DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group IV (claims 44-45) in the reply filed on 05/23/2025 is acknowledged. However Groups I-V were rejoined in the previous action, thus the elected invention reads on claims 35-48. Claims 35-50 are pending. Claims 49-50 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected group, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 05/23/2025.
Claims Status
Claims 1-34, 37 and 41 are canceled, no claims are newly added, claims 49-50 have been withdrawn from consideration as being drawn to non-elected subject matter, and claims 35-36 and 38-48 have been considered on the merits. All arguments have been considered.
Withdrawn Objections & Rejections
Applicant's response filed 12/08/2025 has been considered. Rejections and/or objections not reiterated from the previous Office action mailed 08/08/2025 are hereby withdrawn. Rejections drawn to 112(b), 102 and 103 in the previous action are withdrawn due to the claim amendments filed 12/08/2025.
The objections and rejections presented herein represent the full set of objections and rejections currently pending in the application.
Claim Objections (new)
Claim 40 objected to because of the following informalities: the claim refers to the activated receptor of claim 35 and omits the word “domain”. This is considered a typing error and the objection would be overcome if the claim were amended to read “The B-cell antibody receptor of claim 35, wherein the activated receptor domain is TCR or NKG2D”.
Appropriate correction is required.
Claim Rejections - 35 USC § 103 (new)
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim 35-36, 38, 40 and 42-48 are rejected under 35 U.S.C. 103 as being unpatentable over Ellebrecht et al (Science(2016) 353:6295;179-184, cited previously) in view of Lenders et al (J Am Soc Nephrol(2018)29;1-14; cited previously) and Miyamura et al (US 6210666; 2001).
Regarding claim 35: The claim recites (a)-(d) inclusively, therefore all four components are required by the claim. The claim recites (A)-(E) in the alternative (or), therefore only one of (A)-(E) is required by the claim.
Ellebrecht teach the autoimmune disease pemphigus vulgaris (PV) is caused by autoantibodies to the protein Dsg3. Ellebrecht further teach targeted B cell depletion mediated by a chimeric autoantibody receptor (CAAR) comprising the autoantigen Dsg3 and signaling domains causes remission in the autoimmune disease pemphigus vulgaris (abstract, p179 col1 ¶1).
Ellebrecht teach a chimeric immunoreceptor specific for B cells bearing the specific B-cell antibody anti-Dsg3, wherein the extracellular domain of the receptor comprises an antibody binding domain (Dsg3) (p179 col1/2 para 2/1). This reads on a B-cell antibody receptor comprising an antibody binding domain of (a).
Ellebrecht disclose the chimeric immunoreceptor comprises an antibody binding domain (as discussed supra) as required by (a), a transmembrane domain (as required by (b)), and two intracellular domains (Fig S1(a)). Ellebrecht further teach the intracellular signaling domains are a costimulatory factor and an activated receptor (CD3 zeta) (abstract, p179 col2 para2) (as required by (c) and (d)).
Regarding (A) wherein the antibody binding domain comprises a full-length protein having at least 95% identity with the full-length sequence of Seq ID NO: 10; Ellebrecht teach expressing an antigen as the extracellular domain of a chimeric immunoreceptor to direct cytotoxicity specifically to only those B cells bearing antibody receptors specific to the antigen (p179 col1/2 para2/1, figure, p181 col1 para1). Ellebrecht also teach various combinations of chimeric antigen receptors could be combined to maximize efficacy in diseases in which autoantibodies targeting multiple autoantigens are pathogenic (p183 col1 ¶1).
Thus Ellebrecht teach a method of specifically targeting B cells which generate antibodies that cause disease (e.g. autoantigens) which represents a therapeutic strategy that avoids the risks of general immunosuppression and can be applied to other diseases (p183 col1 ¶1).
Ellebrecht do not teach the antigen (antibody binding domain) comprises a full-length protein of alpha galactosidase A comprising an amino acid sequence having at least 95% identity with the full-length amino acid sequence set forth in Seq ID NO: 10.
Lenders teach Fabry disease is caused by mutations in the alpha-galactosidase A gene (p1 col1 para1). Lenders teach that recombinant enzyme replacement therapy is a standard treatment for Fabry disease. Lenders further teach that antibodies against the enzyme replacement therapy (antibodies against alpha-galactosidase A) reduce the efficiency of enzyme replacement therapy for many patients (40% of treated males have a problematic antibody response to the enzyme replacement therapy) (p1 col2 para3).
One of ordinary skill in the art would understand that antibodies generated against the enzyme during replacement therapy (alpha-galactosidase) are generated by antibody producing B cells. Lenders further teach that specific B cell depletion and immunomodulation before enzyme replacement therapy can induce immune tolerance and block the immune response to recombinant alpha-glucosidase, and that intense and unspecific immunosuppression as used for transplantation might prevent a problematic antibody response (p8 col2 ¶1).
Lenders do not teach a specific amino acid sequence for human alpha-galactosidase having at least 95% identity with the full-length sequence as set forth in Seq ID NO: 10.
Seq ID NO: 10 is an amino acid sequence comprising 398 residues and encodes the full length sequence of the human GLA (alpha gal) protein (instant specification p19 ¶3).
Miyamura teach Fabry disease results from a deficiency in the enzyme alpha galactosidase A and that recombinant forms of the enzyme are useful for treatment of patients with the disease (abstract).
Miyamura further teach the sequence of human alpha-galactosidase A is set forth in sequence 43, a nucleic acid sequence encoding an amino acid sequence that comprises 100% sequence identity with Seq ID NO: 10 of the instant disclosure (see below; Qy is the instant Seq ID NO: 10 and Db is sequence 43 of Miyamura)
Qy 1 LeuAspAsnGlyLeuAlaArgThrProThrMetGlyTrpLeuHisTrpGluArgPheMet 20
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 CTGGACAATGGATTGGCAAGGACGCCTACCATGGGCTGGCTGCACTGGGAGCGCTTCATG 60
Qy 21 CysAsnLeuAspCysGlnGluGluProAspSerCysIleSerGluLysLeuPheMetGlu 40
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 TGCAACCTTGACTGCCAGGAAGAGCCAGATTCCTGCATCAGTGAGAAGCTCTTCATGGAG 120
Qy 41 MetAlaGluLeuMetValSerGluGlyTrpLysAspAlaGlyTyrGluTyrLeuCysIle 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 ATGGCAGAGCTCATGGTCTCAGAAGGCTGGAAGGATGCAGGTTATGAGTACCTCTGCATT 180
Qy 61 AspAspCysTrpMetAlaProGlnArgAspSerGluGlyArgLeuGlnAlaAspProGln 80
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 GATGACTGTTGGATGGCTCCCCAAAGAGATTCAGAAGGCAGACTTCAGGCAGACCCTCAG 240
Qy 81 ArgPheProHisGlyIleArgGlnLeuAlaAsnTyrValHisSerLysGlyLeuLysLeu 100
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 CGCTTTCCTCATGGGATTCGCCAGCTAGCTAATTATGTTCACAGCAAAGGACTGAAGCTA 300
Qy 101 GlyIleTyrAlaAspValGlyAsnLysThrCysAlaGlyPheProGlySerPheGlyTyr 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 GGGATTTATGCAGATGTTGGAAATAAAACCTGCGCAGGCTTCCCTGGGAGTTTTGGATAC 360
Qy 121 TyrAspIleAspAlaGlnThrPheAlaAspTrpGlyValAspLeuLeuLysPheAspGly 140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 TACGACATTGATGCCCAGACCTTTGCTGACTGGGGAGTAGATCTGCTAAAATTTGATGGT 420
Qy 141 CysTyrCysAspSerLeuGluAsnLeuAlaAspGlyTyrLysHisMetSerLeuAlaLeu 160
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 TGTTACTGTGACAGTTTGGAAAATTTGGCAGATGGTTATAAGCACATGTCCTTGGCCCTG 480
Qy 161 AsnArgThrGlyArgSerIleValTyrSerCysGluTrpProLeuTyrMetTrpProPhe 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 481 AATAGGACTGGCAGAAGCATTGTGTACTCCTGTGAGTGGCCTCTTTATATGTGGCCCTTT 540
Qy 181 GlnLysProAsnTyrThrGluIleArgGlnTyrCysAsnHisTrpArgAsnPheAlaAsp 200
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 541 CAAAAGCCCAATTATACAGAAATCCGACAGTACTGCAATCACTGGCGAAATTTTGCTGAC 600
Qy 201 IleAspAspSerTrpLysSerIleLysSerIleLeuAspTrpThrSerPheAsnGlnGlu 220
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 601 ATTGATGATTCCTGGAAAAGTATAAAGAGTATCTTGGACTGGACATCTTTTAACCAGGAG 660
Qy 221 ArgIleValAspValAlaGlyProGlyGlyTrpAsnAspProAspMetLeuValIleGly 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 661 AGAATTGTTGATGTTGCTGGACCAGGGGGTTGGAATGACCCAGATATGTTAGTGATTGGC 720
Qy 241 AsnPheGlyLeuSerTrpAsnGlnGlnValThrGlnMetAlaLeuTrpAlaIleMetAla 260
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 721 AACTTTGGCCTCAGCTGGAATCAGCAAGTAACTCAGATGGCCCTCTGGGCTATCATGGCT 780
Qy 261 AlaProLeuPheMetSerAsnAspLeuArgHisIleSerProGlnAlaLysAlaLeuLeu 280
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 781 GCTCCTTTATTCATGTCTAATGACCTCCGACACATCAGCCCTCAAGCCAAAGCTCTCCTT 840
Qy 281 GlnAspLysAspValIleAlaIleAsnGlnAspProLeuGlyLysGlnGlyTyrGlnLeu 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 841 CAGGATAAGGACGTAATTGCCATCAATCAGGACCCCTTGGGCAAGCAAGGGTACCAGCTT 900
Qy 301 ArgGlnGlyAspAsnPheGluValTrpGluArgProLeuSerGlyLeuAlaTrpAlaVal 320
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 901 AGACAGGGAGACAACTTTGAAGTGTGGGAACGACCTCTCTCAGGCTTAGCCTGGGCTGTA 960
Qy 321 AlaMetIleAsnArgGlnGluIleGlyGlyProArgSerTyrThrIleAlaValAlaSer 340
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 961 GCTATGATAAACCGGCAGGAGATTGGTGGACCTCGCTCTTATACCATCGCAGTTGCTTCC 1020
Qy 341 LeuGlyLysGlyValAlaCysAsnProAlaCysPheIleThrGlnLeuLeuProValLys 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1021 CTGGGTAAAGGAGTGGCCTGTAATCCTGCCTGCTTCATCACACAGCTCCTCCCTGTGAAA 1080
Qy 361 ArgLysLeuGlyPheTyrGluTrpThrSerArgLeuArgSerHisIleAsnProThrGly 380
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1081 AGGAAGCTAGGGTTCTATGAATGGACTTCAAGGTTAAGAAGTCACATAAATCCCACAGGC 1140
Qy 381 ThrValLeuLeuGlnLeuGluAsnThrMetGlnMetSerLeuLysAspLeuLeu 398
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1141 ACTGTTTTGCTTCAGCTAGAAAATACAATGCAGATGTCATTAAAAGACTTACTT 1194
It would have been prima facia obvious to modify the composition of Ellebrecht, drawn to a B-cell antibody receptor comprising an antibody binding domain comprising the Dsg3 protein to target B cells which produce anti-Dsg3 antibodies with the teaching of Lenders and Miyamura, to target B cells which produce antibodies against alpha galactosidase A by modifying the B-cell antibody receptor to comprise an antibody binding domain comprising the full length alpha galactosidase A protein, which would be encoded by the nucleic acid sequence taught by Miyamura.
One would have been motivated to modify the antibody binding domain comprising the Dsg3 protein as taught by Ellebrecht with the amino acid sequence of alpha-galactosidase A as taught by Miyamura because doing so represents a method to reduce the specific B cells that produce antibodies against alpha galactosidase during enzyme replacement therapy, as taught by Lenders. One would also be motivated because Ellebrecht teach targeting the B cells which generate the specific autoantibody, or pathogenic antibody, avoids the risks of general immunosuppression and can likely be applied to other autoantibody-mediated diseases.
One would have had a reasonable expectation of success because Ellebrecht demonstrates the efficacy of targeted B cell depletion and further teach the method can likely be applied to additional diseases.
Regarding claim 36: Ellebrecht teach the chimeric immunoreceptor comprises a flexible linker adjacent to the extracellular antigen binding domain (Table S1, Supplementary Materials and Methods p2 para1).
Regarding claim 38: Ellebrecht teach the transmembrane domain is the CD8 alpha transmembrane domain (p179 col2 para2).
Regarding claim 39: The teachings of Ellebrecht are discussed supra. Ellebrecht also teach the costimulatory domain is CD137, which is also known as 4-1BB (p179 col2 ¶2).
Regarding claim 40: The teachings of Ellebrecht are discussed supra. Ellebrecht also teach the intracellular domain of an activated receptor is CD3 zeta (abstract, p179 col2 para2), which one of ordinary skill in the art would recognize as a TCR activation domain.
Regarding claim 42, 43: Ellebrecht teach a lentiviral vector for stable receptor expression (Fig 1A). A lentiviral vector for expression of the receptor will comprise a polynucleotide encoding the receptor.
Regarding claims 44, 45: Ellebrecht teach primary human CD4+/CD8+ human T cells are transduced with the engineered receptor and expression validated by flow cytometry (sup methods p3/4 para 5/1, Fig S1B,C). This reads on an immune cell expressing the B cell antibody receptor is a CD8 T cell, as required by the claim.
Regarding claims 46: The teachings of Ellebrecht are discussed supra. Ellebrecht also teach chimeric antigen receptors directed to autoantibodies represent a therapeutic strategy (a medicinal product) that avoids the risks of general immunosuppression and could be applied to other autoantibody-mediated diseases.
Because the chimeric antigen receptors are directed to autoantibodies, they read on an active ingredient.
Regarding claims 47 and 48: The teachings of Ellebrecht are discussed supra. The disclosure if Ellebrecht is drawn to therapy for autoimmune disease with the goal of eliminating pathogenic autoimmune cells while sparing protective immunity (Abstract). Ellebrecht T cells are directed to kill autoreactive B lymphocytes via expression of a chimeric autoantibody receptor (CAAR) which comprises the autoantigen fused to intracellular signaling domains (Abstract). The CAAR-T cells taught by Ellebrecht specifically eliminate the autoimmune targeted B cells in vivo (abstract).
Ellebrecht do not teach treating lysosomal storage disease wherein the lysosomal storage disease is Fabry disease.
Lenders teach Fabry disease is caused by mutations in the alpha-galactosidase A gene (p1 col1 para1). Lenders teach recombinant enzyme replacement therapy is a treatment for Fabry disease, however about 40% of treated males develop neutralizing antidrug antibodies that cause attenuation of therapy efficacy (p1 col2 para3).
It would have been prima facia obvious to modify the invention of Ellebrecht, drawn to a CAAR T receptor comprising a Dsg3 antibody binding domain by substitute an alpha-galactosidase antibody binding domain in place of the Dsg3 antibody binding domain of the CAAR T receptor because Lenders teach about 40% of males develop neutralizing antibodies to enzyme replacement therapy and the invention of Ellebrecht is drawn to eliminating pathogenic autoimmune cells while sparing protective immunity.
One would be motivated to modify the invention of Ellebrecht with an alpha-galactosidase antibody binding domain because Lenders teach B cells generating antibodies against alpha-galactosidase is a challenge in treatment for Fabry disease.
There would have been a reasonable expectation of success that swapping the antibody binding domain taught by Ellebrecht for an antibody binding domain directed to anti alpha-galactosidase antibodies (the full length alpha-galactosidase protein) would facilitate treatment of Fabry disease by neutralizing antidrug antibodies, and the results would have been predictable, because one of ordinary skill in the art would recognize that swapping receptor domains to alter receptor specificity and activity is common practice.
Thus the teachings of Ellebrecht, June and Lenders render obvious the invention as claimed.
Response to Arguments
The responses are directed to the Arguments filed 12/08/2025.
Regarding Arguments directed to 35 USC § 112:
The amendments to claims overcome the rejections to claims 36 and 46-48. Specifically, the phrase “cell medicine” was removed and clarifying language was added to claim 36.
Therefore the rejection as stated previously is withdrawn.
Regarding Arguments directed to 35 USC § 102:
The amendments to the claims overcome the rejection by importing the claim limitations of claim 41 into claim 35 and changing the Seq ID NOs. Therefore the rejection as stated previously is withdrawn.
Regarding Arguments directed to 35 USC § 103:
The amendments to the claims overcome the rejection by importing the claim limitations of claim 41 into claim 35 and changing the Seq ID NOs. Therefore the rejection as stated previously is withdrawn.
However the arguments relevant to the instant rejections are addressed below:
Regarding claim 39: The discussion regarding claim 39 merely asserts the disclosure of June does not cure the deficiency of Ellebrecht and Lenders, but does not present any specific arguments to be addressed. Thus the argument is unpersuasive.
Regarding claim 41 (limitations moved into claim 35): Applicant argues that the rejection which relies upon Ellebrecht and Lenders is missing a throughline linking targeting Fabry disease and using modified B-cell antibody receptors to enhance ERT efficacy.
As discussed supra, Ellebrecht teach targeted B cell depletion mediated by a chimeric autoantibody receptor (CAAR) comprising an antigen to target the B cells successfully eliminates pathogenic B cells (abstract, p179 col1 ¶1). Ellebrecht further teach various combinations of chimeric antigen receptors could be combined to maximize efficacy in diseases in which autoantibodies targeting multiple autoantigens are pathogenic (p183 col1 ¶1). Thus Ellebrecht teaches the method used to target B cells causative for PV can be applied to target B cells that are pathogenic in a different context.
Lenders is relied upon to teach a major challenge of the treatment of Fabry disease using enzyme replacement therapy is the development of neutralizing antidrug antibodies (p1 col2 ¶3).
The throughline linking the disclosures of Ellebrecht and Lenders is that one of ordinary skill in the art would understand that a method to target pathogenic B cells in the context of one disease (as disclosed by Ellebrecht) would have a reasonable expectation of success in targeting pathogenic B cells in a different pathogenic context, such as targeting B cells which generate neutralizing antidrug antibodies which Lenders teach is a challenge for the treatment of Fabry disease.
Adapting a method used to treat one disease to treat a different condition that is mediated by mechanism is considered a common practice for biomedical research and as such the combination of Ellebrecht and Lenders is considered obvious with a reasonable expectation of success.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ANDREA LYNNE MORRIS SPENCER whose telephone number is (571)272-3328. The examiner can normally be reached Monday-Friday 9:00-5:00 (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, James (Doug) Schultz can be reached at 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ANDREA LYNNE MORRIS SPENCER/Examiner, Art Unit 1631
/TAEYOON KIM/Primary Examiner, Art Unit 1631
Prosecution Insights