DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 2, 4-19, 21-27, 29-31, 33, 35-38, 40-42, 45-49, 51, 53-57, 59-81, 83, 84, 86, 87, 89, and 90 are canceled.
Claims 3, 20, 28, 32, 34, 39, 43, 44, 50, 52, 58, 82, 85, and 88 are amended.
New claims 91-95 are added.
Claims 1, 3, 20, 28, 32, 34, 39, 43, 44, 50, 52, 58, 82, 85, 88, and 91-95 are presented and examined on the merits.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994).
The disclosure of the prior-filed application, Application No. 62/971,771, fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application. The application fails to provide support for the claims under examination, since there is no disclosure regarding SEQ ID NO 62-90. Therefore, the effective filling date of SEQ ID NO 62-90 in claims 32, 34 is deemed to be August 08, 2022, the filling date of the application 17/760,342.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 3, 20, 39, 43-44, 50, 52, 58, 82, 85, 88, 91-95 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims are broadly drawn to treatment of amyotrophic lateral sclerosis by administering “a compound” that inhibits miR-485.
The critical essential element is a compound; however, the instant claims encompass administration of a wide genus of possible miR-485 inhibitors, the claim does not specify what type of compound is used including nucleic acid-based inhibitors, small molecules, protein-based inhibitors (e.g., antibodies).
To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of a complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, and any combination thereof.
The specification exemplifies only nucleic acid-based inhibitors (e.g., paragraph 0282).
There is no description of the necessary and sufficient elements of the species encompassed by the breadth of the claims.
The only species described in specification are nucleic acid-based inhibitors: sequences complementary to miR-485. Applicant fails to describe representative members of Applicant's broadly claimed genus.
Therefore, the skilled artisan would have reasonable concluded applicants were not in possession of the intended claimed invention for claims 1, 3, 20, 39, 43-44, 50, 52, 58, 82, 85, 88, 91-95.
The claims listed in the statement of rejection but not otherwise discussed are rejected because they are similarly not limited to particular polynucleotides that are considered to be adequately described by the specification.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1, 3, 20, 28, 32, 34, 39, 43-44, 94-95 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Ryu et al. (“Ryu”, WO 2018/139819, January 2018, cited from machine translation).
Regarding claim 1, 3, 20, 94-95, Ryu teaches pharmaceutical composition for preventing or treating brain diseases using miR-485-3p and, more particularly, to a pharmaceutical composition for preventing or treating brain diseases, comprising a miR-485-3p inhibitor. The composition for treating brain diseases comprising a miR-485-3p inhibitor can restore the protein ELAVL2 and thus can fundamentally treat various diseases, e.g. Alzheimer's disease, autism, mental retardation, amyotrophic lateral sclerosis (e.g., abstract). It is inherent that such administration will regulate expression of genes recited in claims 3, 20.
Regarding claims 28 and 32, Ryu teaches the miRNA 485 inhibitor SEQ ID NO: 6 (5'-UGUAUGA-3), which corresponds to the SEQ ID NO: 2 of the instant claims 28 and 32.
Regarding claim 34, Ryu teaches the miRNA 485 inhibitor SEQ ID NO 7, that has 100% homology with SEQ ID NO 30 of the instant claim.
Regarding claim 39, Ryu teaches that the antisense oligonucleotide can be modified, for example ribonucleic acid (RNA), deoxyribonucleic acid (DNA), antagomiR, 2'-0-modified oligonucleotide, phosphorothioate-backbone deoxyribonucleotide, phosphorophore Thioate-backbone ribonucleotides, peptide nucleic acid (PNA) oligonucleotides or locked nucleic acid (LNA) oligonucleotides (e.g., paragraph 4th, page 8).
Regarding claim 43-44, Ryu teaches that the inhibitor can be delivered in liposome formulation (e.g., paragraph 1st, page 11).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 50, 52, 58, 85, 88 are rejected under 35 U.S.C. 103 as being unpatentable over Ryu et al. (“Ryu”, WO 2018/139819, January 2018, cited from machine translation) in view of Harada et al. (“Harada”, European Journal of Pharmaceutical Sciences, 2001), Kondo et al. (“Kondo”, US 2018/0334674, November 2018), Mangelsdorf et al. (“Mangelsdorf”, Complement Med Res, 2017), Chien et al. (”Chien”, J. Med. Chem., 2018, 61: 7358-7373).
Teachings of Ryu are discussed above.
Ryu does not teach delivering of the miR inhibitor using cationic carrier, which comprises polyethylene glycol (PEG), lysine, vitamin B3, and target moiety. However, this is cured by Harada, Kondo, Mangelsdorf and Chien.
Harada teaches physicochemical properties of polyion complex (PIC) micelles formed from antisense-oligodeoxynucleotides (antisense-ODN) and poly(ethylene glycol)-poly(L-lysine) block copolymers (PEG-PLL) (it reads on a water-soluble biopolymer [PEG] and cationic carrier [poly-lysine]) to utilize them as a novel formulation for antisense-ODN delivery (e.g., abstract; see structure below). Harada teaches that the length of antisense-ODN as well as PLL segments in PEG-PLL was an important parameter to determine the physicochemical properties including the average diameter and the association number of the formed PIC micelles (e.g., paragraph 3rd, page 37; Table 1).
PNG
media_image1.png
200
400
media_image1.png
Greyscale
Kondo teaches drug delivery formulations comprising a nucleic acid such as a modified siRNA, a modified antisense RNA, or an antisense
DNA (e.g., paragraph 2). Kondo teaches that the drug delivery formulation according to wherein the cationic poly(amino acid) segment comprises poly-lysine and the hydrophilic polymer chain segment comprises poly( ethylene glycol) or an end-modified poly(ethylene glycol) (e.g. paragraphs [0034-0035]). Kondo teaches that In the block copolymers that can be used in the formulation, a cyclic peptide comprising the arginine-glycine-aspartic acid (RGD) sequence (referred to as "cRGD"), for example, a cyclic peptide consisting of the arginine-glycine-aspartic acid-phenylalanine-lysine sequence can be bound to the end of the hydrophilic polymer chain
segment. cRGD can serve as a ligand to adhere or bind the
micelle to cancer cells (it reads on targeting moiety) (e.g., paragraph 0108).
Mangelsdorf teaches the therapy including Vitamin B3 in a patient with Amyotrophic lateral sclerosis (ALS) (e.g., abstract; Table 3).
Chien teaches that leucine and phenylalanine can be ligands for LAT1 transporter, allowing crossing blood-brain barrier (e.g., paragraph 1st, left column page 7358).
It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to construct a micelle according to teachings of Harada -comprising PEG and poly-lysine to deliver miR-485 inhibitor taught by Ryu, such micelle comprising vitamin B3 as taught by Mangelsdorf and targeting moiety taught by Kondo and Chien to direct the micelles to the brain.
One of the ordinary skill in the art would be motivated to develop a micelle to delivery miR-485 inhibitor and vitamin B3 for the treatment of amyotrophic lateral sclerosis (ALS) in a subject.
Claims 82, 91-93 are rejected under 35 U.S.C. 103 as being unpatentable over Ryu et al. (“Ryu”, WO 2018/139819, January 2018, cited from machine translation) in view of Hornstein et al. (“Hornstein”, WO 2016/030899 A1).
Teachings of Ryu are discussed above.
Ryu does not teach ALS comprises sporadic ALS, familial ALS as required by instant claim 82. Ryu does not teach copper-zinc superoxide dismutate enzyme (SOD1) and that SOD1 comprises a G93A mutation as required by instant claims 91-93. However, this is cured by Hornstein.
Hornstein teaches method of treating amyotrophic lateral scleroses by downregulation the expression level and/or activity of miR-9. (e.g., paragraph 1st, page 1). Hornstein teaches that genetic testing for ALS may include screening for mutations in the SOD 1 gene (superoxide disrnutase 1), which account for about 20% of familial ALS and also perhaps 1-3% of sporadic ALS (e.g., paragraph 6th, page 13). Hornstein teaches method of treating Amyotrophic lateral scleroses (ALS) in a subject the method comprising administering to the subject a pharmaceutical composition comprising as an active ingredient an agent capable of downregulating an activity and/or expression level of miR-9, wherein the ALS is caused by the G94A missense mutation in the SOD1 polypeptide thereby treating the ALS in the subject (e.g., paragraph 6th, page 14). Hornstein teaches that the mutation results in the G94A missense mutation (also known as SOD1 "G93A" mutation) in the wild type SOD 1 polypeptide (e.g., paragraph 2nd, page 16).
It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to construct a liposome particle to deliver miR-485 inhibitor taught by Ryu, for the treatment of amyotrophic lateral sclerosis ALS associated with SOD1 G93A mutation taught by Hornstein.
One of the ordinary skill in the art would be motivated to develop a micelle to delivery miR-485 inhibitor for the treatment of amyotrophic lateral sclerosis (ALS) in a subject associated with SOD1 G93A mutation.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 3, 20, 28, 32, 34, 94-95 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 4, 6-7, 12-13, 15-19 of U.S. Patent No. US 11,542,503 B2 (“503”, cited as a reference on IDS filed 05/01/2024).
The following rejection is in view of the decision of the Court of Appeals for the Federal Circuit in Pfizer Inc, v Teva pharmaceuticals USA Inc., 86 USPQ2d 1001, at page 1008 (March 2008), which indicates that there is no patentable distinction between claims to a product and a method of using that product disclosed in the specification of the application and that the preclusion of such a double patenting rejection under 35 USC 121 does not apply where the present application is other than a divisional application of the patent application containing such patentably indistinct claims. The instant claims are to a method of using the product claimed in the issued patent and the instant application is NOT a DIV of the instant patent
Although the claims at issue are not identical, they are not patentably distinct from each other because both sets of claims are drawn to: A method of treating an amyotrophic lateral sclerosis (ALS) in a subject in need thereof comprising administering to the subject a compound that inhibits miR-485 (miRNA inhibitor); the method of claim 1, wherein the ALS is associated with: (a) a decreased level of a SIRT1 protein and/or a SIRT1 gene, (b) a decreased level of a CD36 protein and/or a CD36 gene, (c) a decreased level of a PGC-la protein and/or a PGC-1α gene, (d) a decreased level of a NRG1 protein and/or a NRG1 gene, (e) a decreased level of a STMN2protein and/or a STMN2 gene, (f) a decreased level of a NRXN1 protein and/or a NRXN1 gene, or(g) any combination of (a) to (f); a method of treating an amyotrophic lateral sclerosis (ALS),which is associated with an abnormal level of: (a) a SIRT1 protein and/or a SIRT1 gene, (b) a PGC-1α protein and/or a PGC-la gene, (c) a CD36 protein and/or a CD36 gene, (d) a NRG1 protein and/or a NRG1 gene, (e) a STMN2 protein and/or a STMN2 gene, (f) a NRXN1 protein and/or a NRXN1 gene, or (g) any combination of (a) to (f), in a subject in need thereof, the method comprising administering to the subject a compound that inhibits miR-485 (miRNA inhibitor), wherein the miRNA inhibitor increases is capable of increasing the level of: (a) the SIRT1 protein and/or SIRT1 gene, (b) the PGC-1α protein and/or PGC-1α gene, (c) the CD36 protein and/or CD36 gene, (d) the NRG1 protein and/or NRG1 gene, (e) the STMN2 protein and/or STMN2 gene, (f) the NRXN1 protein and/or NRXN1 gene, or (g) any combination of (a) to (f); the method claim1, wherein the miRNA inhibitor comprises a nucleotide sequence comprising 5'-[[ ]]UGUAUGA-3' (SEQ ID NO: 2) and wherein the miRNA inhibitor comprises about 6 to about 30 nucleotides in length; the method claim1, wherein the miRNA inhibitor has a sequence selected from the group consisting of: 5'-UGUAUGA- 3' (SEQ ID NO: 2), 5'-GUGUAUGA-3' (SEQ ID NO: 3), 5'-CGUGUAUGA-3' (SEQ ID NO: 4), 5'- CCGUGUAUGA-3' (SEQ ID NO: 5), 5'-GCCGUGUAUGA-3' (SEQ ID NO: 6), 5'- AGCCGUGUAUGA-3' (SEQ ID NO: 7), 5'-GAGCCGUGUAUGA-3' (SEQ ID NO: 8), 5'- AGAGCCGUGUAUGA-3' (SEQ ID NO: 9), 5'-GAGAGCCGUGUAUGA-3' (SEQ ID NO: 10), 5'- GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 11), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 12), 5'-GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 13), 5'-AGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 14), 5'-GAGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 15); 5'-UGUAUGAC-3' (SEQ ID NO: 16), 5'-GUGUAUGAC-3' (SEQ ID NO: 17), 5'-CGUGUAUGAC-3' (SEQ ID NO: 18), 5'-CCGUGUAUGAC-3' (SEQ ID NO: 19), 5'-GCCGUGUAUGAC-3' (SEQ ID NO: 20), 5'- AGCCGUGUAUGAC-3' (SEQ ID NO: 21), 5'-GAGCCGUGUAUGAC-3' (SEQ ID NO: 22), 5'- AGAGCCGUGUAUGAC-3' (SEQ ID NO: 23), 5'-GAGAGCCGUGUAUGAC-3' (SEQ ID NO: 24), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 25), 5'-AGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 26), 5'-GAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 27), 5'- AGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 28), 5'-GAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 29), and 5'-AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 30), 5'- TGTATGA-3' (SEQ ID NO: 62), 5'-GTGTATGA-3' (SEQ ID NO: 63), 5'-CGTGTATGA-3' (SEQ ID NO: 64), 5'-CCGTGTATGA-3' (SEQ ID NO: 65), 5'-GCCGTGTATGA-3' (SEQ ID NO: 66), 5'- AGCCGTGTATGA-3' (SEQ ID NO: 67), 5'-GAGCCGTGTATGA-3' (SEQ ID NO: 68), 5'- AGAGCCGTGTATGA-3' (SEQ ID NO: 69), 5'-GAGAGCCGTGTATGA-3' (SEQ ID NO: 70), 5'- GGAGAGCCGTGTATGA-3' (SEQ ID NO: 71), 5'-AGGAGAGCCGTGTATGA-3' (SEQ ID NO:72), 5'-GAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 73), 5'-AGAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 74), 5'-GAGAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 75); 5'-TGTATGAC-3' (SEQ ID NO: 76), 5'-GTGTATGAC-3' (SEQ ID NO: 77), 5'-CGTGTATGAC-3' (SEQ ID NO: 78),5'-CCGTGTATGAC-3' (SEQ ID NO: 79), 5'-GCCGTGTATGAC-3' (SEQ ID NO: 80), 5'- AGCCGTGTATGAC-3' (SEQ ID NO: 81), 5'-GAGCCGTGTATGAC-3' (SEQ ID NO: 82), 5'- AGAGCCGTGTATGAC-3' (SEQ ID NO: 83), 5'-GAGAGCCGTGTATGAC-3' (SEQ ID NO: 84),5'-GGAGAGCCGTGTATGAC-3' (SEQ ID NO: 85), 5'-AGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 86), 5'-GAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 87), 5'-AGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 88), 5'-GAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 89), and 5'-AGAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 90); the method of claim1, wherein the miRNA inhibitor [[is]]comprises a nucleotide sequence that has at least about 50%; sequence identity to 5'- [[ ]]AGAGAGGAGAGCCGUGUAUGAC[[ ]]-3' (SEQ ID NO: 30) or 5'-[[ ]]AGAGAGGAGAGCCGTGTATGAC[[ ]]-3' (SEQ ID NO: 90); a method of regulating an expression and/or activity of a copper-zinc superoxide dismutate enzyme (SOD1) in a subject in need thereof comprising administering to the subject a compound that inhibits miR-485 (miRNA inhibitor), wherein the miRNA inhibitor is capable of regulating the expression and/or activity of the SOD1 when administered to the subject; the method of claim 94, wherein the subject suffers from ALS.
It is noted that “503” method represents a species with regard to: A method of treating a brain disease in a subject in need thereof comprising administering a miR - 485-3p inhibitor to the subject , wherein the brain disease is selected from the group consisting of amyotrophic lateral sclerosis ( ALS),autism spectrum disorder, mental retardation, seizure, stroke, Parkinson's disease , spinal cord injury , and combinations thereof, and wherein the miR-485-3p inhibitor comprises a nucleic acid molecule and inhibits expression of miR-485-3p, see “503” claim 1; The method of claim 1, wherein the nucleic acid molecule is selected from a group consisting of a DNA , an RNA , an antagomir , a siRNA , a shRNA , and an oligonucleotide, see “503” claim 4; The method of claim 5, wherein the antisense oligonucleotide comprises the nucleic acid sequence set forth in
SEQ ID NO: 3 , SEQ ID NO: 4 , SEQ ID NO: 5 , SEQ ID NO: 6 , or SEQ ID NO : 7’ see “503” claim 6; The method of claim 5, wherein the antisense oligonucleotide comprises one or more modification selected from: 1) modification to a LNA ( locked nucleic acid ) or PNA ( peptide nucleic acid) form, 2) substitution of the OH group at the 2' carbon of a nucleotide with -CH3 (methyl), and 3) modification of a nucleotide bond to Phosphorothioate, see “503” claim 7; The method of claim 11, wherein the antisense oligonucleotide comprises the nucleic acid sequence set forth
in SEQ ID NO: 3 , SEQ ID NO: 4 , SEQ ID NO: 5 , SEQ ID NO: 6 , or SEQ ID NO: 7, see “053” claim 12; The method of claim 12, wherein the antisense oligonucleotide comprises the nucleic acid sequence set forth
in SEQ ID NO: 7, see “053” claim 15; The method of claim 11, wherein the brain disease is selected from the group consisting of amyotrophic lateral
sclerosis (ALS), autism spectrum disorder, mental retardation, seizure, stroke, Parkinson's disease, spinal cord injury, and combinations thereof, see “503” claim 16; The method of claim 13, wherein the antisense oligonucleotide is 2-O-methylated, see “503” claim 17; The method of claim 7, wherein the antisense oligonucleotide is 2'-O-methylated, see “503” claim 18; The method of claim 6, wherein the antisense oligonucleotide comprises the nucleic acid sequence set forth in SEQ ID NO: 7, see “503” claim 19. The instant claims use the comprising language and therefore the additional steps/components in “503” claims are not excluded.
Thus, the instant claims and the application claims are obvious variants.
Claims 1, 3, 20, 28, 32, 34, 39, 43, 44, 50, 52, 58, 82, 85, 88, and 91-95 rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 4, 6-7, 12-13, 15-19 of U.S. Patent No. US 11,542,503 B2 (“503”) in view of Harada et al. (“Harada”, European Journal of Pharmaceutical Sciences, 2001), Kondo et al. (“Kondo”, US 2018/0334674, November 2018), Mangelsdorf et al. (“Mangelsdorf”, Complement Med Res, 2017), Chien et al. (“Chien”, J. Med. Chem., 2018, 61: 7358-7373) and Hornstein et al. (“Hornstein”, WO 2016/030899 A1).
The teachings of “503” and the secondary documents are discussed above.
It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to construct a micelle -comprising PEG and poly-lysine to deliver miR-485 inhibitor, such micelle comprising vitamin B3 and targeting moiety for the treatment of amyotrophic lateral sclerosis (ALS) in a subject, arriving at the instant invention.
Claims 1, 3, 20, 28, 32, 34, 39, 43, 44, 50, 52, 58, 82, 85, 88, and 91-95 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 4, 6-7, 9-11, 14-15 of copending Application No. 18/149,251 (“251”) in view of Harada et al. (“Harada”, European Journal of Pharmaceutical Sciences, 2001), Kondo et al. (“Kondo”, US 2018/0334674, November 2018), Mangelsdorf et al. (“Mangelsdorf”, Complement Med Res, 2017), Chien et al. (“Chien”, J. Med. Chem., 2018, 61: 7358-7373) and Hornstein et al. (“Hornstein”, WO 2016/030899 A1).
Claims from “251” recite treatment of a number of diseases including amyotrophic lateral sclerosis (ALS) by administering inhibitor of miR-485-3p. Teachings of secondary references are discussed above.
It would have been obvious to one of the ordinary skill in the art to deliver such miR-485-3p inhibitor using micelles comprising vitamin B3 and targeting moieties based on teachings of the secondary references for treatment of amyotrophic lateral sclerosis (ALS), arriving at instant invention.
This is a provisional nonstatutory double patenting rejection.
Claims 1, 3, 20, 28, 32, 34, 39, 43, 44, 50, 52, 58, 82, 85, 88, and 91-95 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-23 of U.S. Patent No. 11,839,624 (“624”, cited as a reference on IDS filed 05/01/2024) in view of Ryu et al. (“Ryu”, WO 2018/139819, January 2018, cited from machine translation) and Hornstein et al. (“Hornstein”, WO 2016/030899 A1).
Claims from “624” recite micelles for delivery of anionic payload such as miR inhibitors. Teachings of Ryu and Hornstein are discussed above.
It would have been obvious to one of the ordinary skill in the art to use micelles from “624” for delivery of miR inhibitor of Ryu and Horsntein for treatment of amyotrophic lateral sclerosis (ALS), arriving at instant invention.
Claims 1, 3, 20, 28, 32, 34, 39, 43, 44, 50, 52, 58, 82, 85, 88, and 91-95 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2, 8, 15, 20, 29, 35, 36, 38, 42-44, 58, 72-75, 78, 84-86 of copending Application No. 17/622,518 (“518”) in view of Ryu et al. (“Ryu”, WO 2018/139819, January 2018, cited from machine translation) and Hornstein et al. (“Hornstein”, WO 2016/030899 A1).
Claims from “518” recite micelles for delivery of anionic payload such as miR inhibitors. Teachings of Ryu and Hornstein are discussed above.
It would have been obvious to one of the ordinary skill in the art to use micelles from “518” for delivery of miR inhibitor of Ryu and Horsntein for treatment of amyotrophic lateral sclerosis (ALS), arriving at instant invention.
This is a provisional nonstatutory double patenting rejection.
Claims 1, 3, 20, 28, 32, 34, 39, 43, 44, 50, 52, 58, 82, 85, 88, and 91-95 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 93-94, 98-99, 123-138 of copending Application No. 18/503,748 (“748”) in view of Ryu et al. (“Ryu”, WO 2018/139819, January 2018, cited from machine translation) and Hornstein et al. (“Hornstein”, WO 2016/030899 A1).
Claims from “748” recite micelles for delivery of anionic payload such as miR inhibitors. Teachings of Ryu and Hornstein are discussed above.
It would have been obvious to one of the ordinary skill in the art to use micelles from “748” for delivery of miR inhibitor of Ryu and Horsntein for treatment of amyotrophic lateral sclerosis (ALS), arriving at instant invention.
This is a provisional nonstatutory double patenting rejection.
Claims 1, 3, 20, 28, 32, 34, 39, 43, 44, 50, 52, 58, 82, 85, 88, and 91-95 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2, 14-16, 19, 23, 25, 30, 34-35, 41, 43, 49, 55, 64, 76, 78, of copending Application No. 17/760,345 (“345”) in view of Ryu et al. (“Ryu”, WO 2018/139819, January 2018, cited from machine translation) and Hornstein et al. (“Hornstein”, WO 2016/030899 A1).
Claims from “345” recite treatment of tauopathy, associated with abnormal expression of SIRT1, by administering miR-485 inhibitors identical to instantly claimed using micelles identical to instantly claimed, anticipating instant claims. Teachings of Ryu and Hornstein are discussed above.
It would have been obvious to one of the ordinary skill in the art to use micelles for delivering miR inhibitor from “748” for treatment of amyotrophic lateral sclerosis (ALS) of Ryu and Horsntein, arriving at instant invention.
This is a provisional nonstatutory double patenting rejection.
Claims 1, 3, 20, 28, 32, 34, 39, 43, 44, 50, 52, 58, 82, 85, 88, and 91-95 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3, 6-8, 18, 22, 24, 33-35, 40, 73, 77, of copending Application No. 17/906,175 (“175”) in view of Ryu et al. (“Ryu”, WO 2018/139819, January 2018, cited from machine translation) and Hornstein et al. (“Hornstein”, WO 2016/030899 A1).
Claims from “175” recite treatment of diseases associated with abnormal expression of SIRT1, by administering micelles comprising miR-485 inhibitors identical to instantly claimed, anticipating instant claims. Teachings of Ryu and Hornstein are discussed above.
It would have been obvious to one of the ordinary skill in the art to use micelles for delivering miR inhibitor from “145” for treatment of amyotrophic lateral sclerosis (ALS) of Ryu and Horsntein, arriving at instant invention.
This is a provisional nonstatutory double patenting rejection.
Claims 1, 3, 20, 28, 32, 34, 39, 43, 44, 50, 52, 58, 82, 85, 88, and 91-95 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3, 6-8, 12-13, 18, 22, 24, 33-35, 40, 73, 76-77 of copending Application No. 17/906,174 (“174”) in view of Ryu et al. (“Ryu”, WO 2018/139819, January 2018, cited from machine translation) and Hornstein et al. (“Hornstein”, WO 2016/030899 A1).
Claims from “174” recite treatment of diseases associated with abnormal expression of PGC-1α, by administering micelles carrying miR-485 inhibitors identical to instantly claimed, anticipating instant claims. Teachings of Ryu and Hornstein are discussed above.
It would have been obvious to one of the ordinary skill in the art to use micelles for delivering miR inhibitor from “174” for treatment of amyotrophic lateral sclerosis (ALS) of Ryu and Horsntein, arriving at instant invention.
This is a provisional nonstatutory double patenting rejection.
Claims 11, 3, 20, 28, 32, 34, 39, 43, 44, 50, 52, 58, 82, 85, 88, and 91-95 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 2, 4, 12-13, 19, 21-22, 25, 28, 31-32, 41, 47-48, 50, 64, 66, 71 of copending Application No. 17/997,000 in view of Ryu et al. (“Ryu”, WO 2018/139819, January 2018, cited from machine translation) and Hornstein et al. (“Hornstein”, WO 2016/030899 A1).
Claims from ‘000 recite treatment of cognitive disorders by administering micelles comprising miR-485 inhibitors identical to instantly claimed, anticipating instant claims. Teachings of Ryu and Hornstein are discussed above.
It would have been obvious to one of the ordinary skill in the art to use micelles for delivering miR inhibitor from “000” for treatment of amyotrophic lateral sclerosis (ALS) of Ryu and Horsntein, arriving at instant invention.
This is a provisional nonstatutory double patenting rejection.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JULIO GOMEZ RODRIGUEZ whose telephone number is (571)270-0991. The examiner can normally be reached Monday - Friday 8:00 am - 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 5712722916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JULIO WASHINGTON GOMEZ RODRIGUEZ/Examiner, Art Unit 1637
/J. E. ANGELL, Ph.D./Primary Examiner, Art Unit 1637