Prosecution Insights
Last updated: April 19, 2026
Application No. 17/786,147

COMPOSITIONS AND METHODS FOR HEMOGLOBIN PRODUCTION

Final Rejection §103§112
Filed
Jun 16, 2022
Examiner
PERSONS, JENNA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Trustees of the University of Pennsylvania
OA Round
2 (Final)
52%
Grant Probability
Moderate
3-4
OA Rounds
2y 12m
To Grant
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allow Rate
25 granted / 48 resolved
-7.9% vs TC avg
Strong +73% interview lift
Without
With
+73.4%
Interview Lift
resolved cases with interview
Typical timeline
2y 12m
Avg Prosecution
47 currently pending
Career history
95
Total Applications
across all art units

Statute-Specific Performance

§101
8.0%
-32.0% vs TC avg
§103
27.9%
-12.1% vs TC avg
§102
14.9%
-25.1% vs TC avg
§112
30.0%
-10.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 48 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status Applicant’s remarks, and amendments to the specification and claims filed November 11, 2025 are acknowledged. Claims 1, 11, 13, and 21 were amended, claims 5-6, 12, and 15-16 were cancelled, and claims 23-32 were introduced. Claims 1-4, 7-11, 13-14, and 17-32 are pending and under examination herein. Priority Applicant’s priority claims to Application Nos. 62/952,653, filed December 23, 2019, and PCT/US20/66779, filed December 23, 2020 are acknowledged. Claims 1-4, 7-11, 13-14, and 17-32 find support in Application No. 62/952,653, and therefore, the effective filing date of all claims currently under examination is December 23, 2019. Withdrawn Rejections Applicant’s remarks and the amendments to the claims have been reviewed. The cancellation of claims 6 and 16 resolve the § 112(a) Written Description rejection raised in the prior action. The amendments to claim 21 are sufficient to overcome the § 102 rejections over Tutino raised in the prior action. The aforementioned rejections are withdrawn, accordingly. Applicant’s remarks and amendments to the claims have been thoroughly considered, but are not persuasive to place the claims in condition for allowance for the reasons that follow. Any objection or rejection not reiterated herein has been overcome by amendment. Claim Objections Claim 21 is objected to because of the following informalities: Claim 21 recites “wherein said the PP6C inhibitor,” and “or ii) or ii).” The claim should be amended to recite “wherein said Appropriate correction is required. Claim Rejections - 35 USC § 112(a) – Enablement The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Method of Increasing the Level of Human Fetal Hemoglobin in a Cell or Subject Claims 1-4, 7-10, 27, and 29-30 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph. The specification is enabling for increasing the level of human fetal hemoglobin in I) HUDEP-2 cells stably expressing Cas9, or II) primary human erythroid cells in vitro which are electroporated with Cas9, by administering any one of three sgRNAs specifically targeting PP6C, i.e., sgRNAs presumed to comprise the recognition sequences of SEQ ID NOs: 5, and 7-8. The specification does not reasonably provide enablement for increasing the level of human fetal hemoglobin in any other cells, or in any subject, or using any other PP6C inhibitors encompassed by the claim. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims for the reasons that follow. The rejection of claims 1-4, and 7-10 is maintained and modified as necessitated by Applicant’s amendments to the claims. The rejection of claims 27, and 29-30 is new and necessitated by Applicant’s amendments to the claims. The test of enablement is whether one skilled in the art could make or use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics Inc., 857 F.2d 778, 785, 8 USPQ2d 1217, 1223 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor, but rather is a conclusion reached by weighing many factors. These factors were outlined in In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988), and the most relevant factors are indicated below: Nature of the Invention and Breadth of the Claims Claim 1 recites “A method of increasing the level of human fetal hemoglobin in a cell or subject, the method comprising administering at least one protein phosphatase 6 catalytic subunit (PP6C) inhibitor to the cell or subject.” The “protein phosphatase 6 catalytic subunit (PP6C) inhibitor” is “i) an inhibitory nucleic acid,” which is interpreted as encompassing any nucleic acid which inhibits PP6C whether directly or indirectly, e.g., an antisense oligomer, siRNA, shRNA, miRNA, aptamer, antagomir, etc., or “ii) Cas9 and a guide RNA (gRNA) specific for the PP6C,” which is interpreted as requiring a gRNA targeting a nucleic acid encoding PP6C. “Increasing the level of human fetal hemoglobin” is interpreted as increasing, to any degree, the amount of human γ-globin (pg. 16, line 12-14). A “cell” is interpreted as any in vitro, ex vivo, or in vivo cell. A “subject” is interpreted as “human or animal subjects,” e.g., an animal subject comprising a human γ-globin gene (pg. 10, line 32-33). Accordingly, enablement of the claims requires that one of ordinary skill in the art, without undue experimentation, be able to increase the level of human fetal hemoglobin in any cell or any animal or human subject, by administering to the cell or subject at least one agent which is either an inhibitory nucleic acid as interpreted above, or a Cas9 and a guide RNA targeting a nucleic acid encoding PP6C. Guidance in the Specification The specification describes a CRISPR screening strategy to identify regulators of fetal hemoglobin expression (pg. 17, line 5 to pg. 18, line 12; Fig. 1A-B). The specification teaches that out of “a library of sgRNAs targeting 218 different phosphatase domains,” “5 of 6 sgRNAs targeting PP6C resulted in enriched fetal globin expression [in “human umbilical cord blood-derived progenitor (HUDEP-2) cells… stably expressing Cas9”] as compared to non-targeting sgRNAs” (pg. 18, lines 1-12; Fig. 1A-B). In a separate experiment in “primary human cells,” which are presumed to be “erythroid cells” (pg. 18, lines 30-31), the specification compared use of sgRNAs targeting PP6C to the use of an sgRNA targeting a known, “direct transcriptional repressor[] of the γ-globin genes,” BCL11A (pg. 16, line 26-29 and pg. 18, line 13-31; Fig. 2A-B). The specification demonstrates that 3 of the 6 sgRNAs, i.e., #1, #3, and #4, deplete levels of PP6C protein (Fig. 2A), and induce γ-globin RNA and protein levels comparable to targeting the known repressor, BCL11A (Fig. 2B-D)(pg. 18, lines 13-31). The successful sgRNAs are presumed to comprise the recognition sequences of SEQ ID NOs: 5, and 7-8 (pg. 18-19). The specification does not demonstrate any methods in a subject, in cells isolated from a subject, or in cell types other than those described immediately above. The specification does not demonstrate any methods using any other PP6C inhibitors encompassed by the claims. Specifically, the specification does not describe the use of any “inhibitory nucleic acid molecules” that inhibit PP6C directly or indirect, and which are siRNAs, shRNAs, antisense oligomers, miRNAs, aptamers, antagomirs, etc. Importantly, multiple lines of evidence suggest unpredictability for the claimed scope of cells, subjects, and PP6C inhibitors encompassed by the claims. For example, the specification teaches that fetal hemoglobin genes are “silenced” in subjects after birth, and that fetal hemoglobin expression must be “reactivated” in adult red blood cells (pg. 3, lines 28-29; pg. 16, lines 14-25). It is not evident, which, if any, of the in vitro models described in the specification represent this silenced state, because as shown in Figs. 2A-D, the cells do appear to express fetal hemoglobin (“gamma-globin”). Examiner also notes that while 5/6 sgRNAs enriched fetal hemoglobin expression in HUDEP-2 cells (Fig. 1B), only 4/6 sgRNAs were capable of depleting PP6C in primary human erythroid cells (Fig. 2A, lanes 5-6), and only 3/6 sgRNAs were shown to induce fetal hemoglobin expression therein (Fig. 2A-D). The nature of the difference between these two in vitro experimental models is not evident based on the specification. Nevertheless, this observation suggests that a PP6C inhibitor, e.g., a Cas9 and gRNA, which successfully increases fetal hemoglobin in one context, may not successfully increase fetal hemoglobin in another context, even when both are similar in vitro models. This observation also suggests that even when a PP6C inhibitor substantially decreases PP6C expression, it may not be sufficient to increase fetal hemoglobin expression (see Fig. 2A, lane 2). The scope of PP6C inhibitors encompassed by the claim include “inhibitory nucleic acid molecule[s],” e.g., antisense oligomers, shRNA, siRNA, miRNAs, etc. The skilled artisan would know that many such molecules may only reduce PP6C expression by, for example, 10%, 25%, 50%, etc. The specification shows that an sgRNA (i.e., #3) which directly targets PP6C and effectively eliminates PP6C protein (Fig. 2A), increases fetal hemoglobin levels by ~ 4%, i.e., 8.6% compared to 3.8% in control cells (Fig. 2D). It is not evident that the skilled artisan could predict which of the many inhibitory nucleic acid molecules would reduce PP6C protein to levels sufficient to cause an increase in fetal hemoglobin levels. This is further supported by the observations described above which illustrate that only 3/4 sgRNA which substantially reduced PP6C in primary human erythroid cells even induced fetal hemoglobin expression. The scope of PP6C inhibitors encompassed by the claim includes “inhibitory nucleic acid molecule[s]” which do not directly target PP6C, but which nonetheless “inhibit” PP6C, e.g., by targeting a PP6C regulator or interactor. The specification has not provided or suggested any mechanistic relationship between PP6C, its regulators or interactors, and fetal hemoglobin levels. The skilled artisan could not predict which of the inhibitory nucleic acid molecules which are designed to inhibit PP6C indirectly would cause an increase in fetal hemoglobin levels in any cell or subject. The scope of PP6C inhibitors encompassed by the claim also includes “inhibitory nucleic acid molecule[s]” which are nucleic acid aptamers, miRNAs, and antagomirs. Again, the specification has not established any mechanistic relationship between PP6C and fetal hemoglobin levels. The skilled artisan could not predict whether disrupting or blocking a specific domain of PP6C, PP6C phosphatase activity, or its interaction with one or more regulators or co-factors would increase fetal hemoglobin levels. Together, the specification lacks working examples commensurate with the scope of the claim, provides evidence that the claim cannot be practiced across its full scope, and lacks sufficient guidance to predict which embodiments of the method will work. The specification provides predictably for only two specific embodiments of the instantly claimed method: increasing the level of human fetal hemoglobin in I) HUDEP-2 cells stably expressing Cas9, or II) primary human erythroid cells in vitro which are electroporated with Cas9, by administering any one of three sgRNAs specifically targeting PP6C, i.e., sgRNAs presumed to comprise the recognition sequences of SEQ ID NOs: 5, and 7-8 (pg. 18-19). State of the Prior Art A thorough search of the prior art failed to uncover any evidence that PP6C regulates fetal hemoglobin levels, or hemoglobin levels in general. The search also failed to uncover any evidence that PP6C regulates any known regulators of fetal hemoglobin levels, e.g., BCL11A, or aspects of erythrocyte biology, such that the skilled artisan could modulate a relationship between PP6C and hemoglobin levels with predictable effects. Accordingly, the prior art was searched for general guidance for methods of increasing fetal hemoglobin levels in cells and subjects with known agents. Cui (Cui and Engel, 2017, Gene and Cell Therapies for Beta-Globinopathies, Advances in Experimental Medicine and Biology 1013, Chapter 7, pg. 177-202; of record) describes the effects of many known inducers of fetal hemoglobin (see pgs. 183-189). It is not evident that the agents would be considered PP6C inhibitors, but Cui remains relevant because Cui concludes that “[t]here is wide variability in the response to these non-specific and less (mechanistically) understood approaches to the augmentation of HbF synthesis and the reasons for this are largely unknown” (pg. 190). Based on Cui, it is apparent that while various agents that increase fetal hemoglobin levels are known in the art, the effects of the known agents are unpredictable. Therefore, it is not apparent that the use of a PP6C inhibitor encompassed by the claims, which appears even less mechanistically understood than the agents described by Cui, would be predicted to function in the method as claimed. The prior art fails to provide any additional predictability for the instantly claimed method. Experimentation Required and Level of Skill in the Art In order to practice the invention, a large amount of highly unpredictable experimentation would be required. The skilled artisan would need to prepare putative PP6C inhibitors sufficient to represent the scope of the genus, i.e., gRNAs targeting a PP6C-encoding nucleic acid, and siRNAs, antisense oligomers, shRNAs, miRNAs, aptamers, etc., targeting PP6C, or regulators and interactors of PP6C. The skilled artisan would need to determine whether the putative PP6C inhibitor actually inhibited PP6C. Then, the skilled artisan would need to administer the PP6C inhibitors, and PP6C inhibitor combinations (“at least one”) to cells and subjects encompassed by the claim, e.g., cells in vitro, ex vivo, in vivo, of any type (human or non-human), as well as human and animal subjects. The skilled artisan would also need to establish a baseline level of fetal hemoglobin in cells and subjects encompassed by the claim, e.g., by measuring pre-administration, or in control cells or subjects. The skilled artisan would then compare the levels of fetal hemoglobin in cells and subjects administered the PP6C inhibitor(s), and compare to the established baseline to determine if the PP6C inhibitor(s) actually increased the level of fetal hemoglobin. The level of skill in the art is high, and the experimentation above is well within the purview of the skilled artisan. However, the amount of experimentation is undue at least because: the specification provides only two embodiments of the claimed method; and these limited embodiments do not appear representative of the scope of cells and PP6C inhibitors encompassed by the claim, or of methods in subjects, particularly cells or subjects in which fetal hemoglobin is “silenced;” the specification provides evidence that sgRNAs that induce fetal hemoglobin in one context (HUDEP-2 cells), may not function in a different context (primary human erythroid cells)(see Figs. 1B, 2A-B); the specification fails to provide any evidence that the scope of PP6C inhibitors encompassed by the claim will deplete or perturb PP6C function to a level sufficient to induce fetal hemoglobin expression; the prior art fails to teach any working examples of the method, or teach or suggest any relationship between PP6C and fetal hemoglobin regulation; the prior art provides no relationship between PP6C and fetal hemoglobin levels, and suggests that the effects of even known agents that increase fetal hemoglobin levels are unpredictable. Taking into consideration the factors outlined above, it is the conclusion that undue experimentation would be required to use the method across its claimed scope. Dependent Claims Claims 2-4, 7-10, 27, and 29-30 do not further limit the method so as to resolve the issues described above, and therefore, are rejected for the reasons above. Regarding claims 9-10, the claims require that the method further comprise administering a “fetal hemoglobin inducer,” which is interpreted as any compound which induces fetal hemoglobin expression, e.g., hydroxyurea, or “pomalidomide” as recited in claim 10. The specification and prior art, while teaching the structure of various fetal hemoglobin inducers, fail to provide any examples of the claimed methods. The specification and prior art fail to provide any guidance as to the mechanism of PP6C in fetal hemoglobin regulation. A thorough search also failed to uncover evidence that the mechanism(s) through which inducers encompassed by the claims regulate fetal hemoglobin levels is straightforward or well understood (Dulmovits et al., 2016, Blood, Vol. 127, No. 11, pg. 1481-1492, of record; “multiple levels of regulation are involved in the mechanism of action of pomalidomide,” pg. 1490, left col.; “the mechanism of action of HU is still not fully understood,” pg. 1491, left col.). The prior art does demonstrate that pomalidomide and hydroxyurea each, independently, induce fetal hemoglobin (Meiler et al., 2011, Blood, Vol. 118, No. 4, pg. 1109-1112; Fig. 1A; of record). The prior art demonstrates that a combination of pomalidomide and hydroxyurea also induces fetal hemoglobin in progenitor cells ex vivo; however, when the combination was administered in vivo, it was no longer capable of inducing fetal hemoglobin production (“Motivated by the synergistic HbF-inducing activity of pomalidomide and hydroxyurea in ex vivo CD34+ progenitor cells, we conducted combinatory treatments [in sickle cell mice] and surprisingly observed a virtual loss of HbF induction above control levels,” pg. 1111, left col.; Fig. 1A). Thus, the prior art provides evidence that agents which increase fetal hemoglobin levels when administered alone, or even, when administered as a combination in vitro, may fail to retain this function when combined in vivo. The prior art teaches that the discrepancy may be due to “greater complexity of regulatory signals in vivo… or differences in the β-globin gene clusters in the two systems” (pg. 1111, right col.). There is limited guidance in the specification and prior art as to use of a PP6C inhibitor in fetal hemoglobin regulation, let alone in combination with another agent having a less than well-understood mechanism. It not apparent that the skilled artisan could reasonably predict that the combination of a PP6C inhibitor encompassed by the claims and a fetal hemoglobin inducer would function in the method as claimed. Method of Treating a Hemoglobinopathy in a Subject in Need Thereof Claims 11, 13-14, 17-20, 28, and 31-32 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention for the reasons that follow. The rejection of claims 11, 13-14, and 17-20 is maintained and modified as necessitated by Applicant’s amendments to the claims. The rejection of claims 28, and 31-32 is new and necessitated by Applicant’s amendments to the claims. The test of enablement is whether one skilled in the art could make or use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics Inc., 857 F.2d 778, 785, 8 USPQ2d 1217, 1223 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor, but rather is a conclusion reached by weighing many factors. These factors were outlined in In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988), and the most relevant factors are indicated below: Nature of the Invention and Breadth of the Claims Claim 11 recites “A method of treating a hemoglobinopathy in a subject in need thereof, the method comprising administering a composition comprising at least one protein phosphatase 6 catalytic subunit (PP6C) inhibitor and a pharmaceutically acceptable carrier to the subject….” The “PP6C inhibitors” encompassed by the claim are interpreted in paragraph 8 above. The claim recites that the hemoglobinopathy is “β-thalassemia or sickle cell anemia.” Thus, “treating” is interpreted as relieving one or more symptoms of, delaying progression of, or improving the condition of a subject with sickle cell anemia or β-thalassemia. A “subject” is interpreted as an “human or animal subject” (pg. 10, line 32-33). Accordingly, enablement of the claims requires that one of ordinary skill in the art, without undue experimentation, be able to treat sickle cell anemia or β-thalassemia in any animal or human subject, by administering to the subject a composition comprising a pharmaceutically acceptable carrier and at least one agent which is either an inhibitory nucleic acid as interpreted above, or a Cas9 and a guide RNA targeting a nucleic acid encoding PP6C. Guidance in the Specification The teachings of the specification are described in paragraph 9 above and applied hereinafter. The specification teaches that inducing fetal hemoglobin can lower morbidity and mortality of hemoglobinopathies, e.g., sickle cell disease and β-thalassemia (pg. 16, lines 13-25). However, the specification fails to teach any working examples of increasing fetal hemoglobin levels in a subject, let alone to levels sufficient to “treat[] a hemoglobinopathy” as instantly claimed. The in vitro models described in the specification fail to provide sufficient evidence that PP6C inhibitors encompassed by the claim will I) increase fetal hemoglobin levels in a subject, provided fetal hemoglobin is actively expressed in the subject, or II) “reactivate” silenced fetal hemoglobin genes in subjects, let alone to levels sufficient to “treat[] a hemoglobinopathy” as claimed. The specification also does not establish a level of PP6C depletion or perturbation that is sufficient to induce fetal hemoglobin in cells or subjects, or establish a level of fetal hemoglobin induction effective to treat any hemoglobinopathy encompassed by the claim. The specification provides that “effective HbF induction by pharmacological means… remains a challenge” (pg. 16, lines 24-25). Indeed, with respect to even well known “direct transcriptional repressors” of fetal hemoglobin genes, the specification teaches that they “remain difficult to target pharmacologically and in a erythroid selective manner,” owing to their “functions in multiple tissues,” and in the case of one repressor, its role in “erythroid differentiation” (pg. 16, lines 26-33). The specification fails to teach or suggest any mechanistic relationship between PP6C and fetal hemoglobin, characterize the role of PP6C in erythroid cells or other tissues, or demonstrate that PP6C can be targeted in a erythroid selective manner. Based on the limited guidance in the specification, and the clear challenges that persist in the art even for comparably well-known repressors of fetal hemoglobin, the skilled artisan cannot reasonably predict that a PP6C inhibitor encompassed by the claims will treat sickle cell anemia or β-thalassemia in a subject. State of the Prior Art The teachings of the prior art are described in paragraph 10 above and applied hereinafter. As described therein, the prior art fails to provide predictability for increasing fetal hemoglobin levels in cells or subjects with the scope of PP6C inhibitors encompassed by the claim. No working examples of the instantly claimed method of treatment were uncovered in the prior art search, either. Accordingly, the prior art was searched for general guidance as to the predictability of treating sickle cell anemia or β-thalassemia with an agent that increases fetal hemoglobin levels. Cui teaches that reactivation of fetal hemoglobin (“HbF”) in adult hematopoietic cells has potential clinical benefit for patients with mutations in the β-globin gene, e.g., patients with β-thalassemia or sickle cell disease (“SCD”)(pg. 178). Cui teaches that “induction of HbF to 10-20% of total hemoglobin, or a three to fivefold increase over the normal baseline, significantly alleviates the clinical symptoms of SCD” (pg. 182). However, Cui teaches that despite “concerted efforts… to identify an effective way to induce the synthesis of HbF in adult erythroid cells for potential therapeutic relief,” and identification of “[c]hemical inducers of HbF as well as a number of transcription factors that are able to reactive HbF synthesis in vitro and in vivo in adult erythroid cells,” “there has been only limited success in attempts to manipulate either the drugs or regulatory proteins, and in only a fraction of patients, and there is wide variation in individual response to these drugs and transcription factors” (Introduction, pg. 178). Indeed, Cui states that hydroxyurea and 5-azacytidine, which are the best characterized agents that induce HbF, “are demonstrably inadequate to prevent the major complications of SCD, since only half or fewer of the patients treated with these drugs exhibited sustained long-term increments in γ-globin synthesis and amelioration of disease symptoms” (pg. 182). Cui teaches that although hydroxyurea, 5-azacytidine, and butyrate have shown clinical efficacy in patients with SCD, they have not shown efficacy in patients with β-thalassemia, because of “the higher levels of γ-globin that are presumably required… to achieve clinically beneficial effects” (pg. 182-183). Taken together, Cui provides evidence that treating sickle cell disease or β-thalassemia with even a comparably well-characterized agent that increases fetal hemoglobin levels is unpredictable. Cui also teaches that there is no known agent that achieves clinical benefit in patients with β-thalassemia. With respect to sickle cell disease, Cui teaches that fetal hemoglobin induction “to 10-20% of total hemoglobin, or a three to fivefold increase over the normal baseline, significantly alleviates the clinical symptoms of SCD” (pg. 182). Only one specific embodiment in the specification increases fetal hemoglobin levels “three to fivefold… over the normal baseline” (see Fig. 2D, “PP6C sgRNA #1”). Each of the other in vitro embodiments show an approximately two fold increase over the normal baseline. The specification and prior art provide evidence that the results obtained with an agent in one context are not necessarily predictable of another context and/or with a different agent. It is not predictable based on the singular, in vitro embodiment which achieves threefold HbF induction over baseline, that the skilled artisan could achieve the levels of fetal hemoglobin necessary to treat a hemoglobinopathy in a subject, with a PP6C inhibitor as claimed. The prior art fails to provide any additional predictability for the instantly claimed method. Experimentation Required and Level of Skill in the Art In order to practice the invention, a large amount of highly unpredictable experimentation would be required. The skilled artisan would need to prepare putative PP6C inhibitors sufficient to represent the breadth of the genus. The skilled artisan would need to determine whether the putative PP6C inhibitor(s) actually inhibited PP6C. The skilled artisan would need to recruit human subjects, and obtain/prepare animal subjects with sickle cell anemia and β-thalassemia. The skilled artisan would need to establish the delivery means, route, dose, and duration for each PP6C inhibitor and PP6C inhibitor combination. Given the scope of PP6C inhibitors encompassed by the claim, these parameters would almost certainly vary extensively. The skilled artisan would need to establish the metric(s) to determine treatment of each hemoglobinopathy. Then, the skilled artisan would need to administer the PP6C inhibitors, and PP6C inhibitor combinations (“at least one”) to the subjects, and determine whether the hemoglobinopathies were treated. The level of skill in the art is high, and the experimentation above is well within the purview of the skilled artisan. However, the amount of experimentation is undue at least because: the specification fails to provide predictability for increasing fetal hemoglobin levels in the scope of cell or subjects encompassed by the claim, with the scope of PP6C inhibitors encompassed by the claim as described in paragraphs 8-13 above; the specification fails to provide any working examples of the method, and provides evidence that targeting comparably well-characterized regulators is untenable; the specification provides only a single in vitro embodiment which achieves the HbF induction necessary to relieve symptoms of a hemoglobinopathy based on the prior art, but there is insufficient evidence that these results translate to different in vitro or in vivo contexts; the prior art fails to provide any working examples of the method, and alternatively, provides evidence that the use of even known agents is unpredictable. Taking into consideration the factors outlined above, it is the conclusion that undue experimentation would be required to use the claimed method. Dependent Claims Claims 13-14, 17-20, 28, and 31-32 do not further limit the method so as to resolve the issues described above, and therefore, are rejected for the reasons above. Regarding claims 18-19, the claims require that the method further comprise administering a “fetal hemoglobin inducer,” which is interpreted as any compound which induces fetal hemoglobin expression, e.g., hydroxyurea, or “pomalidomide” as recited in claim 10. The specification and prior art, while teaching the structure of various fetal hemoglobin inducers, fail to provide any examples of the claimed methods. The specification and prior art fail to provide any guidance as to the mechanism of PP6C in fetal hemoglobin regulation. A thorough search also failed to uncover evidence that the mechanism(s) through which inducers encompassed by the claims regulate fetal hemoglobin levels is straightforward or well understood (Dulmovits et al., 2016, Blood, Vol. 127, No. 11, pg. 1481-1492, of record; “multiple levels of regulation are involved in the mechanism of action of pomalidomide,” pg. 1490, left col.; “the mechanism of action of HU is still not fully understood,” pg. 1491, left col.). The prior art does demonstrate that pomalidomide and hydroxyurea each, independently, induce fetal hemoglobin (Meiler et al., 2011, Blood, Vol. 118, No. 4, pg. 1109-1112; Fig. 1A; of record). The prior art demonstrates that a combination of pomalidomide and hydroxyurea also induces fetal hemoglobin in progenitor cells ex vivo; however, when the combination was administered in vivo, it was no longer capable of inducing fetal hemoglobin production (“Motivated by the synergistic HbF-inducing activity of pomalidomide and hydroxyurea in ex vivo CD34+ progenitor cells, we conducted combinatory treatments [in sickle cell mice] and surprisingly observed a virtual loss of HbF induction above control levels,” pg. 1111, left col.; Fig. 1A). Thus, the prior art provides evidence that agents which increase fetal hemoglobin levels when administered alone, or even, when administered as a combination in vitro, may fail to retain this function when combined in vivo. The prior art teaches that the discrepancy may be due to “greater complexity of regulatory signals in vivo… or differences in the β-globin gene clusters in the two systems” (pg. 1111, right col.). There is limited guidance in the specification and prior art as to use of a PP6C inhibitor in fetal hemoglobin regulation, let alone in combination with another agent having a less than well-understood mechanism. It not apparent that the skilled artisan could reasonably predict that the combination of a PP6C inhibitor encompassed by the claims and a fetal hemoglobin inducer would function in the method as claimed. Response to Remarks – 35 USC § 112(a) Enablement Applicant’s remarks regarding the § 112(a) Enablement rejections raised in the prior action have been reviewed. Regarding the scope of enablement rejection over claim 1 and its dependents, Applicant cites case law which states that “[t]he question for enablement is not whether experimentation is needed, but rather if the experimentation is undue.” Applicant also states that “absolute predictability is not a requirement.” Applicant submits that “the structure of the inhibitory nucleic acid molecules is known,” and “defined and dictated by the target gene or nucleic acid.” Applicant cites USPTO Written Description Training Materials as stating “the structure of all possible antisense oligonucleotide that are complementary to [a target] mRNA can be predicted,” and that “even though all of the oligonucleotides that are complementary to [the target] mRNA will not have antisense function, there are certain art-recognized correlations between the antisense oligonucleotide’s function and the structure of the target mRNA that would aid the selection of those fragments having antisense activity.” For example, Applicant references “computer prediction models.” Applicant references data in the specification which shows that “4 of 6 gRNA resulted in significant depletion of PP6C protein level showed induction of gamma-globin… [and] also showed significant increases in HbF.” Applicant concludes that there is sufficient structure-function guidance in the specification to select appropriate inhibitory nucleic acid and gRNA to practice the methods. Examiner acknowledges that the standard for enablement is not “absolute predictability,” or whether experimentation is required. In the previous action and above, Examiner concludes that the level of experimentation required to practice the claims was “undue” based on consideration of the Wands factors as described in MPEP 2164.01(a). There is no apparent deficiency in the rejections with respect to the standard for determining compliance with the enablement requirement. Applicant’s remarks in support of a sufficient structure-function relationship between the claimed PP6C inhibitors and the required outcome of the methods (i.e., increasing fetal hemoglobin levels in a cell or subject) have not been found persuasive. Examiner agrees that should the target nucleic acid be defined, the structure of siRNAs, shRNAs, and ASOs targeting the nucleic acid, and functioning through well-known RNAi-based or RNaseH-based mechanisms, could easily be ascertained by the skilled artisan based on the prior art. A similar conclusion could be reached for a gRNA targeting a defined nucleic acid. Examiner also acknowledges the existence of screening methods to determine functional antisense molecules and gRNAs, and computer prediction models which aid in selection of functional antisense molecules and gRNAs. However, the term “inhibitory nucleic acid molecule” is not limited to the aforementioned antisense nucleic acids, or to a specific target. The term encompasses at least miRNAs, antagomiRs, and nucleic acid aptamers, as well as “PP6C inhibitors” which function indirectly, e.g., by targeting regulators or interactors of PP6C. The specification and prior art fail to provide predictability for use of these species in the method at least because no mechanistic relationship between PP6C, its regulators or interactors, and fetal hemoglobin levels has been established. Even should the claims be limited to an siRNA, shRNA, ASO, or gRNA specifically designed to target PP6C-encoding nucleic acid using prior art design rules, and even should the skilled artisan screen for those which inhibit PP6C, it is not evident that the skilled artisan could predict those which would increase fetal hemoglobin levels across the cells and subjects claimed. The specification provides evidence that a gRNA which effectively eliminates PP6C levels increases fetal hemoglobin levels by ~ 4% (see Fig. 2A and Fig. 2D). The siRNAs, shRNAs, antisense oligomers, etc., encompassed by the claims, which function through RNAi- and RNase H-based mechanisms, include many molecules which would decrease, but not eliminate PP6C expression (e.g., they may only decrease PP6C levels by 10%, 25%, or 50%). Neither the specification nor prior art provide sufficient guidance to determine which of these molecules would be sufficient to increase fetal hemoglobin levels. Based on the specification, the skilled artisan would be skeptical that a molecule which does not fully eliminate PP6C expression could increase fetal hemoglobin levels. Further unpredictability is raised by evidence in the specification that suggests that a gRNA which substantially decreases PP6C expression fails to increase fetal hemoglobin levels (see Fig. 2A, lane 2). The specification also provides evidence that gRNAs do not increase fetal hemoglobin levels consistently across in vitro contexts (compare Fig. 1B and Fig. 2A), and it is not evident that the in vitro models are even representative of the subjects encompassed by the claim which have “silenced” fetal hemoglobin genes (see HbF expression in controls of Fig. 2C-D, for example). The prior art does not remedy the specification’s evidence of unpredictability for practicing the method, even with molecules which would be considered reasonably well-characterized based on the prior art (i.e., siRNAs, shRNAs, ASOs, gRNAs designed to specifically target PP6C). The prior art actually lends further unpredictability, because the use of even known “fetal hemoglobin inducers” is unpredictable based on Cui. Regarding the enablement rejection over claim 11 and its dependents, Applicant submits that the claims are enabled because “the PP6C inhibitors are fully enabled,” and the claims are limited to treating β-thalassemia or sickle cell anemia, in which “any increase in fetal hemoglobin levels can provide a therapeutic benefit to the subject.” Applicant asserts that the claims “do[] not require a cure.” Applicant states that “increasing fetal hemoglobin 2-3 fold or more as demonstrated in the present application would be beneficial to the subject.” Applicant’s arguments related to enablement of methods of increasing fetal hemoglobin in cells or subjects with PP6C inhibitors are addressed immediately above. Applicant’s remarks have not been found persuasive to overcome the rejections related to methods of increasing fetal hemoglobin in cells or subjects. These remarks are also not persuasive to overcome the rejections related to methods of treating a hemoglobinopathy, i.e., sickle cell anemia or β-thalassemia, in a subject. The claims were not, and are not, interpreted as requiring “a cure.” The previous and instant rejections interpret “treating” as relieving one or more symptoms of, delaying progression of, or improving the condition of a subject….”Applicant alleges that “any increase in fetal hemoglobin levels can provide a therapeutic benefit to the subject,” and subsequently, alleges that “increasing fetal hemoglobin 2-3 fold or more” would be beneficial to the subject. Applicant presents no evidence to support these claims. The prior art teaches that “induction of HbF to 10-20% of total hemoglobin, or a three to fivefold increase over the normal baseline, significantly alleviates the clinical symptoms of [sickle cell disease] SCD” (pg. 182). The prior art teaches that “higher levels of γ-globin [] are presumably required… to achieve clinically beneficial effects” in β-thalassemia (pg. 182-183). Neither the specification nor prior art provide any working examples of the instant methods of treatment. The specification provides only one in vitro working example which achieves fetal hemoglobin induction “three to fivefold… over the normal baseline” (see Fig. 2D, “PP6C sgRNA #1”). However, for the reasons described above, neither the specification nor prior art provide evidence that the results obtained in this singular working example would be obtained in different in vitro contexts, let alone in in vivo contexts, or with a different PP6C inhibitors encompassed by the claims. Notice to Joint Inventors This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim Rejections - 35 USC § 103 – Lee and Polizzotto The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 21-24 are rejected under 35 U.S.C. 103 as being unpatentable over Lee (Lee et al., WO 2014/055624; published 10 April 2014) and Polizzotto (Polizzotto et al., 6 December 2014, blood, Vol. 124, Issue 21, pg. 4128). The rejections that follow are new and necessitated by Applicant’s amendments to the claims. It is noted that “PP6C” is also known as “PPP6C” in the art (specification, pg. 4, lines 1-2). Regarding claims 21-24, Lee teaches a composition comprising at least one protein phosphatase 6 catalytic subunit (PP6C) inhibitor (“a PPP6C inhibitor,” pg. 5, lines 6-17; pg. 13, lines 22-23; pg. 17, lines 4-8; pg. 26-28; “siRNA was complexed with… Lipofectamine RNAiMax… in Opti-MEM,” pg. 31, lines 15-24). Lee teaches the PP6C inhibitor is an inhibitory nucleic acid molecule, wherein the inhibitory nucleic acid molecule is an siRNA (“The inhibitor can be nucleic acid…,” pg. 17, lines 4-5; “The PPP6C inhibitor may be an siRNA,” pg. 5, lines 6-17; “siRNA Sequences,” pg. 49). Lee teaches the “inhibition of… PPP6C… increase[s] the innate immune response. Such up-regulation is useful in the treatment of conditions that would benefit from a heightened immune response such as but not limited to infections such as viral infections and cancer” (pg. 2, lines 15-19). Lee specifically teaches that PP6C inhibition may be useful to enhance the immune response in retroviral infections, e.g., HIV (“Knockdown of… Ppp6C[] significantly enhanced the ability of retroviral infection to induce IFN and ISG production,” pg. 41-42; “wherein the retroviral infection is an HIV infection,” 26. pg. 57). Lee teaches that the PP6C inhibitor may be used alone or “in combination with other active ingredients,” (pg. 21, lines 10-12). Lee does not teach that the composition comprises at least one “fetal hemoglobin inducer,” wherein the fetal hemoglobin inducer is pomalidomide. It is noted that the term “fetal hemoglobin inducer” refers to a compound which can induce fetal hemoglobin, e.g., pomalidomide, hydroxyurea, or metformin, based on the specification. However, the compound and composition are not otherwise limited by this term. For example, the compound could also have additional functions, and/or the composition could be used to achieve different outcomes. Polizzotto teaches that humans with HIV, despite antiretroviral therapy (ART), exhibit immune deficits, including failure to reconstitute CD4 T cell numbers and function (“Background”). Polizzotto teaches this results in “increased risks of tumors and infections and reduced response to vaccination” (“Background”). Polizzotto teaches that pomalidomide has immunomodulatory properties which may be relevant for immune activation in patients with HIV (“Background”). Polizzotto demonstrates that a composition comprising pomalidomide increases the number of and activation of CD4 and CD8 T cell populations in subjects with HIV (“Results”; “Conclusions”). Polizzotto teaches that the augmentation of immune responsiveness by pomalidomide should be further explored in HIV and other immunodeficiencies” (“Conclusions”). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have arrived at a composition comprising an inhibitory nucleic acid targeting PP6C and pomalidomide in view of Lee and Polizzotto. It would have amounted to a simple combination of two compounds known to enhance immune responses to retroviral infection, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation that an inhibitory nucleic acid targeting PP6C and pomalidomide would possess the same functions when combined in the composition as described in their respective references because they are distinct compounds with distinct structure (i.e., one is a nucleic acid, and the other, a small molecule), and therefore, bring about their immunomodulatory properties through different mechanisms (i.e., one through inhibition of PP6C expression, and the other, through binding to molecules in the cell). In addition, Lee teaches that PP6C inhibitors can be used “in combination with other active agents.” The skilled artisan would have had a reasonable expectation that the resulting composition could be used to enhance the immune response of cells and/or subjects to retroviral infection based on the teachings of Lee and Polizzotto described above. Given that Lee and Polizzotto suggest that enhancing the immune response would be therapeutically relevant in subjects with retroviral infection, the skilled artisan would have been motivated to arrive at the composition of claims 21-24. Claim Rejections - 35 USC § 103 – Lee and Polizzotto in view of Smith, Wiles, and GenBank Claims 25-26 are rejected under 35 U.S.C. 103 as being unpatentable over Lee (Lee et al., WO 2014/055624; published 10 April 2014) and Polizzotto (Polizzotto et al., 6 December 2014, blood, Vol. 124, Issue 21, pg. 4128) as applied to claims 21-24, in further view of Smith (Smith et al., 30 November 2017, PLOS Biology, 15(11):e2003213), Wiles (Wiles et al., 20 May 2015, Mamm Genome, (2015) 26:501–510), and GenBank (Accession No. NM_002721.4, “Homo sapiens protein phosphatase 6 catalytic subunit (PPP6C), transcript variant 2, mRNA,” available 24 June 2018). The rejections that follow are new and necessitated by Applicant’s amendments to the claims. The teachings of Lee and Polizzotto are described above and applied as to claims 21-24 therein. Neither Lee nor Polizzotto teach an inhibitory nucleic acid molecule which is a “gRNA specific for the PP6C,” or wherein the gRNA comprises SEQ ID NO: 5, 7, or 8. Smith teaches that RNAi and CRISPR technologies have similar “on-target efficacy,” producing “comparable reduction in the transcript abundance of the target gene” (“We find the on-target efficacy of the 2 technologies is similar,” Author Summary; pg. 9-10; Fig. 4A). However, Smith teaches that “[t]he specificities of RNAi and CRISPR technologies are a critical concern” (pg. 2). Smith teaches that “the molecular triggers of the RNAi pathway, while designed to silence a single gene of interest, can in fact affect multiple off-target genes,” through “unintended loading” of the passenger strand, and entering “the miRNA pathway and potentially contribut[ing] to the silencing of dozens if not hundreds of transcripts (pg. 2-3; “miRNA-like seed effects of RNAi are widespread,” pg. 13). In contrast, Smith teaches that CRISPR technology, which employs a gRNA specific to a target gene, has negligible off-target activity (“the CRISPR-associated 9 (Cas9) nuclease is programmed with a single guide RNA (sgRNA) to create a targeted double-strand (dsDNA) break,” pg. 2; “the off-target effects of RNAi are much greater than typically appreciated, whereas CRISPR technology has negligible off-target activity,” Author summary; “CRISPR technology produces few systematic off-target effects,” pg. 13; “CRISPR technology… tends to produce predominantly on-target activity,” pg. 14). Smith, while teaching gRNAs specific for a target gene, does not teach gRNA design rules or a sequence encoding PP6C. With respect to gRNA design rules, Wiles teaches that “[s]pecificity of the CRISPR-Cas9 system is defined by the 20 nt located at the 5’ end of the sgRNA, which interacts with the target DNA by Watson-Crick RNA-DNA base pairing” (pg. 503, right col.; Fig. 1 and description). Wiles teaches the other key element of a gRNA is its proximity to a protospacer adjacent motif (PAM) sequence, which for Cas9 is the sequence “5’ NGG 3’” on the non-target strand (pg. 502, left col.; Fig. 1). The relationship of these gRNA elements to each strand in a target region is shown in Fig. 1 (Fig. 1 and description). Wiles teaches that “[i]n practice, by simply designing the 5’ 20 nt sequence on the sgRNA to be complementary to the genomic target sequence, the Cas9-sgRNA complex can be directed to specific genomic locus generating DNA DSBs” (pg. 502, left col.). Finally, GenBank teaches a reference mRNA sequence encoding human PP6C. The skilled artisan would understand that GenBank’s sequence is identical to the coding DNA strand, and complementary to the template DNA stand, both of which could be targeted by a Cas9-gRNA complex. Regarding claim 25, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the inhibitory nucleic acid of Lee in the composition rendered obvious above, with a gRNA specific for PP6C in view of Smith, Wiles, and GenBank. It would have amounted to a simple substitution of one inhibitory nucleic acid type for another inhibitory nucleic acid type, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in designing a functional gRNA specific for PP6C because design of gRNAs to target a gene of interest was well known in the art based on Smith and Wiles, and because the genomic sequence encoding PP6C was known as evidenced by GenBank. Lee teaches that PP6C inhibitors may “prevent or reduce the synthesis of PPP6C… [or] reduce activity by interfering with PPP6C function.” Smith teaches that CRISPR-Cas systems can achieve these results (“indels arising from the error-prone nonhomologous end-joining pathway (NHEJ) can result in frameshift mutations and a null allele,”; “reduction in the transcript abundance of the target gene). Thus, the skilled artisan would conclude that a gRNA specific for PP6C would be sufficient to achieve the immunomodulatory properties taught by Lee. Given the advantages of CRISPR-Cas systems relative to siRNA taught by Smith (i.e., reduced off-target effects), the skilled artisan would have been motivated to substitute the two types of inhibitory nucleic acids in the composition rendered obvious above. Wiles suggests that the on-target efficiency and off-target effects of a gRNA cannot yet be predicted a priori (“intelligent design of sgRNA guide sequence is still in its infancy,” pg. 503-506). The skilled artisan would understand that testing gRNAs designed using prior art rules is a necessary step to achieve the desired levels of on-target efficiency and tolerable levels of off-target effects for the application. SEQ ID NOs: 5, 7, and 8 are either 100% complementary or 100% identical to the GenBank sequence as shown in the alignments in Appendix I. The SEQ ID NOs, therefore, are complementary to target sites on the coding or template DNA strand of the human PP6C gene as shown in Fig. A below (underlined). As shown in Fig. A, each of the 20-nt SEQ ID NOs is also adjacent to a Cas9 PAM sequence, i.e., “NGG” on the non-target strand (bolded). FIG. A 5’ GCACATCAACTAGTGCACGAAGGCTATAAATTTA 3’ nts 927-960 NM_002721.4(coding) 3’ CGTGTAGTTGATCACGTGCTTCCGATATTTAAAT 5’ complement(template) 5’ GCACATCAACTAGTGCACGA 3’ SEQ ID NO: 5 3’ TTCAATAAGGCCCGTCAAGG 5’ SEQ ID NO: 7 (reverse) 5’ CCAAAGTTATTCCGGGCAGTTCCAGATTCAGAAC 3’ nts 1065-1098 NM_002721.4(coding) 3’ GGTTTCAATAAGGCCCGTCAAGGTCTAAGTCTTG 5’ complement(template) 3’ CCCGATAGTCAGGGGCTCCT 5’ SEQ ID NO: 8 (reverse) 5’ CCTGGGCTATCAGTCCCCGAGGAGCAGGTTGGCT 3’ nts 832-865 NM_002721.4(coding) 3’ GGACCCGATAGTCAGGGGCTCCTCGTCCAACCGA 5’ complement(template) Regarding claim 26, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have designed a gRNA specific for PP6C which comprises SEQ ID NO: 5, 7 or 8. It would have amounted to applying known gRNA design principles taught by the prior art, to a known nucleic acid sequence, by known means to yield predictable results. The skilled artisan would have recognized that gRNA testing was a necessary step in the application of CRISPR-Cas technology in view of Wiles. The skilled artisan would have arrived at gRNAs comprising SEQ ID NOs: 5, 7, and 8 by simply applying the design principles of Wiles to the known PP6C-encoding sequence; each SEQ ID NO is 20-nts in length and fully complementary to a target site adjacent to an “NGG” PAM sequence in the PP6C gene as shown in Fig. A above. As stated above, Lee teaches that PP6C inhibitors may “prevent or reduce the synthesis of PPP6C… [or] reduce activity by interfering with PPP6C function.” Smith teaches that CRISPR-Cas systems can achieve these results (“indels arising from the error-prone nonhomologous end-joining pathway (NHEJ) can result in frameshift mutations and a null allele,”; “reduction in the transcript abundance of the target gene). Thus, the skilled artisan would conclude that a gRNA specific for PP6C would be sufficient to achieve the immunomodulatory properties taught by Lee. Given the advantages of CRISPR-Cas systems relative to siRNA taught by Smith (i.e., reduced off-target effects), the skilled artisan would have been motivated to substitute the two types of inhibitory nucleic acids in the composition rendered obvious above. Response to Remarks – Prior Art Applicant’s remarks regarding the prior art rejections raised in the previous action have been considered, but are moot because the new grounds of rejection do not rely on any reference applied in the prior rejection of record for any teaching or matter specifically challenged in the argument. Conclusion No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JENNA L PERSONS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600
Read full office action

Prosecution Timeline

Jun 16, 2022
Application Filed
Jun 05, 2025
Non-Final Rejection — §103, §112
Nov 11, 2025
Response Filed
Feb 03, 2026
Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12595484
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Apr 07, 2026
Patent 12570705
MODIFIED LIGAND-GATED ION CHANNELS AND METHODS OF USE
2y 5m to grant Granted Mar 10, 2026
Patent 12570975
COMPOSITION FOR DIAGNOSIS OR TREATMENT OF A CONDITION ASSOCIATED WITH INCREASED ACTIVITY OF EIF4E COMPRISING AN EIF4E INHIBITOR
2y 5m to grant Granted Mar 10, 2026
Patent 12570706
MODIFIED LIGAND-GATED ION CHANNELS AND METHODS OF USE
2y 5m to grant Granted Mar 10, 2026
Patent 12551573
COMPOSITIONS AND METHODS FOR THE TARGETING OF PCSK9
2y 5m to grant Granted Feb 17, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+73.4%)
2y 12m
Median Time to Grant
Moderate
PTA Risk
Based on 48 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month