Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Applicant’s amendments and remarks filed on December 5, 2025 are acknowledged. Claim 2 has been canceled. Claims 1 and 3-68 are pending. Claims 5, 6, 16, 34, and 44-61 are withdrawn. Claims 1, 3, 4, 7-15, 17-33, 35-43, and 62-68 are examined on the merits herein.
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on December 5, 2025 has been entered.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 3, 4, 7-12, 15, 17-19, 21-30, 35, 39-43, and 62-68 are rejected under 35 U.S.C. 103 as being unpatentable over Radovic-Moreno et al. (US 2017/0157048; reference cited by Applicant) in view of Bousmail et al. (Chemical Science 2017; reference cited by Applicant).
Regarding claims 1, 3, 7-12, 17-19, and 62-68, Radovic-Moreno et al. teaches liposomal spherical nucleic acids comprising a liposomal core having a lipid bilayer, wherein an immune stimulant or an immune suppressor is associated with the lipid bilayer, and oligonucleotides positioned on the exterior of the liposomal core wherein the oligonucleotides form an oligonucleotide shell wherein the oligonucleotide shell is comprised of at least one pattern recognition receptor modulating oligonucleotide wherein the pattern recognition receptor modulating oligonucleotide is a TLR agonist [0006-0009]. The TLR is selected from the group consisting of TLR3, TLR 7, TLR8, TLR9, and TLR13 [0011]. Radovic-Moreno et al. also teaches that the oligonucleotides positioned on the exterior of the liposomal core comprise CpG-motif containing oligonucleotides [0025]. Radovic-Moreno et al. also teaches that the oligonucleotide shell may be anchored to the surface of the liposomal core through conjugation to one or a multiplicity of linker molecules [0103]. Further, Radovic-Moreno et al. teaches that the liposomal core is comprised of one or more lipids including sterols such as cholesterol [0035].
However, Radovic-Moreno et al. does not teach a hydrophobic anchor comprising at least six dodecane (C12) subunits (claim 1), specifically nine dodecane subunits (claim 3), six to about ten dodecane subunits (claim 62), or nine to about twelve dodecane subunits (claim 63).
Bousmail et al. generated a single type of DNA-polymer conjugate that self-assembles in aqueous buffer to form micellar DNA particles. The conjugates consist of a 19-mer DNA sequence attached to 12 dodecane (hexaethylene, HE) units [page 6219, right column, second paragraph]. Bousmail et al. also teaches that the assembly of HE12-SNAs was shown to be dependent on the presence of divalent metal cations and the main driving force of assembly is hydrophobic interactions. Further, Bousmail et al. demonstrated that HE12-SNAs can withstand large variations in ionic concentrations wherein disassembly into monomeric HE12-DNA units occurred only upon total depletion of divalent cations. Bousmail et al. teaches that HE12-SNAs has a 4.6-fold higher half-life than ssDNA which demonstrates enhanced stability against nuclease degradation attributing to the dense packing of DNA creating a steric barrier [page 6221]. Bousmail et al. teaches that HE12–DNA nanoparticles show great promise as delivery vehicles for chemotherapeutics and demonstrated the ability to load drugs and protect them in different biological conditions, achieve in vitro activity in primary patient cell lines, and monitor the in vivo bio distribution of these structures in mice to understand their real time trafficking and stability [page 6227, right column, second full paragraph].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the spherical nucleic acid of Radovic-Moreno et al. by using a hydrophobic anchor comprising at least six dodecane subunits as taught by Bousmail et al. Further, based on the teachings of Bousmail et al. and through routine experimentation, it would have been obvious for one of ordinary skill in the art to vary the number of hydrophobic anchors because Bousmail et al. taught that rapid nuclease degradation is a major challenge for DNA nanostructures as they are translated to the in vitro culture environment [page 6221, first full paragraph]. One of ordinary skill in the art would have been motivated to do so because Bousmail et al. demonstrated that HE12-SNAs enhanced stability against nuclease degradation.
Regarding claims 4 and 35, Radovic-Moreno et al. teaches that the nanostructure further comprises an antigen [0039]. In some embodiments, the antigen is linked directly to the oligonucleotide shell, linked indirectly to the oligonucleotide shell through a linker, linked directly to the liposomal core, or linked indirectly to the liposomal core through a linker [0041-0044]. In other embodiments the antigen is selected from the group consisting of a cancer antigen, a bacterial antigen, a viral antigen, a parasitic antigen, a hapten, and an allergen [0053].
Regarding claim 15, it would have been obvious to incorporate an immunostimulatory oligonucleotide in about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% of the oligonucleotides in the shell of Radovic-Moreno et al. to stimulate immune receptors with a reasonable expectation of success because Radovic-Moreno et al. taught that the nanostructure includes a liposomal core having a lipid bilayer and a layer of oligonucleotides which may be an oligonucleotide shell to help target the nanostructure to immune cells and also act to stimulate immune receptors that can recognize nucleic acids [0091].
Regarding claim 21, Radovic-Moreno et al. teaches that the oligonucleotides may be linked to the core or to one another and/or to other molecules such an antigens either directly or indirectly through a linker. The oligonucleotides may be conjugated to a linker via the 5′ end or the 3′ end. In addition, some or all of the oligonucleotides of the nanostructure may be linked to one another either directly or indirectly through a covalent or non-covalent linkage [0101].
Regarding claim 22, Radovic-Moreno et al. teaches that the oligonucleotides may be linked to the core or to one another and/or to other molecules such an antigens either directly or indirectly through a linker. The oligonucleotides may be conjugated to a linker via the 5′ end or the 3′ end [0101].
Regarding claims 23-26, Radovic-Moreno et al. teaches that the oligonucleotides are comprised of single-stranded or double-stranded DNA oligonucleotides [0016], single-stranded or double-stranded RNA oligonucleotides [0017], or combinations of single-stranded or double-stranded DNA, RNA, or chimeric RNA-DNA oligonucleotides [0019]. Radovic-Moreno et al. also teaches that the oligonucleotides can be modified such as at the sugar moiety, the phosphodiester linkage, and/or the base [0130].
Regarding claims 27-28, Radovic-Moreno et al. teaches that the oligonucleotides comprise 2-1,000 oligonucleotides [0034].
Regarding claims 29-30, Radovic-Moreno et al. teaches that oligonucleotides are preferably in the range of 6 to 100 bases in length. However, nucleic acids of any size greater than 4 nucleotides (even many kb long) are capable of inducing a biological response according to the invention if sufficient stimulatory motifs are present. Preferably the nucleic acid is in the range of between 8 and 100 and in some embodiments between 8 and 50 or 8 and 30 nucleotides in size [0144].
Regarding claims 39-40, Radovic-Moreno et al. teaches a method for treating a subject comprising administering to a subject a nucleic acid nanostructure in an effective amount to promote an immune response [0055] and further comprising administering an adjuvant [0068]. Radovic-Moreno et al. also teaches that the nanostructures are useful as a vaccine for the treatment of a subject at risk of developing or a subject having allergy or asthma, an infection with an infectious organism or a cancer in which a specific cancer antigen has been identified [0161].
With regard to the functional language recited in the claims, the structure in the prior art is indistinguishable from the structure that is claimed, and absent evidence to the contrary the recited function is inherent in the structure. See MPEP 2112. Regarding claims 41-43, Radovic-Moreno et al. teaches that the nanostructures may be administered alone or in any appropriate pharmaceutical carrier, such as a liquid, for example saline, or a powder, for administration in vivo [0158]. The structure in the prior art is indistinguishable from the structure in these claims, thus the limitations “wherein the antigenic composition is capable of generating an immune response including dendritic cell activation, antibody generation, cytotoxic T cell activation, helper T cell activation, or a protective immune response in a subject” (claim 41), “wherein the immune response includes an antibody response” (claim 42), and “wherein the antibody response is a neutralizing antibody response or a protective antibody response” (claim 43) is a function that is an inherent property of the structure.
Claim 13 is rejected under 35 U.S.C. 103 as being unpatentable over Radovic-Moreno et al. (US 2017/0157048; reference cited by Applicant) and Bousmail et al. (Chemical Science 2017; reference cited by Applicant) as applied to claims 1, 3, 4, 7-12, 15, 17-19, 21-30, 35, 39-43, and 62-68 above, and further in view of Krieg et al. (US 6,239,116; reference cited by Applicant).
Regarding claim 13, the teachings of Radovic-Moreno et al. and Bousmail et al. are discussed above.
However, Radovic-Moreno et al. and Bousmail et al. do not teach instant SEQ ID NO: 3.
Krieg et al. teaches nucleic acid sequences containing unmethylated CpG dinucleotides that modulate an immune response including stimulating a Th1 pattern of immune activation, cytokine production, NK lytic activity, and B cell proliferation. Krieg et al. also teaches that the sequences are useful as a synthetic adjuvant [abstract]. Krieg et al. teaches SEQ ID NO: 10 which is 20 nucleotides in length and has a 100% match to instant SEQ ID NO: 3 as shown in the sequence search results. Further, Krieg et al. teaches that SEQ ID NO: 10 is useful as an adjuvant during antibody production.
SEQ ID NO: 3 1 TCCATGACGTTCCTGACGTT 20
||||||||||||||||||||
Krieg et al. SEQ ID NO: 10 1 TCCATGACGTTCCTGACGTT 20
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to incorporate SEQ ID NO: 10 of Krieg et al., a CpG oligonucleotide, into the spherical nucleic acid of Radovic-Moreno et al. and Bousmail et al. as a synthetic adjuvant during antibody production because the use of adjuvants is essential to induce a strong antibody response to soluble antigens as taught by Krieg et al. [column 22].
Claim 14 is rejected under 35 U.S.C. 103 as being unpatentable over Radovic-Moreno et al. (US 2017/0157048; reference cited by Applicant) and Bousmail et al. (Chemical Science 2017; reference cited by Applicant) as applied to claims 1, 3, 4, 7-12, 15, 17-19, 21-30, 35, 39-43, and 62-68 above, and further in view of Krieg et al. (US 6,239,116; reference cited by Applicant).
Regarding claim 14, the teachings of Radovic-Moreno et al. and Bousmail et al. are discussed above.
However, Radovic-Moreno et al. and Bousmail et al. do not teach instant SEQ ID NO: 4.
Krieg et al. teaches nucleic acid sequences containing unmethylated CpG dinucleotides that modulate an immune response including stimulating a Th1 pattern of immune activation, cytokine production, NK lytic activity, and B cell proliferation. Krieg et al. also teaches that the sequences are useful as a synthetic adjuvant [abstract]. Krieg et al. teaches SEQ ID NO: 46 which is 24 nucleotides in length and has a 100% match to instant SEQ ID NO: 4 as shown in the sequence search results. Further, Krieg et al. teaches that SEQ ID NO: 46 can stimulate cytokine production, stimulate natural killer cell lytic activity, and stimulate B cell proliferation [column 12].
SEQ ID NO: 4 1 TCGTCGTTTTGTCGTTTTGTCGTT 24
||||||||||||||||||||||||
Krieg et al. SEQ ID NO: 46 1 TCGTCGTTTTGTCGTTTTGTCGTT 24
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to incorporate SEQ ID NO: 46 of Krieg et al. into the spherical nucleic acid of Radovic-Moreno et al. and Bousmail et al. to stimulate cytokine production, stimulate natural killer cell lytic activity, and stimulate B cell proliferation as taught by Krieg et al.
Claim 20 is rejected under 35 U.S.C. 103 as being unpatentable over Radovic-Moreno et al. (US 2017/0157048; reference cited by Applicant) and Bousmail et al. (Chemical Science 2017; reference cited by Applicant) as applied to claims 1, 3, 4, 7-12, 15, 17-19, 21-30, 35, 39-43, and 62-68 above, and further in view of Sood et al. (WO 2009/070609).
Regarding claim 20, the teachings of Radovic-Moreno et al. and Bousmail et al. are discussed above.
However, Radovic-Moreno et al. and Bousmail et al. do not teach that the liposome comprises DPPC.
Sood et al. teaches methods of treating a subject with cancer that exhibits stress-related growth involve administering to the subject a pharmaceutically effective amount of a composition that includes a nucleic acid component that includes a nucleic acid that inhibits the expression of a gene that encodes IL- 6, and a lipid component comprising one or more phospholipids [abstract]. Sood et al. also teaches that in certain embodiments, a neutral liposome may be used to deliver a siRNA. Further, little to no toxicity has been observed with the use of neutral liposomes. Examples of phospholipids include, but is not limited to, DPPC [page 15, 2nd and 4th full paragraphs].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to incorporate DPPC into the spherical nucleic acid of Radovic-Moreno et al. and Bousmail et al. because Sood et al. taught that neutral phospholipids such as DPPC has been shown to have little to no toxicity and are useful for liposome formation.
Claims 31-33 are rejected under 35 U.S.C. 103 as being unpatentable over Radovic-Moreno et al. (US 2017/0157048; reference cited by Applicant) and Bousmail et al. (Chemical Science 2017; reference cited by Applicant) as applied to claims 1, 3, 4, 7-12, 15, 17-19, 21-30, 35, 39-43, and 62-68 above, and further in view of Medarova et al. (WO 2020/068398).
Regarding claims 31-33, the teachings of Radovic-Moreno et al. and Bousmail et al. are discussed above.
However, Radovic-Moreno et al. and Bousmail et al. do not teach the diameter of the spherical nucleic acid.
Medarova et al. teaches therapeutic compositions and methods for treating cancer that use nanoparticles linked to inhibitory nucleic acids [abstract]. Medarova et al. also teaches that the therapeutic nanoparticles have a diameter of between 10 nm to 30 nm [page 2, 2nd full paragraph]. Further, Medarova et al. teaches that the term “nanoparticle” means an object that has a diameter between about 2 nm to about 200 nm [page 5, 4th full paragraph].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the spherical nucleic acid of Radovic-Moreno et al. and Bousmail et al. wherein the diameter of the spherical nucleic acid is between 10 nm to 30 nm because Medarova et al. taught therapeutic compositions comprising nanoparticles having a diameter between about 2 nm to about 200 nm can be used to treat cancer.
Claims 36-38 are rejected under 35 U.S.C. 103 as being unpatentable over Radovic-Moreno et al. (US 2017/0157048; reference cited by Applicant) and Bousmail et al. (Chemical Science 2017; reference cited by Applicant) as applied to claims 1, 3, 4, 7-12, 15, 17-19, 21-30, 35, 39-43, and 62-68 above.
Regarding claims 36-38, the teachings of Radovic-Moreno et al. and Bousmail et al. are discussed above.
It would have been obvious to incorporate a plurality of spherical nucleic acids comprising different nanoparticle cores in the process of optimizing the composition and pharmaceutical formulation of Radovic-Moreno et al. and Bousmail et al. to promote an immune response in the treatment of diseases with a reasonable expectation of success as taught by Radovic-Moreno et al. [0055 and 0071].
Response to Arguments
Applicant's arguments filed December 5, 2025 have been fully considered to the extent that they might apply to the new ground of rejection set forth above but they are not persuasive.
Applicant asserts that the Office still has not established that any cited document, either alone or in combination, discloses or suggests a method according to instant claim 1. The Examiner notes again that claim 1 is not a method claim and instead is a product claim.
Applicant asserts that the instant application showed that having more C12 subunits provided better results. The C12 structure is very specific as shown in Figure 1 and reproduced below wherein n is at least 6 (as required by claim 1), n is 9 (as required by claim 3), n is 6 to about 10 (as required by claim 62), or wherein n is 9 to about 12 (as required by claim 63); however, Applicant refers to Figure 3 which only shows results with 4, 5, 6, 7, 8, 9, and 10 C12 subunits. Further, Bousmail et al. studied the in vitro cellular uptake and internalization of HE12-SNAs by confocal fluorescence microscopy. Several intense foci were observed indicating the high efficiency of uptake [page 6221, right column, last paragraph bridging to page 6222] . Therefore, based on the teachings of the cited prior art, an increase in uptake is expected.
PNG
media_image1.png
234
220
media_image1.png
Greyscale
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 3, 4, 7-10, 12, 17, 18, 23-24, 35-38, 41-43, and 62-68 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 7, 18, 44, 45, 49, and 50 of copending Application No. 17/684,269 in view of Bousmail et al. (Chemical Science 2017; reference cited by Applicant).
Regarding claims 1, 3, 4, 7, 35, and 62, 63, 67, 68 of the instant application, conflicting claim 1 of application ‘269 teaches a spherical nucleic acid (SNA) comprising: (a) a nanoparticle core; (b) a shell of oligonucleotides attached to the external surface of the nanoparticle core, the shell of oligonucleotides comprising one or more immunostimulatory oligonucleotides; and (c) a viral antigen or a nucleic acid that encodes a viral antigen encapsulated in the nanoparticle core.
Regarding claims 8-10 of the instant application, conflicting claim 45 of application ‘269 teaches the SNA of claim 1 wherein each of the immunostimulatory oligonucleotides is a toll-like receptor (TLR) agonist.
Regarding claim 12 of the instant application, conflicting claim 44 of application ‘269 teaches the SNA of claim 1 wherein the immunostimulatory oligonucleotide is a CpG-motif containing oligonucleotide, a double- stranded DNA oligonucleotide, or a single-stranded RNA oligonucleotide.
Regarding claims 17, 18, and 64-66 of the instant application, conflicting claim 7 of application ‘269 teaches the SNA of claim 1 wherein the nanoparticle core is a liposomal core or a lipid nanoparticle core.
Regarding claims 23-24 of the instant application, conflicting claim 18 of application ‘269 teaches the SNA of claim 1 wherein the shell of oligonucleotides comprises DNA, RNA, or a combination thereof.
Regarding claims 36-38 of the instant application, conflicting claim 49 of application ‘269 teaches a pharmaceutical formulation comprising the SNA of claim 1 and a pharmaceutically acceptable carrier or diluent.
Regarding claims 41-43 of the instant application, conflicting claim 50 of application ‘269 teaches an antigenic composition comprising the SNA of claim 1 in a pharmaceutically acceptable carrier, diluent, stabilizer, preservative, or adjuvant, wherein the antigenic composition is capable of generating an immune response including antibody generation or a protective immune response in a mammalian subject.
However, application ‘269 does not teach a hydrophobic anchor comprising at least six dodecane subunits that attaches one or more oligonucleotides in the shell of oligonucleotides to the nanoparticle core.
Bousmail et al. generated a single type of DNA-polymer conjugate that self-assembles in aqueous buffer to form micellar DNA particles. The conjugates consist of a 19-mer DNA sequence attached to 12 dodecane (hexaethylene, HE) units [page 6219, right column, second paragraph]. Bousmail et al. also teaches that the assembly of HE12-SNAs was shown to be dependent on the presence of divalent metal cations and the main driving force of assembly is hydrophobic interactions. Further, Bousmail et al. demonstrated that HE12-SNAs can withstand large variations in ionic concentrations wherein disassembly into monomeric HE12-DNA units occurred only upon total depletion of divalent cations. Bousmail et al. teaches that HE12-SNAs has a 4.6-fold higher half-life than ssDNA which demonstrates enhanced stability against nuclease degradation attributing to the dense packing of DNA creating a steric barrier [page 6221]. Bousmail et al. teaches that HE12–DNA nanoparticles show great promise as delivery vehicles for chemotherapeutics and demonstrated the ability to load drugs and protect them in different biological conditions, achieve in vitro activity in primary patient cell lines, and monitor the in vivo bio distribution of these structures in mice to understand their real time trafficking and stability [page 6227, right column, second full paragraph].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the spherical nucleic acid of application ‘269 by using a hydrophobic anchor comprising at least six dodecane subunits as taught by Bousmail et al. Further, based on the teachings of Bousmail et al. and through routine experimentation, it would have been obvious for one of ordinary skill in the art to vary the number of hydrophobic anchors because Bousmail et al. taught that rapid nuclease degradation is a major challenge for DNA nanostructures as they are translated to the in vitro culture environment [page 6221, first full paragraph]. One of ordinary skill in the art would have been motivated to do so because Bousmail et al. demonstrated that HE12-SNAs enhanced stability against nuclease degradation.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Response to Arguments
Applicant's arguments filed December 5, 2025 have been fully considered to the extent that they might apply to the new ground of rejection set forth above but they are not persuasive.
PNG
media_image2.png
232
784
media_image2.png
Greyscale
This argument is not found persuasive. Conflicting claim 1 of application ‘269 teaches a spherical nucleic acid (SNA) comprising: (a) a nanoparticle core; (b) a shell of oligonucleotides attached to the external surface of the nanoparticle core, the shell of oligonucleotides comprising one or more immunostimulatory oligonucleotides; and (c) a viral antigen or a nucleic acid that encodes a viral antigen encapsulated in the nanoparticle core. However, application ‘269 does not teach a hydrophobic anchor comprising at least six dodecane subunits that attaches one or more oligonucleotides in the shell of oligonucleotides to the nanoparticle core. Therefore, Bousmail et al. was used in combination with application ‘269 to render obvious the claim limitations as discussed above in the nonstatutory double patenting rejection.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/C.T./
Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637