Prosecution Insights
Last updated: August 15, 2026
Application No. 17/769,524

METHODS FOR MODULATING HUMAN L1 RETROTRANSPOSONS RNA AND COMPOSITIONS FOR USE THEREIN

Final Rejection §102§103
Filed
Apr 15, 2022
Priority
Oct 16, 2019 — provisional 62/916,096 +2 more
Examiner
KIM, TAEYOON
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Salk Institute for Biological Studies
OA Round
2 (Final)
52%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allowance Rate
458 granted / 888 resolved
-8.4% vs TC avg
Strong +52% interview lift
Without
With
+51.8%
Interview Lift
resolved cases with interview
Typical timeline
3y 9m
Avg Prosecution
64 currently pending
Career history
957
Total Applications
across all art units

Statute-Specific Performance

§101
5.2%
-34.8% vs TC avg
§103
36.4%
-3.6% vs TC avg
§102
13.7%
-26.3% vs TC avg
§112
30.2%
-9.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 888 resolved cases

Office Action

§102 §103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s amendment and response filed on 3/27/2026 has been received and entered into the case. Claims 5, 8, 12, 15 have been canceled, claims 25-30 are newly added, claims 1-4, 6-7, 9-11, 13-14, 16 and 21-24 have been withdrawn from consideration as being drawn to non-elected subject matter, and claims 17-20 and 25-30 have been considered on the merits. All arguments have been considered. The claim rejection under 35 USC 101 has been withdrawn due to the instant amendment. The claim rejections under 35 USC 102 have been withdrawn due to the instant amendment. The claim rejection under 35 USC 103 has been withdrawn due to the instant amendment. Claim Objections Claims 17 and 19 are objected to because of the following informalities: the terms would be in a full name followed by abbreviations in the parenthesis. For example, “L1 (Long interspersed element 1)” would be more appropriate as “Long interspersed element 1 (L1)” instead. Appropriate correction is required. Claim Interpretation Claim 17 is interpreted as a composition comprising an oligonucleotide sequence up to 50 nucleotides in length having a sequence of SEQ ID NOs as claimed and a pharmaceutically acceptable carrier. The term “antisense” does not mean anything in their structure as the sequence is defined by the SEQ ID NOs. The intended purpose or use of the composition for reducing L1 RNA or the agent inhibiting L1 RNA expression does not provide any structure to the claimed oligonucleotide, and thus, does not provide any patentable weight in determining patentability of the claimed composition. Claim 18 is directed to the carrier being a nanocarrier. Claim 19 is interpreted as the composition of claim 17 having an oligonucleotide comprising one of SEQ ID NOs: 57-76. Claim 20 is directed to the length of the oligonucleotide being up to 24 nucleotides in length. Claims 25-27 are interpreted as the composition of claim 17 having an oligonucleotide comprising one of SEQ ID NOs: 77-96, 97-116, or 117-127, respectively. Claim 28 is directed to the nanocarrier being a liposome. Claim 29 is interpreted the same as claim 17 as the wherein clause does not provide any structure to the composition, rather it is directed to the intended result when the product is used as directed. Claim 30 is interpreted the same as claim 17 but without limiting the specific SEQ ID NOs. As discussed above, the wherein clause does not provide any structure to the composition, rather it is directed to the intended result when the product is used as directed. Claim Rejections - 35 USC § 102 (New) The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 17-18, 20, 25 and 29-30 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Porteus et al. (US 2018/0273609) The claims are interpreted as discussed above under “claim interpretation”. Porteus et al. teach the list of gRNA 22 bp spacer sequences of SEQ ID NOs:75,146-161,197 (para. 66), and SEQ ID NO: 125894 has 100% identity with SEQ ID NO: 82 of the instant application (see alignment below). Thus, the gRNA spacer sequence of Proteus et al. is an oligonucleotide comprising SEQ ID NO: 82 of claims 17(ii) and 25. RESULT 3 US-15-762-700-125894 (NOTE: this sequence has 1 duplicate in the database searched) Sequence 125894, US/15762700 Patent No. 12043843 GENERAL INFORMATION APPLICANT: CRISPR Therapeutics AG TITLE OF INVENTION: MATERIALS AND METHODS FOR TREATMENT OF HEMOGLOBINOPATHIES FILE REFERENCE: 116339-8 CURRENT APPLICATION NUMBER: US/15/762,700 CURRENT FILING DATE: 2018-03-23 NUMBER OF SEQ ID NOS: 161315 SEQ ID NO 125894 LENGTH: 22 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: chemically synthesized Query Match 100.0%; Score 21; Length 22; Best Local Similarity 100.0%; Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATCGTCTGAAGCCTTCTTCTC 21 ||||||||||||||||||||| Db 1 ATCGTCTGAAGCCTTCTTCTC 21 Regarding the pharmaceutically acceptable carrier, wherein the carrier being nanocarrier which is liposome, Porteus et al. teach that the nucleic acid encoding a nucleic acid-targeting nucleic acid are packaged into liposomes (para. 285). Thus, the reference anticipates the claimed invention. Claim(s) 17-20, 26 and 29-30 is/are rejected is/are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Kabadi et al. (US2019/0374655A1; priority date of 10/28/2015) The claims are interpreted as discussed above under “claim interpretation”. Kabadi et al. teach a list of gRNA 20-24 bp spacer sequences for targeting dystrophin gene (para. 87). SEQ ID NO: 1195619 (22 bp gRNA) of the list comprises SEQ ID NO: 57 (claims 17 and 19) and SEQ ID NO:772238 (22 bp gRNA) of the list comprises SEQ ID NO: 101 (claims 17 and 26) (see alignment below). SEQ ID NO:57 US-15-763-328-1195619 (NOTE: this sequence has 1 duplicate in the database searched) Sequence 1195619, US/15763328 Publication No. US20190374655A1 GENERAL INFORMATION APPLICANT: CRISPR Therapeutics AG TITLE OF INVENTION: MATERIALS AND METHODS FOR TREATMENT OF DUCHENNE MUSCULAR TITLE OF INVENTION: DYSTROPHY (DMD) FILE REFERENCE: 160101PCT / CT6-PCT CURRENT APPLICATION NUMBER: US/15/763,328 CURRENT FILING DATE: 2018-03-26 PRIOR APPLICATION NUMBER: US 62/247,484 PRIOR FILING DATE: 2015-10-28 PRIOR APPLICATION NUMBER: US 62/324,064 PRIOR FILING DATE: 2016-04-18 NUMBER OF SEQ ID NOS: 1410475 SEQ ID NO 1195619 LENGTH: 22 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: chemically synthesized Query Match 100.0%; Score 21; Length 22; Best Local Similarity 100.0%; Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GTACCTCAGATGGAAATGCAG 21 ||||||||||||||||||||| Db 1 GTACCTCAGATGGAAATGCAG 21 SEQ ID NO:101 US-15-763-328-772238 (NOTE: this sequence has 1 duplicate in the database searched) Sequence 772238, US/15763328 Publication No. US20190374655A1 GENERAL INFORMATION APPLICANT: CRISPR Therapeutics AG TITLE OF INVENTION: MATERIALS AND METHODS FOR TREATMENT OF DUCHENNE MUSCULAR TITLE OF INVENTION: DYSTROPHY (DMD) FILE REFERENCE: 160101PCT / CT6-PCT CURRENT APPLICATION NUMBER: US/15/763,328 CURRENT FILING DATE: 2018-03-26 PRIOR APPLICATION NUMBER: US 62/247,484 PRIOR FILING DATE: 2015-10-28 PRIOR APPLICATION NUMBER: US 62/324,064 PRIOR FILING DATE: 2016-04-18 NUMBER OF SEQ ID NOS: 1410475 SEQ ID NO 772238 LENGTH: 22 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: chemically synthesized Query Match 100.0%; Score 21; Length 22; Best Local Similarity 100.0%; Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TAATTGCAGAATTTAGTCCAT 21 ||||||||||||||||||||| Db 1 TAATTGCAGAATTTAGTCCAT 21 Regarding the pharmaceutically acceptable carrier, wherein the carrier being nanocarrier which is liposome, Kabadi et al. teach that the nucleic acid encoding a genome-targeting nucleic acid of the disclosure can be packaged into or on the surface of delivery vehicles for delivery to cells and the delivery vehicles include but are not limited to nanospheres, liposomes, nanoparticles (para. 356). Thus, the reference anticipates the claimed invention. Claim Rejections - 35 USC § 103 (New) In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 17-20 and 25-30 is/are rejected under 35 U.S.C. 103 as being unpatentable over in view of Bondarev et al. (US2015/0094215; of record). The claims are interpreted as discussed above under “claim interpretation”. Bondarev et al. teach the use of antisense strategy to suppress L1 reverse transcriptase (para. 9), and the inhibitor or antagonist of the L1RT can be an inorganic compound, an organic compound, an antisense sequence, a double-stranded RNA corresponding to a defined target region in L1RT mRNA, a dominant negative mutant of the L1RT protein, an antibody or a small molecule (para. 25). Bondarev et al. teach antisense oligonucleotide(s) or antisense polynucleotide(s) are used as inhibitors or antagonists of L1RT (para. 32), and a series of antisense phosphorothioate oligonucleotides, 20 or more nucleotides in length, targeting the nucleic acid encoding L1RT are designed to bind to the promoter or other control regions and coding and/or non-coding regions of L1RT (para. 33). Regarding the specific ASO sequences disclosed in claims 17-18 and 25-27, Bondarev et al. do not particularly teach any of these sequences as ASO. However, it would have been obvious to a person skilled in the art to design ASO sequence against the L1RT sequences including those claimed because one skilled in the art would readily know how to design ASO against L1RT. The claimed ASO sequences are considered to belong those antisense sequences obtained by routine experimentations. Regarding the pharmaceutically acceptable carrier, Bondarev et al. teach that the inhibitor or antagonist is optionally administered with a pharmaceutically acceptable carrier (para. 10). Bondarev et al. teach that a pharmaceutical composition comprising antisense oligonucleotides can be delivered with a delivery vehicle such as a liposome (para. 76). Thus, this teaching would meet the limitations of claims 18 and 28. Regarding the antisense oligonucleotide (ASO) being L1 RNA, L1 ORF1 RNA and/or L1 ORF2 RNA or complementary to the fragment thereof, the teachings of Bondarev et al. as discussed above would meet the limitation. The teaching of the antisense oligonucleotide of 20 nucleotides in length (para. 33) would meet the optional limitation in claim 20. Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention. Claim(s) 17-20 and 28-30 is/are rejected 35 U.S.C. 103 as being unpatentable over Ambati (WO2011/153234) in view of Bondarev et al. (supra). The claims are interpreted as discussed above under “claim interpretation”. Ambati teaches a primer for LINE Ll.3 (ORF2), and the sequence of the primer comprises SEQ ID NO:60 of the instant claim (para. 150). Thus, the primer, which is considered to meet the claimed composition as it is an oligonucleotide of 22 nucleotide long. AZQ21967 ID AZQ21967 standard; DNA; 22 BP. XX AC AZQ21967; XX DT 19-JAN-2012 (first entry) XX DE Human LINE L1.3 (ORF2) specific reverse real time (RT) PCR primer. WO2011153234-A2 Query Match 100.0%; Score 21; Length 22; Best Local Similarity 100.0%; Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GTCTGGCACTCCCTAGTGAGA 21 ||||||||||||||||||||| Db 2 GTCTGGCACTCCCTAGTGAGA 22 Ambati do not teach the pharmaceutically acceptable carrier, wherein the carrier being nanocarrier which is liposome. Bondarev et al. teach that the inhibitor or antagonist is optionally administered with a pharmaceutically acceptable carrier (para. 10). Bondarev et al. teach that a pharmaceutical composition comprising oligonucleotides can be delivered with a delivery vehicle such as a liposome (para. 76). It would have been obvious to a person skilled in the art to use the liposome taught by Bondarev et al. for the oligonucleotide primer for LINE1 taught by Ambati because liposome is taught to be suitable for the delivery of oligonucleotides. Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention. Claim(s) 17-18, 20 and 27-30 is/are rejected 35 U.S.C. 103 as being unpatentable over Rigoutsos et al. (US 8178503) in view of Burwinkel et al. (WO2019/081507) and Bondarev et al. (supra). The claims are interpreted as discussed above under “claim interpretation”. Rigoutsos et al. teach that the region or sequence that can be used in designing an interfering RNA molecule including SEQ ID NO: 92418, and this sequence has 100% identity to the claimed SEQ ID NO:120. Thus, it would have been obvious to a person skilled in the art to use SEQ ID NO: 92418 as an antisense oligonucleotide. RESULT 1 US-11-408-557-92418 Sequence 92418, US/11408557 Patent No. 8178503 Query Match 100.0%; Score 21; Length 21; Best Local Similarity 100.0%; Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CTGGTGCGCTGCACCCACTAA 21 ||||||||||||||||||||| Db 1 CTGGTGCGCTGCACCCACTAA 21 One skilled in the art would recognize that the SEQ ID NO: 92418 of Rigoutsos et al. would be complementary to human LINE 1 consensus sequence taught by Burwinkel et al. (SEQ ID NO: 3), and the SEQ ID NO: 3 of Burwinkel et al. is identical to SEQ ID NO: 1 of the instant application. Rigoutsos et al. do not teach the pharmaceutically acceptable carrier, wherein the carrier being nanocarrier which is liposome. Bondarev et al. teach that the inhibitor or antagonist is optionally administered with a pharmaceutically acceptable carrier (para. 10). Bondarev et al. teach that a pharmaceutical composition comprising antisense oligonucleotides can be delivered with a delivery vehicle such as a liposome (para. 76). It would have been obvious to a person skilled in the art to use the liposome taught by Bondarev et al. for the oligonucleotides designed based on SEQ ID NO:92418 of Rigoutsos et al. because liposome is taught to be suitable for the delivery of antisense oligonucleotides. Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention. Response to Arguments Applicant’s arguments with respect to claim(s) 17-20 have been considered but are moot because the new ground of rejection does not rely on any reference applied in the prior rejection of record for any teaching or matter specifically challenged in the argument. As indicated above, the instant amendment has overcome the claim rejections under 101, 102 and 103. However, new rejections are necessitated by the amendment as presented above. Conclusion No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to TAEYOON KIM whose telephone number is (571)272-9041. The examiner can normally be reached 9-5 EST Monday-Friday. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JAMES SCHULTZ can be reached at 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /TAEYOON KIM/Primary Examiner, Art Unit 1631
Read full office action

Prosecution Timeline

Apr 15, 2022
Application Filed
Oct 01, 2025
Non-Final Rejection mailed — §102, §103
Mar 27, 2026
Response Filed
May 26, 2026
Final Rejection mailed — §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12698474
B-cell cultivation method
7y 1m to grant Granted Aug 04, 2026
Patent 12685774
CELL/GENE THERAPIES TARGETING MAGE-A4 PEPTIDE
3y 7m to grant Granted Jul 21, 2026
Patent 12668778
METHOD FOR EXPANSION OF DOUBLE NEGATIVE REGULATORY T CELLS
3y 6m to grant Granted Jun 30, 2026
Patent 12661377
COMBINATION THERAPY COMPRISING A COMPOSITION OF MESENCHYMAL STROMAL CELLS AND HYALURONIC ACID FOR USE IN TREATMENT OF OSTEOARTHRITIS
3y 5m to grant Granted Jun 23, 2026
Patent 12648967
Post-Natal Transplantation Of Factor VIII-Expressing Cells For Treatment of Hemophilia
3y 2m to grant Granted Jun 09, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+51.8%)
3y 9m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 888 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month