermann et al. exemplify sense strand sequences with Cgn e.g. cytidine-glycol nucleic acid (GNA).
Ascertainment of the Difference Between Scope the Prior Art and the Claims
(MPEP §2141.02)
While Zimmermann et al. teaches that the RNAi can contain a GNA, Zimmermann et al. does not teach a GNA in the antisense strand or in the seed region. However, this deficiency is cured by Schlegel et al.
Schlegel et al. is directed to chirality dependent potency enhancement and structural impact of glycol nucleic acid modification on siRNA. With regards to chemical modifications of siRNAs, it has been demonstrated that acyclic, thermally destabilizing modifications have the capability to improve stability and/or enhance RNAi-mediated gene silencing via several different mechanisms. For instance, differentiation between the two strands of an siRNA that is loaded within Argonaute strongly depends on the thermal stability of the terminal regions of the duplex; Ago2 favors loading of the 5′-end of the strand from the duplex end which has a lower thermal stability. It has been shown that thermally destabilizing modifications incorporated at certain positions of an siRNA duplex can lead to an increase in potency by improving strand bias, thereby favoring loading of the desired guide strand into RISC. In addition, the introduction of thermally destabilizing modifications may help facilitate sense strand dissociation during Ago2 loading, thereby increasing the rate of formation of active RISC (page 8537, right column). Figure 1 shows the siRNA with a 2 nucleotide overhang, sense strand (passenger) 21 nucleotide length and guide (antisense strand) 23 nucleotide length. This figure shows various modification that can be included. Loss of potency was observed when GNA was incorporated toward the 3′-end of the guide strand or the 5′-end of the passenger strand, respectively. The loss in silencing activity may have been the result of an improper thermal balancing toward loading of the passenger strand. In contrast, positions 13–15 of the guide and 6–9 of the passenger strand maintained in vitro efficacy comparable to the parent. Substitution of positions 3–9 of the guide strand (within the seed region) and positions 13–19 of the passenger strand were also well tolerated. Of particular interest are nucleotides 6–7 of the guide strand where it has been shown that an isoleucine side chain causes a kink in the guide RNA structure complexed with Ago2 (pages 8541-8542).
Finding of Prima Facie Obviousness Rationale and Motivation
(MPEP §2142-2143)
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Zimmermann et al., Acevedo et al., Manoharan et al. and Schlegel et al. and utilize destabilizing modifications incorporated at certain positions of the RNAi to increase potency by improving strand bias as taught by Schlegel et al. Therefore, one skilled in the art would manipulate not only the position but the type of modification in order to achieve the optimal combination of destabilizing modifications but also stabilizing modifications to ensure delivery of the RNAi. Schlegel et al. teaches siRNA with a sense and antisense strand wherein the sense strand (passenger) is 21 nucleotide in length and the guide (antisense strand) is 23 nucleotide in length and a 2 nucleotide overhang. Schlegel et al. teaches that GNA substitution of positions 3–9 of the guide strand (within the seed region) and positions 13–19 of the passenger strand were also well tolerated. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Zimmermann et al., Acevedo et al., Manoharan et al. and Schlegel et al. and utilize GNA as it is a modification which can be used in iRNA as taught by Schlegel et al. Since Zimmermann et al. suggests modification in the oligonucleotides there is a reasonable expectation of success.
Regarding claims 15-16, Schlegel et al. teaches GNA substitution at positions 3-9 which overlap with the position(s) claimed. Since there are a finite number of positions taught as containing the GNA substitution one skilled in the art would envision the GNA at any of these positions. Therefore, the GNA at position 7 is obvious absent a demonstration of an unexpected effect.
Claim 19 is rejected under 35 U.S.C. 103 as being unpatentable over Zimmermann et al. in view of Acevedo et al. and Manoharan et al. as applied to claims 1-3, 5-10, 12-13 and 17-18 above and in further view of Chen et al. (International Journal of Nanomedicine, 2011).
Applicant Claims
The instant application claims the RGD peptide is H-Gly-Arg-Gly-Asp-Ser-Pro-Lys-Cys-OH (SEQ ID NO: 14) or Cyclo(-Arg-Gly-Asp-D-Phe- Cys).
Determination of the Scope and Content of the Prior Art
(MPEP §2141.01)
The teachings of Zimmermann et al., Acevedo et al. and Manoharan et al. are set forth above. Zimmermann et al. teaches a RGD peptide can be the ligand. Significant sites of TTR expression include the retina (paragraph 0006, 0129, 0513).
Ascertainment of the Difference Between Scope the Prior Art and the Claims
(MPEP §2141.02)
While Zimmermann et al. suggests the use of a RGD peptide, Zimmermann et al. does not expressly teach an RGD peptide as claimed. However, this deficiency is cured by Chen et al.
Chen et al. is directed to novel RGD-lipid conjugate-modified liposomes for enhancing siRNA delivery in human retinal pigment epithelial cells. The RGD peptide taught (sequence: H-Gly-Arg-Gly-Asp-Ser-Pro-Lys-Cys-OH) (page 2568). In order to accumulate more liposomal siRNA in the retinal pigment epithelial cells, with the goal of producing greater and more selective therapeutic activity, use of active targeted liposomes with the RGD peptide has been suggested. This involves coupling RGD moieties capable of recognizing and binding to the integrin receptor of the retinal pigment epithelial cells, (page 2576).
Finding of Prima Facie Obviousness Rationale and Motivation
(MPEP §2142-2143)
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Zimmermann et al., Acevedo et al., Manoharan et al. and Chen et al. and utilize the RGD peptide: H-Gly-Arg-Gly-Asp-Ser-Pro-Lys-Cys-OH as a targeting ligand. One skilled in the art would have been motivated to utilize this particular peptide as it has been shown to target retinal pigment epithelial cells. Since Zimmermann et al. teaches the use of an RGD ligand and to inhibit expression of TTR in the retina and Chen et al. teaches the use of this RGD peptide for delivery in human retinal pigment epithelial cells, one skilled in the art would have a reasonable expectation of success in utilizing this particular peptide.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-3, 6-10 and 17-18 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-75 of U.S. Patent No. 10208307 (cited on PTO Form 1449) in view of Acevedo et al. and Manoharan et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
The instant application claims a double stranded RNAi agent comprising a sense strand complementary to an antisense strand, wherein the antisense strand comprises a region complementary to part of an mRNA encoding transthyretin (TTR), wherein each strand independently has 14 to 30 nucleotides; wherein the double stranded RNAi agent comprises one or more lipophilic monomer
The instant application claims a double stranded RNAi agent for inhibiting expression of transthyretin (TTR) in a cell, wherein the double stranded RNAi agent comprises a sense strand and an antisense strand forming a double stranded region; wherein the sense strand comprises the nucleotide sequence 5’ – UGGGAUUUCAUGUAACCAAGA – 3’ (SEQ ID NO: 12) and the antisense strand comprises the nucleotide sequence 5’- UCUUGGUUACAUGAAAUCCCAUC -3’ (SEQ ID NO: 13); wherein the double stranded RNAi agent comprises one or more lipophilic monomer.
Lipophilic monomers claimed include:
PNG
media_image4.png
316
354
media_image4.png
Greyscale
Patent ‘307 claims a double stranded ribonucleic acid (RNAi) agent that inhibits expression of transthyretin (TTR) in a cell, comprising a sense strand differing by no more than 4 modified nucleotides from the nucleotide sequence of 5′-usgsggauUfuCfAfUfguaaccaaga-3′ (SEQ ID NO: 10) and an antisense strand differing by no more than 4 modified nucleotides from the nucleotide sequence 5′-usCfsuugGfuuAfcaugAfaAfucccasusc-3′ (SEQ ID NO: 7), wherein a, c, g, and u are 2′-O-methyl (2′-OMe) A, C, G, and U; Af, Cf, Gf, and Uf are 2′-fluoro A, C, G, and U; and s is a phosphorothioate linkage. SEQ ID NO: 10 is the same as instantly claimed SEQ ID NO 11/12 whereas SEQ ID NO: 7 is the same as instantly claimed SEQ ID No: 13. As claimed the RNAi is conjugated to the ligand as shown below:
PNG
media_image7.png
273
380
media_image7.png
Greyscale
While Patent ‘307 claims a double stranded RNAI targeting the same TTR with the same sequence and a ligand conjugated to the sense strand with a linker which is similar to the lipophilic monomer claimed, Patent ‘307 does not claim the exact same lipophilic monomer.
However, this deficiency is cured by Acevedo et al. and Manoharan et al.
Acevedo et al. is directed to pyrrolidine-containing monomers and oligomers.
PNG
media_image5.png
298
644
media_image5.png
Greyscale
which reads on the instant claims when n is 0, Q is G3 which is C(O) and Z is L1 which is an alkyl having 1 to about 20 carbon atoms. X and Y can be H or oligonucleotides (columns 4-5, lines 8-67, 1-67; claim 1). The compounds are capable of hybridizing to nucleic acids of interest in the etiology of disease (column 6, lines 13-24). Exemplified is incorporation in oligonucleotides.
Manoharan et al. is directed to modified iRNA agents. Taught are iRNA agents which include a monomer in which the ribose moiety has been replaced by a moiety other than ribose. The inclusion of such a monomer can allow for modulation of a property of the iRNA agent into which it is incorporated. The non-ribose moiety can also serve as a point to which a ligand or other entity, e.g. a carbohydrate can be directly or indirectly tethered (paragraph 0002). Taught is a ribose replacement modification subunit (RRMS) can alter the lipophilicity of the iRNA agent (paragraph 007). Subunits taught include:
PNG
media_image6.png
212
584
media_image6.png
Greyscale
wherein X can be a N(CO)R7 wherein R7 is a ligand such as a C1-C20 alkyl, Y can be absent, Z is CR11R12 wherein R11 and R12 can be H. R5 and R6 can be H. R1, R2, R3 and R4 can be H and (CH2)nORa(or b) wherein n can be 1, Ra/b are phosphates which are connected to a strand, OH or results in a triphosphate (paragraphs 0008-0025; claims; Fig. 3). Deoxy modifications include hydrogen, fluoro, protected amino, etc. (paragraph 0289).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘307, Acevedo et al. and Manoharan et al. and incorporate a ribose replacement modification subunit such as that taught in Acevedo et al. into the RNAi agent of Patent ‘307. One skilled in the art would have been motivated to incorporate a ribose replacement modification subunit in order to manipulate the properties of the RNAi and/or to tether a ligand to the oligonucleotide as taught by Manoharan et al. One skilled in the art would have a reasonable expectation of success as the ribose replacement modification submits taught by Acevedo et al. and Manoharan et al. are pyrrolidines and Patent ‘307 claims carriers for the ligand can be a cyclic group such as pyrrolidinyl. Furthermore, Patent ‘307 claims an RNAi agent and Manoharan et al. teaches the ribose replacement modification submits can be incorporated in RNAi agents. Furthermore, Patent ‘307 claims the RNAi conjugated to a ligand via the following molecule:
PNG
media_image7.png
273
380
media_image7.png
Greyscale
this molecule is of the same structure (albeit a different alkyl length C10 in Patent ‘307 vs C15 in instant claims) than instantly claimed
PNG
media_image8.png
164
460
media_image8.png
Greyscale
suggesting a reasonable expectation of success in using the pyrrolidine of Acevedo et al. and/or Manoharan et al.
Regarding the claimed lipophilic monomer, both Acevedo et al. and Manoharan et al. suggest that the monomer is a five-membered nitrogen containing ring, e.g. a pyrrolidine. Both Acevedo et al. and Manoharan et al. suggest incorporation in an oligonucleotide via an O or CH2O at the same positions in the pyrrolidone of the instantly claimed monomers. Both Acevedo et al. and Manoharan et al. teach that the group attached to the N of the pyrrolidine can be C(O)-alkyl wherein the alkyl is from 1 to 20 carbons. This overlaps the length of the alkyl chain in the instantly claimed lipophilic monomers. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05. It would have been obvious to one of ordinary skill in the art to try any of the specifically taught substituents as a person with ordinary skill has good reason to pursue known options within his or her technical grasp. Note: MPEP 2141 KSR International CO. v. Teleflex Inc. 82 USPQ 2d 1385 (Supreme Court 2007). Manoharan et al. expressly teaches that the ribose replacement modification submits can be used to modify the properties of the RNAi agent and this includes the lipophilicity of the compound as well as serving as a tether to ligands. Therefore, one skilled in the art would manipulate the length of the alkyl chain, which would be expected to modify the lipophilicity of the compound and the substituents attached depending on whether a ligand would be required to be incorporated into the RNAi agent.
Regarding claim 3, the claimed sequence comprises less than 10 2’-fluoro modifications.
Regarding claim 6 and 10, the claimed sense and antisense strand has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5’-end of the sense strand and 3’-end of the antisense.
Regarding claims 7, the claimed sense and antisense strand contain more than 50% O-Me modifications.
Regarding claim 8, the claimed sequence contain 4 fluoro modified nucleotides which as recognized by Manoharan et al. is a deoxy modified nucleotide.
Regarding claims 17-18, Patent ‘307 claims the RNAi agent is conjugated to a ligand. Ligands claimed is a carbohydrate.
Claims 1-3, 6-10 and 17-18 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-28 of U.S. Patent No. 10683501 (cited on PTO Form 1449) in view of Acevedo et al. and Manoharan et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
The instant claims are set forth above.
Patent ‘501 claims a method of prophylactically treating a human subject at risk for developing a TTR-associated disease, comprising administering to the subject a prophylactically effective amount of a double stranded ribonucleic acid (RNAi) agent, wherein the double stranded RNAi agent comprises a sense strand differing by no more than 4 modified nucleotides from the nucleotide sequence of 5′-usgsggauUfuCfAfUfguaaccaaga-3′ (SEQ ID NO: 10) and an antisense strand differing by no more than 4 modified nucleotides from the nucleotide sequence 5′-usCfsuugGfuuAfcaugAfaAfucccasusc-3′ (SEQ ID NO: 7), wherein a, c, g, and u are 2′-O-methyl (2′-OMe) A, C, G, and U; Af, Cf, Gf, and Uf are 2′-fluoro A, C, G, and U; and s is a phosphorothioate linkage, thereby prophylactically treating the subject. SEQ ID NO: 10 is the same as instantly claimed SEQ ID NO 11/12 whereas SEQ ID NO: 7 is the same as instantly claimed SEQ ID No: 13. The double stranded RNAi agent further comprises as least one ligand. As claimed the RNAi is conjugated to the ligand as shown below:
PNG
media_image7.png
273
380
media_image7.png
Greyscale
While Patent ‘501 claims a double stranded RNAI targeting the same TTR with the same sequence and a ligand conjugated to the sense strand with a linker which is similar to the lipophilic monomer claimed, Patent ‘501 does not claim the exact same lipophilic monomer.
However, this deficiency is cured by Acevedo et al. and Manoharan et al.
The teachings of Acevedo et al. and Manoharan et al. are set forth above.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘501, Acevedo et al. and Manoharan et al. and incorporate a ribose replacement modification subunit such as that taught in Acevedo et al. into the RNAi agent of Patent ‘501. One skilled in the art would have been motivated to incorporate a ribose replacement modification subunit in order to manipulate the properties of the RNAi and/or to tether a ligand to the oligonucleotide as taught by Manoharan et al. One skilled in the art would have a reasonable expectation of success as the ribose replacement modification submits taught by Acevedo et al. and Manoharan et al. are pyrrolidines and Patent ‘501 claims carriers for the ligand can be a cyclic group such as pyrrolidinyl. Furthermore, Patent ‘501 claims an RNAi agent and Manoharan et al. teaches the ribose replacement modification submits can be incorporated in RNAi agents. Furthermore, Patent ‘501 claims the RNAi conjugated to a ligand via the following molecule:
PNG
media_image7.png
273
380
media_image7.png
Greyscale
this molecule is of the same structure (albeit a different alkyl length C10 in Patent ‘501 vs C15 in instant claims) than instantly claimed
PNG
media_image8.png
164
460
media_image8.png
Greyscale
suggesting a reasonable expectation of success in using the pyrrolidine of Acevedo et al. and/or Manoharan et al.
Regarding the claimed lipophilic monomer, both Acevedo et al. and Manoharan et al. suggest that the monomer is a five-membered nitrogen containing ring, e.g. a pyrrolidine. Both Acevedo et al. and Manoharan et al. suggest incorporation in an oligonucleotide via an O or CH2O at the same positions in the pyrrolidone of the instantly claimed monomers. Both Acevedo et al. and Manoharan et al. teach that the group attached to the N of the pyrrolidine can be C(O)-alkyl wherein the alkyl is from 1 to 20 carbons. This overlaps the length of the alkyl chain in the instantly claimed lipophilic monomers. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05. It would have been obvious to one of ordinary skill in the art to try any of the specifically taught substituents as a person with ordinary skill has good reason to pursue known options within his or her technical grasp. Note: MPEP 2141 KSR International CO. v. Teleflex Inc. 82 USPQ 2d 1385 (Supreme Court 2007). Manoharan et al. expressly teaches that the ribose replacement modification submits can be used to modify the properties of the RNAi agent and this includes the lipophilicity of the compound as well as serving as a tether to ligands. Therefore, one skilled in the art would manipulate the length of the alkyl chain, which would be expected to modify the lipophilicity of the compound and the substituents attached depending on whether a ligand would be required to be incorporated into the RNAi agent.
Regarding claim 3, the claimed sequence comprises less than 10 2’-fluoro modifications.
Regarding claim 6 and 10, the claimed sense and antisense strand has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5’-end of the sense strand and 3’-end of the antisense.
Regarding claims 7, the claimed sense and antisense strand contain more than 50% O-Me modifications.
Regarding claim 8, the claimed sequence contain 4 fluoro modified nucleotides which as recognized by Manoharan et al. is a deoxy modified nucleotide.
Regarding claims 17-18, Patent ‘501 claims the RNAi agent is conjugated to a ligand. Ligands claimed is a carbohydrate.
Claims 1-3, 6-10 and 17-18 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-28 of U.S. Patent No. 11286486 in view of Acevedo et al. and Manoharan et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
The instant claims are set forth above.
Patent ‘486 claims method of treating a subject suffering from a TTR-associated disease, comprising administering to the subject a therapeutically effective amount of a double stranded RNAi agent, wherein the double stranded RNAi agent comprises a sense strand differing by no more than 4 modified nucleotides from the nucleotide sequence of 5′-usgsggauUfuCfAfUfguaaccaaga -3′ (SEQ ID NO: 10) and an antisense strand differing by no more than 4 modified nucleotides from the nucleotide sequence 5′-usCfsuugGfuuAfcaugAfaAfucccasusc-3′ (SEQ ID NO: 7), wherein a, c, g, and u are 2′-O-methyl (2′-OMe) A, C, G, and U; Af, Cf, Gf, and Uf are 2′-fluoro A, C, G, and U; and s is a phosphorothioate linkage, thereby treating the subject suffering from the TTR-associated disease. SEQ ID NO: 10 is the same as instantly claimed SEQ ID NO 11/12 whereas SEQ ID NO: 7 is the same as instantly claimed SEQ ID No: 13. The double stranded RNAi agent further comprises as least one ligand. As claimed the RNAi is conjugated to the ligand as shown below:
PNG
media_image7.png
273
380
media_image7.png
Greyscale
While Patent ‘486 claims a double stranded RNAI targeting the same TTR with the same sequence and a ligand conjugated to the sense strand with a linker which is similar to the lipophilic monomer claimed, Patent ‘486 does not claim the exact same lipophilic monomer.
However, this deficiency is cured by Acevedo et al. and Manoharan et al.
The teachings of Acevedo et al. and Manoharan et al. are set forth above.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘486, Acevedo et al. and Manoharan et al. and incorporate a ribose replacement modification subunit such as that taught in Acevedo et al. into the RNAi agent of Patent ‘486. One skilled in the art would have been motivated to incorporate a ribose replacement modification subunit in order to manipulate the properties of the RNAi and/or to tether a ligand to the oligonucleotide as taught by Manoharan et al. One skilled in the art would have a reasonable expectation of success as the ribose replacement modification submits taught by Acevedo et al. and Manoharan et al. are pyrrolidines and Patent ‘486 claims carriers for the ligand can be a cyclic group such as pyrrolidinyl. Furthermore, Patent ‘486 claims an RNAi agent and Manoharan et al. teaches the ribose replacement modification submits can be incorporated in RNAi agents. Furthermore, Patent ‘486 claims the RNAi conjugated to a ligand via the following molecule:
PNG
media_image7.png
273
380
media_image7.png
Greyscale
this molecule is of the same structure (albeit a different alkyl length C10 in Patent ‘486 vs C15 in instant claims) than instantly claimed
PNG
media_image8.png
164
460
media_image8.png
Greyscale
suggesting a reasonable expectation of success in using the pyrrolidine of Acevedo et al. and/or Manoharan et al.
Regarding the claimed lipophilic monomer, both Acevedo et al. and Manoharan et al. suggest that the monomer is a five-membered nitrogen containing ring, e.g. a pyrrolidine. Both Acevedo et al. and Manoharan et al. suggest incorporation in an oligonucleotide via an O or CH2O at the same positions in the pyrrolidone of the instantly claimed monomers. Both Acevedo et al. and Manoharan et al. teach that the group attached to the N of the pyrrolidine can be C(O)-alkyl wherein the alkyl is from 1 to 20 carbons. This overlaps the length of the alkyl chain in the instantly claimed lipophilic monomers. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05. It would have been obvious to one of ordinary skill in the art to try any of the specifically taught substituents as a person with ordinary skill has good reason to pursue known options within his or her technical grasp. Note: MPEP 2141 KSR International CO. v. Teleflex Inc. 82 USPQ 2d 1385 (Supreme Court 2007). Manoharan et al. expressly teaches that the ribose replacement modification submits can be used to modify the properties of the RNAi agent and this includes the lipophilicity of the compound as well as serving as a tether to ligands. Therefore, one skilled in the art would manipulate the length of the alkyl chain, which would be expected to modify the lipophilicity of the compound and the substituents attached depending on whether a ligand would be required to be incorporated into the RNAi agent.
Regarding claim 3, the claimed sequence comprises less than 10 2’-fluoro modifications.
Regarding claim 6 and 10, the claimed sense and antisense strand has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5’-end of the sense strand and 3’-end of the antisense.
Regarding claims 7, the claimed sense and antisense strand contain more than 50% O-Me modifications.
Regarding claim 8, the claimed sequence contain 4 fluoro modified nucleotides which as recognized by Manoharan et al. is a deoxy modified nucleotide.
Regarding claims 17-18, Patent ‘486 claims the RNAi agent is conjugated to a ligand. Ligands claimed is a carbohydrate.
Claims 1-3, 6-10 and 17-18 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-44 of U.S. Patent No. 12049628 in view of Acevedo et al. and Manoharan et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
The instant claims are set forth above.
Patent ‘628 claims alt of a double stranded ribonucleic acid (RNAi) agent for inhibiting expression of transthyretin (TTR), comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5′-usgsggauUfuCfAfUfguaaccaaga-3′ of SEQ ID NO:10 and the antisense strand comprises the nucleotide sequence 5′-usCfsuugGfuuAfcaugAfaAfucccasusc-3′ of SEQ ID NO:7, wherein a, c, g, and u are 2′-O-methyl (2′-OMe) A, C, G, and U, respectively; Af, Cf, Gf, and Uf are 2′-fluoro A, C, G, and U, respectively; s is a phosphorothioate linkage; and wherein the sense strand of the double stranded RNAi agent is conjugated to a ligand. SEQ ID NO: 10 is the same as instantly claimed SEQ ID NO 11/12 whereas SEQ ID NO: 7 is the same as instantly claimed SEQ ID No: 13. As claimed the RNAi is conjugated to the ligand as shown below:
PNG
media_image7.png
273
380
media_image7.png
Greyscale
While Patent ‘628 claims a double stranded RNAI targeting the same TTR with the same sequence and a ligand conjugated to the sense strand with a linker which is similar to the lipophilic monomer claimed, Patent ‘628 does not claim the exact same lipophilic monomer.
However, this deficiency is cured by Acevedo et al. and Manoharan et al.
The teachings of Acevedo et al. and Manoharan et al. are set forth above.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘628, Acevedo et al. and Manoharan et al. and incorporate a ribose replacement modification subunit such as that taught in Acevedo et al. into the RNAi agent of Patent ‘628. One skilled in the art would have been motivated to incorporate a ribose replacement modification subunit in order to manipulate the properties of the RNAi and/or to tether a ligand to the oligonucleotide as taught by Manoharan et al. One skilled in the art would have a reasonable expectation of success as the ribose replacement modification submits taught by Acevedo et al. and Manoharan et al. are pyrrolidines and Patent ‘628 claims carriers for the ligand can be a cyclic group such as pyrrolidinyl. Furthermore, Patent ‘628 claims an RNAi agent and Manoharan et al. teaches the ribose replacement modification submits can be incorporated in RNAi agents. Furthermore, Patent ‘628 claims the RNAi conjugated to a ligand via the following molecule:
PNG
media_image7.png
273
380
media_image7.png
Greyscale
this molecule is of the same structure (albeit a different alkyl length C10 in Patent ‘628 vs C15 in instant claims) than instantly claimed
PNG
media_image8.png
164
460
media_image8.png
Greyscale
suggesting a reasonable expectation of success in using the pyrrolidine of Acevedo et al. and/or Manoharan et al.
Regarding the claimed lipophilic monomer, both Acevedo et al. and Manoharan et al. suggest that the monomer is a five-membered nitrogen containing ring, e.g. a pyrrolidine. Both Acevedo et al. and Manoharan et al. suggest incorporation in an oligonucleotide via an O or CH2O at the same positions in the pyrrolidone of the instantly claimed monomers. Both Acevedo et al. and Manoharan et al. teach that the group attached to the N of the pyrrolidine can be C(O)-alkyl wherein the alkyl is from 1 to 20 carbons. This overlaps the length of the alkyl chain in the instantly claimed lipophilic monomers. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05. It would have been obvious to one of ordinary skill in the art to try any of the specifically taught substituents as a person with ordinary skill has good reason to pursue known options within his or her technical grasp. Note: MPEP 2141 KSR International CO. v. Teleflex Inc. 82 USPQ 2d 1385 (Supreme Court 2007). Manoharan et al. expressly teaches that the ribose replacement modification submits can be used to modify the properties of the RNAi agent and this includes the lipophilicity of the compound as well as serving as a tether to ligands. Therefore, one skilled in the art would manipulate the length of the alkyl chain, which would be expected to modify the lipophilicity of the compound and the substituents attached depending on whether a ligand would be required to be incorporated into the RNAi agent.
Regarding claim 3, the claimed sequence comprises less than 10 2’-fluoro modifications.
Regarding claim 6 and 10, the claimed sense and antisense strand has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5’-end of the sense strand and 3’-end of the antisense.
Regarding claims 7, the claimed sense and antisense strand contain more than 50% O-Me modifications.
Regarding claim 8, the claimed sequence contain 4 fluoro modified nucleotides which as recognized by Manoharan et al. is a deoxy modified nucleotide.
Regarding claims 17-18, Patent ‘628 claims the RNAi agent is conjugated to a ligand. Ligands claimed is a carbohydrate.
Claims 1, 3, 6-8, 10 and 17-18 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-30 of U.S. Patent No. 11959081 in view of Acevedo et al. and Manoharan et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
The instant claims are set forth above.
Patent ‘081 claims a double stranded ribonucleic acid (dsRNA) agent, or salt thereof, for inhibiting expression of transthyretin (TTR) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the nucleotide sequence of the sense strand differs by no more than 4 bases from the nucleotide sequence 5′-csasagagUfaUfUfCfcauuuuuacu-3′ of SEQ ID NO: 21 and the nucleotide sequence of the antisense strand differs by no more than 4 bases from the nucleotide sequence 5′-asGfsuaaAfaauggaaUfaCfucuugsgsu-3′ of SEQ ID NO: 22, wherein a, c, g, and u are 2′-O-methyl (2′-OMe) A, C, G, and U, respectively; Af, Cf, Gf and Uf are 2′-fluoro A, C, G and U, respectively; s is a phosphorothioate linkage, and wherein at least one strand is conjugated to a ligand. As claimed the RNAi is conjugated to the ligand as shown below:
PNG
media_image7.png
273
380
media_image7.png
Greyscale
While Patent ‘081 claims a double stranded RNA targeting the same TTR with the same sequence and a ligand conjugated to the sense strand with a linker which is similar to the lipophilic monomer claimed, Patent ‘081 does not claim the exact same lipophilic monomer.
However, this deficiency is cured by Acevedo et al. and Manoharan et al.
The teachings of Acevedo et al. and Manoharan et al. are set forth above.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘081, Acevedo et al. and Manoharan et al. and incorporate a ribose replacement modification subunit such as that taught in Acevedo et al. into the dsRNA agent of Patent ‘081. One skilled in the art would have been motivated to incorporate a ribose replacement modification subunit in order to manipulate the properties of the dsRNA and/or to tether a ligand to the oligonucleotide as taught by Manoharan et al. One skilled in the art would have a reasonable expectation of success as the ribose replacement modification submits taught by Acevedo et al. and Manoharan et al. are pyrrolidines and Patent ‘081 claims carriers for the ligand can be a cyclic group such as pyrrolidinyl. Furthermore, Patent ‘081 claims the dsRNA conjugated to a ligand via the following molecule:
PNG
media_image7.png
273
380
media_image7.png
Greyscale
this molecule is of the same structure (albeit a different alkyl length C10 in Patent ‘081 vs C15 in instant claims) than instantly claimed
PNG
media_image8.png
164
460
media_image8.png
Greyscale
suggesting a reasonable expectation of success in using the pyrrolidine of Acevedo et al. and/or Manoharan et al.
Regarding the claimed lipophilic monomer, both Acevedo et al. and Manoharan et al. suggest that the monomer is a five-membered nitrogen containing ring, e.g. a pyrrolidine. Both Acevedo et al. and Manoharan et al. suggest incorporation in an oligonucleotide via an O or CH2O at the same positions in the pyrrolidone of the instantly claimed monomers. Both Acevedo et al. and Manoharan et al. teach that the group attached to the N of the pyrrolidine can be C(O)-alkyl wherein the alkyl is from 1 to 20 carbons. This overlaps the length of the alkyl chain in the instantly claimed lipophilic monomers. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05. It would have been obvious to one of ordinary skill in the art to try any of the specifically taught substituents as a person with ordinary skill has good reason to pursue known options within his or her technical grasp. Note: MPEP 2141 KSR International CO. v. Teleflex Inc. 82 USPQ 2d 1385 (Supreme Court 2007). Manoharan et al. expressly teaches that the ribose replacement modification submits can be used to modify the properties of the RNAi agent and this includes the lipophilicity of the compound as well as serving as a tether to ligands. Therefore, one skilled in the art would manipulate the length of the alkyl chain, which would be expected to modify the lipophilicity of the compound and the substituents attached depending on whether a ligand would be required to be incorporated into the RNAi agent.
Regarding claim 3, the claimed sequence comprises less than 10 2’-fluoro modifications.
Regarding claim 6 and 10, the claimed sense and antisense strand has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5’-end of the sense strand and 3’-end of the antisense.
Regarding claims 7, the claimed sense and antisense strand contain more than 50% O-Me modifications.
Regarding claim 8, the claimed sequence contain 4 fluoro modified nucleotides which as recognized by Manoharan et al. is a deoxy modified nucleotide.
Regarding claims 17-18, Patent ‘081 claims the RNAi agent is conjugated to a ligand. Ligands claimed is a carbohydrate.
Claims 1-3, 6-10 and 17-18 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-36 of U.S. Patent No. 9399775 (cited on PTO Form 1449) in view of Acevedo et al. and Manoharan et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
The instant claims are set forth above.
Patent ‘775 claims a double stranded RNAi agent comprising a sense strand complementary to an antisense strand, wherein said antisense strand comprises a sequence that is complementary to nucleotides 504 to 526 of the transthyretin (TTR) gene (SEQ ID NO:1), wherein the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length, wherein said double stranded RNAi agent is represented by formula (III): sense: 5′ n.sub.p -N.sub.a -(X X X).sub.i-N.sub.b -Y Y Y -N.sub.b -(Z Z Z).sub.j- N.sub.a-n.sub.q 3′ antisense: 3′ n.sub.p′-N.sub.a′-(X′X′X′).sub.k-N.sub.b′-Y′Y′Y′-N.sub.b′- (Z′Z′Z′).sub.l-N.sub.a′- n.sub.q′ 5′ wherein: j=1; and i, k, and l are 0; p′ is 2; p, q, and q′ are 0; each N.sub.a and N.sub.a′ independently represents an oligonucleotide sequence comprising 2-10 nucleotides which are modified nucleotides; each N.sub.b and N.sub.b′ independently represents an oligonucleotide sequence comprising 0-7 nucleotides which are modified nucleotides; n.sub.p′ represents an overhang nucleotide; YYY, ZZZ, and Y′Y′Y′, each independently represent one motif of three identical modifications on three consecutive nucleotides, wherein the Y nucleotides contain a 2′-fluoro modification, the Y′ nucleotides contain a 2′-O-methyl modification, and the Z nucleotides contain a 2′-O-methyl modification; and wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker. As claimed the RNAi is conjugated to the ligand as shown below:
PNG
media_image7.png
273
380
media_image7.png
Greyscale
While Patent ‘775 claims a double stranded RNA targeting the same TTR with the same sequence and a ligand conjugated to the sense strand with a linker which is similar to the lipophilic monomer claimed, Patent ‘775 does not claim the exact same lipophilic monomer.
However, this deficiency is cured by Acevedo et al. and Manoharan et al.
The teachings of Acevedo et al. and Manoharan et al. are set forth above.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘755, Acevedo et al. and Manoharan et al. and incorporate a ribose replacement modification subunit such as that taught in Acevedo et al. into the dsRNA agent of Patent ‘775. One skilled in the art would have been motivated to incorporate a ribose replacement modification subunit in order to manipulate the properties of the dsRNA and/or to tether a ligand to the oligonucleotide as taught by Manoharan et al. One skilled in the art would have a reasonable expectation of success as the ribose replacement modification submits taught by Acevedo et al. and Manoharan et al. are pyrrolidines and Patent ‘775 claims carriers for the ligand can be a cyclic group such as pyrrolidinyl. Furthermore, Patent ‘775 claims the dsRNA conjugated to a ligand via the following molecule:
PNG
media_image7.png
273
380
media_image7.png
Greyscale
this molecule is of the same structure (albeit a different alkyl length C10 in Patent ‘775 vs C15 in instant claims) than instantly claimed
PNG
media_image8.png
164
460
media_image8.png
Greyscale
suggesting a reasonable expectation of success in using the pyrrolidine of Acevedo et al. and/or Manoharan et al.
Regarding the claimed lipophilic monomer, both Acevedo et al. and Manoharan et al. suggest that the monomer is a five-membered nitrogen containing ring, e.g. a pyrrolidine. Both Acevedo et al. and Manoharan et al. suggest incorporation in an oligonucleotide via an O or CH2O at the same positions in the pyrrolidone of the instantly claimed monomers. Both Acevedo et al. and Manoharan et al. teach that the group attached to the N of the pyrrolidine can be C(O)-alkyl wherein the alkyl is from 1 to 20 carbons. This overlaps the length of the alkyl chain in the instantly claimed lipophilic monomers. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05. It would have been obvious to one of ordinary skill in the art to try any of the specifically taught substituents as a person with ordinary skill has good reason to pursue known options within his or her technical grasp. Note: MPEP 2141 KSR International CO. v. Teleflex Inc. 82 USPQ 2d 1385 (Supreme Court 2007). Manoharan et al. expressly teaches that the ribose replacement modification submits can be used to modify the properties of the RNAi agent and this includes the lipophilicity of the compound as well as serving as a tether to ligands. Therefore, one skilled in the art would manipulate the length of the alkyl chain, which would be expected to modify the lipophilicity of the compound and the substituents attached depending on whether a ligand would be required to be incorporated into the RNAi agent.
Regarding the sequence of claim 2 and 9, Patent ‘775 claims the antisense strand is complementary to nucleotides 504 to 526 of SEQ ID No: 1. As shown below Instant SEQ ID NO: 13 (Qy) is complementary to 504 to 526 of SEQ ID NO: 1 (Db)
PNG
media_image12.png
188
654
media_image12.png
Greyscale
Regarding claim 3, the claimed sequence comprises less than 10 2’-fluoro modifications.
Regarding claim 6 and 10, the claimed sense and antisense strand has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5’-end of the sense strand and 3’-end of the antisense.
Regarding claims 7, the claimed sense and antisense strand contain more than 50% O-Me modifications.
Regarding claim 8, the claimed sequence contain 4 fluoro modified nucleotides which as recognized by Manoharan et al. is a deoxy modified nucleotide.
Regarding claims 17-18, Patent ‘775 claims the RNAi agent is conjugated to a ligand. Ligands claimed is a carbohydrate.
Claims 12-13 are rejected on the ground of nonstatutory double patenting as being unpatentable over the claims of U.S. Patent No. 10208307, 10683501, 11286486, 12049628, 9399775 or 11959081 in view of Zimmermann et al. (USPGPUB No. 2017029817) in view of Acevedo et al. and Manoharan et al. as applied to the claims above and in further view of Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
The instant application claims the double stranded RNAi agent further comprising a phosphate or phosphate mimic at the 5'-end of the antisense strand and wherein the phosphate mimic is a 5'-vinyl phosphonate (VP).
The teachings of US Patent No. 10208307, 10683501, 11286486, 12049628, 9399775 and 11959081 are set forth above. US Patent No. 10208307, 10683501, 11286486, 12049628, 9399775 and 11959081 do not claim a 5’-VP. However, this deficiency is cured by Zimmermann et al.
Zimmermann et al. is directed to transthyretin (TTR) iRNA compositions and methods of use thereof for treating TTR-associated diseases. Claimed is a double stranded ribonucleic acid (RNAi) agent for inhibiting expression of transthyretin (TTR) in a cell, wherein said RNAi agent comprises a sense strand complementary to an antisense strand, wherein said antisense strand comprises a region complementary to SEQ ID NO:2, wherein each strand is about 14 to about 30 nucleotides in length,
wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides,
wherein the sense strand comprises no more than 8 2′-fluoro modifications;
wherein the antisense strand comprises no more than 6 2′-fluoro modifications;
wherein the sense strand and the antisense strand each independently comprise two phosphorothioate linkages at the 5′-terminus; and wherein the sense strand is conjugated to at least one ligand (claim 1). The double stranded RNAi agent further comprises a 5’-phosphate or a 5’-phosphate mimic at the 5’ nucleotide of the antisense strand wherein the 5’-phosphate mimic is a 5’-vinyl phosphate (5’-VP) (paragraph 0028-0029).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of US Patent No. 10208307, 10683501, 11286486, 12049628, 9399775 or 11959081, Acevedo et al., Manoharan et al. and Zimmermann et al. and utilize a 5’-VP. One skilled in the art would have been motivated to utilize this type of modification as the US Patents and Zimmermann et al. are both directed to dsRNA agents which target TTR. Therefore, all of the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions and the combination would have yielded predictable results to one of ordinary skill in the art at the time of the invention. Note: MPEP 2143 KSR International Co. v. Teleflex Inc., 550 US 398, 82 USPQ 2d 1385 (2007).
Claims 14-16 rejected on the ground of nonstatutory double patenting as being unpatentable over the claims of U.S. Patent No. 10208307, 10683501, 11286486, 12049628, 9399775 or 11959081 in view of Acevedo et al. and Manoharan et al. as applied to the claims above and in further view of Schlegel et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
The instant application claims the antisense comprises at least one GNA in the seed region and wherein the seed region is at position 5-7 from the 5'-end of the antisense strand and wherein the antisense comprises at a GNA at position 7 from the 5'-end of the antisense strand.
The teachings of US Patent No. 10208307, 10683501, 11286486, 12049628, 9399775 and 11959081 are set forth above.
Patent 10208307, 10683501, 11286486, 12049628, 9399775 or 11959081 do not claim a GNA. However, this deficiency is cured by Schlegel et al.
Schlegel et al. is directed to chirality dependent potency enhancement and structural impact of glycol nucleic acid modification on siRNA. With regards to chemical modifications of siRNAs, it has been demonstrated that acyclic, thermally destabilizing modifications have the capability to improve stability and/or enhance RNAi-mediated gene silencing via several different mechanisms. For instance, differentiation between the two strands of an siRNA that is loaded within Argonaute strongly depends on the thermal stability of the terminal regions of the duplex; Ago2 favors loading of the 5′-end of the strand from the duplex end which has a lower thermal stability. It has been shown that thermally destabilizing modifications incorporated at certain positions of an siRNA duplex can lead to an increase in potency by improving strand bias, thereby favoring loading of the desired guide strand into RISC. In addition, the introduction of thermally destabilizing modifications may help facilitate sense strand dissociation during Ago2 loading, thereby increasing the rate of formation of active RISC (page 8537, right column). Figure 1 shows the siRNA with a 2 nucleotide overhang, sense strand (passenger) 21 nucleotide length and guide (antisense strand) 23 nucleotide length. This figure shows various modification that can be included. Loss of potency was observed when GNA was incorporated toward the 3′-end of the guide strand or the 5′-end of the passenger strand, respectively. The loss in silencing activity may have been the result of an improper thermal balancing toward loading of the passenger strand. In contrast, positions 13–15 of the guide and 6–9 of the passenger strand maintained in vitro efficacy comparable to the parent. Substitution of positions 3–9 of the guide strand (within the seed region) and positions 13–19 of the passenger strand were also well tolerated. Of particular interest are nucleotides 6–7 of the guide strand where it has been shown that an isoleucine side chain causes a kink in the guide RNA structure complexed with Ago2 (pages 8541-8542).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent 10208307, 10683501, 11286486, 12049628, 9399775 or 11959081, Acevedo et al., Manoharan et al. and Schlegel et al. and utilize destabilizing modifications incorporated at certain positions of the RNAi to increase potency by improving strand bias as taught by Schlegel et al. Therefore, one skilled in the art would manipulate not only the position but the type of modification in order to achieve the optimal combination of destabilizing modifications but also stabilizing modifications to ensure delivery of the RNAi. Schlegel et al. teaches siRNA with a sense and antisense strand wherein the sense strand (passenger) is 21 nucleotide in length and the guide (antisense strand) is 23 nucleotide in length and a 2 nucleotide overhang. Schlegel et al. teaches that GNA substitution of positions 3–9 of the guide strand (within the seed region) and positions 13–19 of the passenger strand were also well tolerated. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent 10208307, 10683501, 11286486, 12049628, 9399775 or 11959081, Acevedo et al., Manoharan et al. and Schlegel et al. and utilize GNA as it is a modification which can be used in iRNA as taught by Schlegel et al.
Regarding claims 15-16, Schlegel et al. teaches GNA substitution at positions 3-9 which overlap with the position(s) claimed. Since there are a finite number of positions taught as containing the GNA substitution one skilled in the art would envision the GNA at any of these positions. Therefore, the GNA at position 7 is obvious absent a demonstration of an unexpected effect.
Claim 19 is rejected on the ground of nonstatutory double patenting as being unpatentable over the claims of U.S. Patent No. 10208307, 10683501, 11286486, 12049628, 9399775 or 11959081 in view of Acevedo et al. and Manoharan et al. as applied to the claims above and in further view of Chen et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
The instant application claims the RGD peptide is H-Gly-Arg-Gly-Asp-Ser-Pro-Lys-Cys-OH (SEQ ID NO: 14) or Cyclo(-Arg-Gly-Asp-D-Phe- Cys).
The teachings of US Patent No. 10208307, 10683501, 11286486, 12049628, 9399775 and 11959081 are set forth above.
While Patent 10208307, 10683501, 11286486, 12049628, 9399775 and 11959081 claim a ligand, none of the patents expressly claim the RGD peptide claim.
However, this deficiency is cured by Chen et al.
Chen et al. is directed to novel RGD-lipid conjugate-modified liposomes for enhancing siRNA delivery in human retinal pigment epithelial cells. The RGD peptide taught (sequence: H-Gly-Arg-Gly-Asp-Ser-Pro-Lys-Cys-OH) (page 2568). In order to accumulate more liposomal siRNA in the retinal pigment epithelial cells, with the goal of producing greater and more selective therapeutic activity, use of active targeted liposomes with the RGD peptide has been suggested. This involves coupling RGD moieties capable of recognizing and binding to the integrin receptor of the retinal pigment epithelial cells, (page 2576).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent 10208307, 10683501, 11286486, 12049628, 9399775 or 1195908, Acevedo et al., Manoharan et al. and Chen et al. and utilize the RGD peptide: H-Gly-Arg-Gly-Asp-Ser-Pro-Lys-Cys-OH as a targeting ligand. One skilled in the art would have been motivated to utilize this particular peptide as it has been shown to target retinal pigment epithelial cells. Therefore, when desiring to administer the dsRNA agent to target TTR one skilled in the art would have been motivated to utilize a ligand which targets retinal pigment epithelial cells.
Claims 1-3, 6-10 and 17-18 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 2, 7-13, 16-18, 21-22, 24-26, 28, 30, 32-33, 35-41 of copending Application No. 18299220 (USPGPUB No. 20240100080, cited on PTO Form 1449) in view of Acevedo et al. and Manoharan et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
This is a provisional nonstatutory double patenting rejection.
The instant claims are set forth above.
Copending ‘220 claims a method of improving at least one indicia of quality of life in a human subject suffering from a TTR-associated disease or at risk for developing a TTR- associated disease, the method comprising administering to the human subject a fixed dose of about 25 mg to about 50 mg of a double stranded RNAi agent, or salt thereof, wherein the double stranded RNAi agent comprises a sense strand complementary to an antisense strand, wherein the sense strand comprises the nucleotide sequence 5'- usgsggauUfuCfAfUfguaaccaaga - 3' (SEQ ID NO: 10) and the antisense strand comprises the nucleotide sequence 5'- usCfsuugGfuuAfcaugAfaAfucccasusc - 3' (SEQ ID NO: 7), wherein a, c, g, and u are 2'-O-methyl (2'-OMe) A, C, G, or U, respectively; Af, Cf, Gf, and Uf are 2'-fluoro A, C, G, or U, respectively; and s is a phosphorothioate linkage, and wherein the at least one indicia of quality of life is selected from the group consisting of a Norfolk Quality of Life-Diabetic Neuropathy (Norfolk QOL-DN) score, a 6-minute walk test (6MWT) score, and a 10-meter walk test score, thereby improving the at least one indicia of quality of life in the human subject. SEQ ID NO: 10 is the same as instantly claimed SEQ ID NO 11/12 whereas SEQ ID NO: 7 is the same as instantly claimed SEQ ID No: 13. As claimed the RNAi is conjugated to the ligand as shown below:
PNG
media_image7.png
273
380
media_image7.png
Greyscale
While Copending ‘220 claims a double stranded RNA targeting the same TTR with the same sequence and a ligand conjugated to the sense strand with a linker which is similar to the lipophilic monomer claimed, Copending ‘220 does not claim the exact same lipophilic monomer.
However, this deficiency is cured by Acevedo et al. and Manoharan et al.
The teachings of Acevedo et al. and Manoharan et al. are set forth above.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘220 , Acevedo et al. and Manoharan et al. and incorporate a ribose replacement modification subunit such as that taught in Acevedo et al. into the dsRNA agent of Copending ‘220 . One skilled in the art would have been motivated to incorporate a ribose replacement modification subunit in order to manipulate the properties of the dsRNA and/or to tether a ligand to the oligonucleotide as taught by Manoharan et al. One skilled in the art would have a reasonable expectation of success as the ribose replacement modification submits taught by Acevedo et al. and Manoharan et al. are pyrrolidines and Copending ‘220 claims carriers for the ligand can be a cyclic group such as pyrrolidinyl. Furthermore, Copending ‘220 claims the dsRNA conjugated to a ligand via the following molecule:
PNG
media_image7.png
273
380
media_image7.png
Greyscale
this molecule is of the same structure (albeit a different alkyl length C10 in Copending ‘220 vs C15 in instant claims) than instantly claimed
PNG
media_image8.png
164
460
media_image8.png
Greyscale
suggesting a reasonable expectation of success in using the pyrrolidine of Acevedo et al. and/or Manoharan et al.
Regarding the claimed lipophilic monomer, both Acevedo et al. and Manoharan et al. suggest that the monomer is a five-membered nitrogen containing ring, e.g. a pyrrolidine. Both Acevedo et al. and Manoharan et al. suggest incorporation in an oligonucleotide via an O or CH2O at the same positions in the pyrrolidone of the instantly claimed monomers. Both Acevedo et al. and Manoharan et al. teach that the group attached to the N of the pyrrolidine can be C(O)-alkyl wherein the alkyl is from 1 to 20 carbons. This overlaps the length of the alkyl chain in the instantly claimed lipophilic monomers. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05. It would have been obvious to one of ordinary skill in the art to try any of the specifically taught substituents as a person with ordinary skill has good reason to pursue known options within his or her technical grasp. Note: MPEP 2141 KSR International CO. v. Teleflex Inc. 82 USPQ 2d 1385 (Supreme Court 2007). Manoharan et al. expressly teaches that the ribose replacement modification submits can be used to modify the properties of the RNAi agent and this includes the lipophilicity of the compound as well as serving as a tether to ligands. Therefore, one skilled in the art would manipulate the length of the alkyl chain, which would be expected to modify the lipophilicity of the compound and the substituents attached depending on whether a ligand would be required to be incorporated into the RNAi agent.
Regarding claim 3, the claimed sequence comprises less than 10 2’-fluoro modifications.
Regarding claim 6 and 10, the claimed sense and antisense strand has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5’-end of the sense strand and 3’-end of the antisense.
Regarding claims 7, the claimed sense and antisense strand contain more than 50% O-Me modifications.
Regarding claim 8, the claimed sequence contain 4 fluoro modified nucleotides which as recognized by Manoharan et al. is a deoxy modified nucleotide.
Regarding claims 17-18, Copending ‘220 claims the RNAi agent is conjugated to a ligand. Ligands claimed is a carbohydrate.
Claims 1, 3, 6-8, 10 and 17-18 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 31-52 of copending Application No. 18600902 (USPGPUB No. 20240409929, cited on PTO Form 1449) in view of Acevedo et al. and Manoharan et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
This is a provisional nonstatutory double patenting rejection.
The instant claims are set forth above.
Copending ‘902 claims a method of treating a subject suffering from a TTR-associated disease or at risk for developing a TTR-associated disease, comprising administering to the subject a therapeutically effective amount or a prophylactically effective amount of a double stranded ribonucleic acid (dsRNA) agent, or salt thereof, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the nucleotide sequence of the sense strand differs by no more than 4 bases from the nucleotide sequence 5'-csasagagUfaUfUfCfcauuuuuacu-3' of SEQ ID NO: 21 and the nucleotide sequence of the antisense strand differs by no more than 4 bases from the nucleotide sequence 5'-asGfsuaaAfaauggaaUfaCfucuugsgsu-3' of SEQ ID NO: 22, wherein a, c, g, and u are 2'-O-methyl (2'-OMe) A, C, G, and U, respectively; Af, Cf, Gf and Uf are 2'-fluoro A, C, G and U, respectively; s is a phosphorothioate linkage, and wherein at least one strand is conjugated to a ligand, thereby treating said subject. . As claimed the RNAi is conjugated to the ligand as shown below:
PNG
media_image7.png
273
380
media_image7.png
Greyscale
While copending ‘902 claims a double stranded RNA targeting the same TTR with the same sequence and a ligand conjugated to the sense strand with a linker which is similar to the lipophilic monomer claimed, copending ‘902 does not claim the exact same lipophilic monomer.
However, this deficiency is cured by Acevedo et al. and Manoharan et al.
The teachings of Acevedo et al. and Manoharan et al. are set forth above.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of copending ‘902, Acevedo et al. and Manoharan et al. and incorporate a ribose replacement modification subunit such as that taught in Acevedo et al. into the dsRNA agent of copending ‘902. One skilled in the art would have been motivated to incorporate a ribose replacement modification subunit in order to manipulate the properties of the dsRNA and/or to tether a ligand to the oligonucleotide as taught by Manoharan et al. One skilled in the art would have a reasonable expectation of success as the ribose replacement modification submits taught by Acevedo et al. and Manoharan et al. are pyrrolidines and copending ‘902 claims carriers for the ligand can be a cyclic group such as pyrrolidinyl. Furthermore copending ‘902 claims the dsRNA conjugated to a ligand via the following molecule:
PNG
media_image7.png
273
380
media_image7.png
Greyscale
this molecule is of the same structure (albeit a different alkyl length C10 in copending ‘902 vs C15 in instant claims) than instantly claimed
PNG
media_image8.png
164
460
media_image8.png
Greyscale
suggesting a reasonable expectation of success in using the pyrrolidine of Acevedo et al. and/or Manoharan et al.
Regarding the claimed lipophilic monomer, both Acevedo et al. and Manoharan et al. suggest that the monomer is a five-membered nitrogen containing ring, e.g. a pyrrolidine. Both Acevedo et al. and Manoharan et al. suggest incorporation in an oligonucleotide via an O or CH2O at the same positions in the pyrrolidone of the instantly claimed monomers. Both Acevedo et al. and Manoharan et al. teach that the group attached to the N of the pyrrolidine can be C(O)-alkyl wherein the alkyl is from 1 to 20 carbons. This overlaps the length of the alkyl chain in the instantly claimed lipophilic monomers. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05. It would have been obvious to one of ordinary skill in the art to try any of the specifically taught substituents as a person with ordinary skill has good reason to pursue known options within his or her technical grasp. Note: MPEP 2141 KSR International CO. v. Teleflex Inc. 82 USPQ 2d 1385 (Supreme Court 2007). Manoharan et al. expressly teaches that the ribose replacement modification submits can be used to modify the properties of the RNAi agent and this includes the lipophilicity of the compound as well as serving as a tether to ligands. Therefore, one skilled in the art would manipulate the length of the alkyl chain, which would be expected to modify the lipophilicity of the compound and the substituents attached depending on whether a ligand would be required to be incorporated into the RNAi agent.
Regarding claim 3, the claimed sequence comprises less than 10 2’-fluoro modifications.
Regarding claim 6 and 10, the claimed sense and antisense strand has two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5’-end of the sense strand and 3’-end of the antisense.
Regarding claims 7, the claimed sense and antisense strand contain more than 50% O-Me modifications.
Regarding claim 8, the claimed sequence contain 4 fluoro modified nucleotides which as recognized by Manoharan et al. is a deoxy modified nucleotide.
Regarding claims 17-18, copending ‘902 claims the RNAi agent is conjugated to a ligand. Ligands claimed is a carbohydrate.
Claims 12-13 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over the claims of copending Application No. 18299220 or 18600902 in view Acevedo et al. and Manoharan et al. as applied to the claims above and in further view of Zimmermann et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
This is a provisional nonstatutory double patenting rejection.
The instant claims are set forth above
The teachings of copending ‘220 and ‘902 are set forth above.
Neither copending ‘220 or ‘902 claim a 5’-VP. However, this deficiency is cured by Zimmermann et al.
The teachings of Zimmermann et al. are set forth above.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of copending ‘220 or ‘902, Acevedo et al., Manoharan et al. and Zimmermann et al. and utilize a 5’-VP. One skilled in the art would have been motivated to utilize this type of modification as the copending applications and Zimmermann et al. are both directed to dsRNA agents which target TTR. Therefore, all of the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions and the combination would have yielded predictable results to one of ordinary skill in the art at the time of the invention. Note: MPEP 2143 KSR International Co. v. Teleflex Inc., 550 US 398, 82 USPQ 2d 1385 (2007).
Claims 14-16 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over the claims of copending Application No. 18299220 or 18600902 in view Acevedo et al. and Manoharan et al. as applied to the claims above and in further view of Schlegel et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
This is a provisional nonstatutory double patenting rejection.
The instant claims are set forth above
The teachings of copending ‘220 and ‘902 are set forth above.
Neither copending ‘220 or ‘902 claim a GNA in the seed region of the antisense strand. However, this deficiency is cured by Schlegel et al.
The teachings of Schlegel et al. are set forth above.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of copending ‘220 or ‘902, Acevedo et al., Manoharan et al. and Schlegel et al. and utilize destabilizing modifications incorporated at certain positions of the RNAi to increase potency by improving strand bias as taught by Schlegel et al. Therefore, one skilled in the art would manipulate not only the position but the type of modification in order to achieve the optimal combination of destabilizing modifications but also stabilizing modifications to ensure delivery of the RNAi. Schlegel et al. teaches siRNA with a sense and antisense strand wherein the sense strand (passenger) is 21 nucleotide in length and the guide (antisense strand) is 23 nucleotide in length and a 2 nucleotide overhang. Schlegel et al. teaches that GNA substitution of positions 3–9 of the guide strand (within the seed region) and positions 13–19 of the passenger strand were also well tolerated. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of copending ‘220 or ‘902, Acevedo et al., Manoharan et al. and Schlegel et al. and utilize GNA as it is a modification which can be used in iRNA as taught by Schlegel et al.
Regarding claims 15-16, Schlegel et al. teaches GNA substitution at positions 3-9 which overlap with the position(s) claimed. Since there are a finite number of positions taught as containing the GNA substitution one skilled in the art would envision the GNA at any of these positions. Therefore, the GNA at position 7 is obvious absent a demonstration of an unexpected effect.
Claim 19 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over the claims of copending Application No. 18299220 or 18600902 in view Acevedo et al. and Manoharan et al. as applied to the claims above and in further view of Chen et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
This is a provisional nonstatutory double patenting rejection.
The instant claims are set forth above
The teachings of copending ‘220 and ‘902 are set forth above.
Neither copending ‘220 or ‘902 claim the instantly claimed RGD peptide. However, this deficiency is cured by Chen et al.
The teachings of Chen et al. are set forth above.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of copending ‘220 or ‘902, Acevedo et al., Manoharan et al. and Chen et al. and utilize the RGD peptide: H-Gly-Arg-Gly-Asp-Ser-Pro-Lys-Cys-OH as a targeting ligand. One skilled in the art would have been motivated to utilize this particular peptide as it has been shown to target retinal pigment epithelial cells. Therefore, when desiring to administer the dsRNA agent to target TTR one skilled in the art would have been motivated to utilize a ligand which targets retinal pigment epithelial cells.
Claims 1-3, 5-10 and 12-19 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-104 of copending Application No. 19247022 in view of Acevedo et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
This is a provisional nonstatutory double patenting rejection.
The instant claims are set forth above.
Copending 19247022 claims a double stranded RNAi agent comprising a sense strand complementary to an antisense strand wherein said antisense strand comprises a region complementary to part of an mRNA encoding transthyretin (TTR), wherein each strand independently has 14 to 30 nucleotides wherein one or more lipophilic moieties are conjugated to one or more internal positions on at least one strand. As claimed the antisense strand comprises a sequence complementary to SEQ ID No: 11 which is the same as instantly claimed SEQ ID NO: 11. Copending 19247022 claims sense strand SEQ ID NO: 12 and antisense strand SEQ ID No: 13 which are the same as instantly claimed. As claimed more than 50% of the sequence has O-Me modifications. Claimed sequences contain less than 10 fluoronucleotides. The lipophilic moieties are conjugated to one or more internal positions on at least one strand via linker or carrier. The lipophilic moieties includes a saturated C6-C18 hydrocarbon. Pyrrolidinyl carrier is claimed. The same RGD peptides are claimed. The 5’ end of the antisense strand include a phosphate mimic 5’-vinyl phosphonate.
While copending 19247022 claims a pyrrolidinyl with a saturated hydrocarbon as the lipophilic moieties conjugated to the RNAi, copending 19247022 does not expressly draw the claimed structure. However, this deficiency is cured by Acevedo et al.
The teachings of Acevedo et al. are set forth above.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of copending 19247022 and Acevedo et al. and incorporate a ribose replacement modification subunit such as that taught in Acevedo et al. into the dsRNA agent of copending 19247022. Copending 19247022 claims a pyrrolidinyl with a saturated hydrocarbon, Acevedo et al. teaches pyrrolidine. Acevedo et al. suggest incorporation in an oligonucleotide via an O or CH2O at the same positions in the pyrrolidone of the instantly claimed monomers. Therefore, Acevedo et al. suggests a structure which falls within the scope of the genus claimed in copending 19247022. Acevedo et al. teach that the group attached to the N of the pyrrolidine can be C(O)-alkyl wherein the alkyl is from 1 to 20 carbons and copending ‘022 claims C6-C18 hydrocarbon. This overlaps the length of the alkyl chain in the instantly claimed lipophilic monomers. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05. It would have been obvious to one of ordinary skill in the art to try any of the specifically taught substituents as a person with ordinary skill has good reason to pursue known options within his or her technical grasp. Note: MPEP 2141 KSR International CO. v. Teleflex Inc. 82 USPQ 2d 1385 (Supreme Court 2007).
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ABIGAIL VANHORN whose telephone number is (571)270-3502. The examiner can normally be reached M-Th 6 am-4 pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ABIGAIL VANHORN/Primary Examiner, Art Unit 1636