Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Status of the Application
Claims 1-14, 52, 53, 65-70, 79 and 95-102 are pending and are currently under examination.
Information Disclosure Statement
The submission of the Information Disclosure Statements are in compliance with 37 CFR 1.97. The information disclosure statement has been considered by the examiner and signed copies have been placed in the file.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 95 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 95 recites the limitation “at least about 12 months”. In determining the range encompassed by the term "about", one must consider the context of the term as it is used in the specification and claims of the application. Ortho-McNeil Pharm., Inc. v. Caraco Pharm. Labs., Ltd., 476 F.3d 1321, 1326, 81 USPQ2d 1427, 1432 (Fed. Cir. 2007). InW.L. Gore & Associates, Inc.v.Garlock, Inc., 721 F.2d 1540, 220 USPQ 303 (Fed. Cir. 1983), the court held that a limitation defining the stretch rate of a plastic as “exceeding about 10% per second” is definite because infringement could clearly be assessed through the use of a stopwatch. However, the court held that claims reciting “at least about” were invalid for indefiniteness where there was close prior art and there was nothing in the specification, prosecution history, or the prior art to provide any indication as to what range of specific activity is covered by the term “about.” Amgen, Inc. v.Chugai Pharmaceutical Co., 927 F.2d 1200, 18 USPQ2d 1016 (Fed. Cir. 1991). See MPEP § 2173.05(b)(II)(A).
In this case, Applicant uses the term “about” to mean “plus or minus 7% of the provided value” (page 3 line 20). The specification does not provide any examples of what is considered “at least about 12 months” and the percentage with respect to months is unclear. The “at least” limitation could mean at least 12 months but the “about” limitation could mean less than or more than 12 months.
MPEP § 2173.02 (II) states that one of the purposes of examination under 35 USC § 112, second paragraph is to determine whether the claim apprises one of ordinary skill in the art of its scope and, therefore, serves the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent. See, e.g., Solomon v. Kimberly-Clark Corp., 216 F.3d 1372, 1379, 55 USPQ2d 1279, 1283 (Fed. Cir. 2000). See also In re Larsen, No. 01-1092 (Fed. Cir. May 9, 2001) (unpublished). If the language of the claim is such that a person of ordinary skill in the art could not interpret the metes and bounds of the claim so as to understand how to avoid infringement, a rejection of the claim under 35 U.S.C. 112, second paragraph, would be appropriate. See Morton Int’l, Inc. v. Cardinal Chem. Co., 5 F.3d 1464, 1470, 28 USPQ2d 1190, 1195 (Fed. Cir. 1993). In this case, there is no “bright line” by which to evaluate “about”, and so the claim is indefinite. Therefore, claim 95 is indefinite.
For purposes of examination, the claim is interpreted as “about 12 months” which can be less than or more than 12 months.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1-14, 52, 53, 65-70, 79 and 95-102 is/are rejected under 35 U.S.C. 103 as being unpatentable over Hung al. (Patent Application No. 20190249177), Klempíř, Jiří, et al. ("The number of CAG repeats within the normal allele does not influence the age of onset in Huntington's disease." Movement disorders 26.1 (2011): 125-129), Rigo et al. (US Patent No. 11,535,848), Zeun, Paul, et al. ("Fluid and imaging biomarkers for Huntington's disease." Molecular and Cellular Neuroscience 97 (2019): 67-80), Chen et al. (US Patent Application 20200405801) and Byrne et al. ("Neurofilament light protein in blood as a potential biomarker of neurodegeneration in Huntington's disease: a retrospective cohort analysis." The Lancet Neurology 16.8 (2017): 601-609).
Regarding claims 1-4, Hung et al. teaches a method of ameliorating Huntington's disease (HD) in a human subject in need thereof, the method comprising administering to the human subject a therapeutically effective amount of a modified oligonucleotide intrathecally (0083, 0144, 0146), (SEQ ID NO: 4), or a salt thereof (Table 5, SEQ ID NO: 22 is 100% identical to SEQ ID NO: 4 of instant claim). Hung et al. teach administration for several weeks wherein the affects of inhibitory action of the antisense is prolonged to about 16 weeks (0383).
Hung et al. teach the configuration of 5-10-5 gapmers that have twenty linked nucleosides, wherein the central gap segment has ten 2′-deoxynucleotides and is flanked on both sides (in the 5′ and 3′ directions) by wings having five nucleosides each. Each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a 2′-MOE modification. The internucleoside linkages within the central gap segment, the linkages connecting the gap segment to the 5′ or 3′ wing segment, and the linkages for the 5′-most and 3′-most nucleosides of each wing segments are all phosphorothioate (P═S) linkages; the internucleoside linkages connecting the rest of the nucleosides of both the 5′ and 3′ wing segments are phosphodiester linkages; i.e. the gapmer has a mixed backbone. All cytosines throughout each gapmer are 5-methylcytosines and teach Beta-D-deoxyribonucleotides (0284 and 0099).
Regarding claims 5-6, Hung et al. teach at least one symptom is ameliorated such as in claim 6 (0143-0149).
Regarding claims 7-14, 52 and 53, Hung et al. teach the method is measured by reduction of HTT expression (0371) wherein HTT mRNA means reduction of huntingtin protein (0058).
Hung et al. do not teach methods of measuring the mutation IT15 gene with CAG repeats, do not teach the subject is administered 60 to100 mg for 16 weeks and do not teach the improvement of the subject is measured by cUHDRS, TFC, MoCA, C-SSRS, SDMT, SWR or TMS.
Regarding claims 65-70, Klempir et al. teach the gene causing HD is termed IT15 or Huntingtin (htt) and is marked by an expanded number of CAG repeats (see page 125.) Klempir et al. the average number of CAG repeats in a mutant allele is 45 compared to a normal allele having 18. It would have therefore been obvious identify and treat a subject with at least 25 CAG repeats or more as Klempir et al. teach the average number found in HD subjects is 45.
Regarding the limitation of administration of 60-100 mg to a subject, Rigo et al. teach using antisense to treat neurological diseases and teach methods of administration into the intrathecal space (col. 37) wherein the antisense can be administered in doses of .0.1-100 mg (see col. 50 lines 1-25). Given Rigo et al. teach using antisense to treat neurological diseases and teach administration of a range of doses intrathecally, it would have been obvious to one of ordinary skill in the art to use different doses as claimed to identify an optimal dose that results in desired amelioration of symptoms. This is within the skilled artisan routine experimentation to find the workable concentration for treatment. See MPEP 2144.05 "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955).
Regarding claim 79, Zeun et al. teach biomarkers of neuropathology have great potential to track disease change and response to therapeutic intervention (see page 72.4). Zeun et al. teach methods of measuring mHTT in cerebral spinal fluid (CSF) before and after treatment using an antisense oligonucleotide (see page 72.4.1).
It would have therefore been obvious to measure mHTT before and after treatment in the methods taught by Hung et al. as a way to track disease change and response to therapeutic intervention.
Regarding claims 95-99 and 102, Chen et al. teach methods of treatment of HD using targeting sequences of antisense to reduce mHTT in subjects (see 0005) wherein the treatment can be administered every 1-12 months or up to 12 months in length (which encompasses 16 weeks or 4 months) (see 0100). Chen et al. teach the methods can be used to slow down, delay or reverse HD progression and the tests to evaluate these results can be cUHDRS, TFC, MoCA, C-SSRS and TNS. Given that Hung et al. teach the inhibitory effects of the administered antisense oligonucleotide were observed for 16 weeks (0383), it would have been obvious to administer doses every 16 weeks (or 4 months) as taught by Chen et al. It would have been further obvious to one of ordinary skill in the art to use these tests to determine the effectiveness of treatments of HD and one of skill would have been capable of using known methods of evaluating results such as in taught in Chen et al.
Regarding claims 100 and 101, Byrne et al. teach other tests were known to evaluate progression of HD such as SDMT and SWR and it would have been obvious to use these tests along with the other known tests as taught by Chen to evaluate treatment and progression of the disease. One of skill in the would have been capable of using these known tests as taught by Byrne et al.
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Claims 1-14, 52, 53 and 65-70 is/are rejected under 35 U.S.C. 103 as being unpatentable over Frier et al. (US Patent No. 7,951,934), Gaus et al. (Structural Determinants for the Interactions of Chemically Modified Nucleic Acids with the Stabilin-2 Clearance Receptor Biochemistry 2018, 57, 2061−2064), Bennett et al. ("Antisense therapy." Progress in Respiratory Research 31 (2001): 365-369), Mahato et al. ("Modulation of gene expression by antisense and antigene oligodeoxynucleotides and small interfering RNA." Expert opinion on drug delivery 2.1 (2005): 3-28), Klempíř, Jiří, et al. ("The number of CAG repeats within the normal allele does not influence the age of onset in Huntington's disease." Movement disorders 26.1 (2011): 125-129) and Rigo et al. (US Patent No. 11,535,848).
Regarding claims 1-3, 5-14, 52 and 53, Freier et al. teach an antisense oligonucleotide having SEQ ID No. 118 that is identical to the claimed SEQ ID No. 4 (see alignment below).
SEQ ID NO 118
LENGTH: 20
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Oligomeric Compound
Query Match 100.0%; Score 20; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
SEQ 4 1 CTCAGTAACATTGACACCAC 20
SEQ 118 1 CTCAGTAACATTGACACCAC 20
Freier et al. teach the antisense oligonucleotide can be modified (see claims 1-11). Freier et al. teach methods of treating individuals suffering from Huntington’s disease (HD) comprising administration of antisense oligonucleotides (see col. 3 lines 22-66). Freier et al. teach the methods are to improve one or more symptoms of HD (see col 9). Freier et al. teach the antisense can be a sodium salt and teach pharmaceutical compositions (see col. 11). Freier et al. teach administration such as intrathecally (see col. 12, lines 1-5). Freier et al. teach HD is a mutation of an expansion of a CAG repeat region and an individual suffering from HD has been diagnosed thru genetic testing for mutations in the huntingtin gene (see col.1 and 2). Freier et al. teach the antisense targets the gene encoding huntingtin to modulate mRNA and proteins expression (col. 5). Freier et al. do not teach the gapmer specifically has the 5-10-5 configurations represented by the structures and in claim 4.
Regarding the structures and claim 4, Gaus et al. teach making different figurations of gamers and teach a gapmer (ASO 2) wherein the wings are 2’-MOE, the gap region is DNA, all linkages are phosphorothioate except the 3 underlined nucleotides in the wings that was capable of efficiently binding to a target sequence (see Fig. 2).
PNG
media_image1.png
252
356
media_image1.png
Greyscale
It would have been obvious to try modifying the antisense of Freier et al. with modified linkages and modified sugar moieties. Gaus et al. teach their objective was to assess direct binding of a variety of modified antisense oligonucleotides to determine which chemistries provide the weaker or stronger interaction with a target sequence. Gaus et al. tested 10 different modification patterns and their effect on binding to a particular target sequence and because there was a finite number of modification patterns that could be used to modify the antisense oligonucleotide, it would have been obvious to try the modifications using the gapmer taught by Freier et al. to assess optimal binding to the target sequence.
In KSR International Co. v. Teleflex Inc., 550 U.S. 398 (2007), the Supreme Court held that "obvious to try" was a valid rationale for an obviousness finding, for example, when there is a "design need" or "market demand" and there are a "finite number" of solutions. 550 U.S. at 421 ("The same constricted analysis led the Court of Appeals to conclude, in error, that a patent claim cannot be proved obvious merely by showing that the combination of elements was ‘[o]bvious to try.’ ... When there is a design need or market pressure to solve a problem and there are a finite number of identified, predictable solutions, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense. In that instance the fact that a combination was obvious to try might show that it was obvious under §103."). Thus, after KSR, the presence of a known result-effective variable would be one, but not the only, motivation for a person of ordinary skill in the art to experiment to reach another workable product or process.
Regarding claim 4, Freier et al. do not teach using a base modification comprising a 5-methylcytosine or 2′-β-D-deoxyribosyl sugar moiety. Bennett et al. describes using the common modification, 5-methylcytosine, in antisense oligonucleotides to decrease pro-inflammatory properties and increase binding affinity (see Figure 3 and page 312). Likewise, Mahato et al. teach common chemical modifications, such as 2′-β-D-deoxyribosyl sugar moieties, that improve the stability and activity of antisense oligonucleotides (Fig. 2). One of skill in the art would have been motivated to incorporate this modification into the antisense sequence taught by Freier et al. to enhance the properties of the oligonucleotide.
Regarding the limitation of administration of 60-100 mg to a subject, Rigo et al. teach using antisense to treat neurological diseases and teach methods of administration into the intrathecal space (col. 37) wherein the antisense can be administered in doses of .0.1-100 mg (see col. 50 lines 1-25). Given Rigo et al. teach using antisense to treat neurological diseases and teach administration of a range of doses intrathecally, it would have been obvious to one of ordinary skill in the art to use different doses as claimed to identify an optimal dose that results in desired amelioration of symptoms. This is within the skilled artisans routine experimentation to find the workable concentration for treatment. See MPEP 2144.05 "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955).
Regarding claims 65-70, Freier et al. do not teach HD is caused by the mutation IT15, do not teach the number of CAG repeats in a subject having HD and do not teach a specific amount of antisense to administer to a subject as claimed. Klempir et al. teach the gene causing HD is termed IT15 or Huntingtin (htt) and is marked by an expanded number of CAG repeats (see page 125.) Klempir et al. the average number of CAG repeats in a mutant allele is 45 compared to a normal allele having 18. It would have therefore been obvious to identify and treat a subject with at least 25 CAG repeats or more as Klempir et al. teach the average number found in HD subjects is 45.
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Claims 1-14, 52, 53, 79 and 96-102 is/are rejected under 35 U.S.C. 103 as being unpatentable over Freier et al. (US Patent No. 7,951,934), Gaus et al. (Structural Determinants for the Interactions of Chemically Modified Nucleic Acids with the Stabilin-2 Clearance Receptor Biochemistry 2018, 57, 2061−2064), Bennett et al. ("Antisense therapy." Progress in Respiratory Research 31 (2001): 365-369), Mahato et al. ("Modulation of gene expression by antisense and antigene oligodeoxynucleotides and small interfering RNA." Expert opinion on drug delivery 2.1 (2005): 3-28), Rigo et al. (US Patent No. 11,535,848), Zeun, Paul, et al. ("Fluid and imaging biomarkers for Huntington's disease." Molecular and Cellular Neuroscience 97 (2019): 67-80), Chen et al. (US Patent Application 20200405801) and Byrne et al. ("Neurofilament light protein in blood as a potential biomarker of neurodegeneration in Huntington's disease: a retrospective cohort analysis." The Lancet Neurology 16.8 (2017): 601-609).
Regarding claims 1-3, 5, and 6, Freier et al. teach an antisense oligonucleotide having SEQ ID No. 118 that is identical to the claimed SEQ ID No. 4 (see alignment below).
SEQ ID NO 118
LENGTH: 20
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Oligomeric Compound
Query Match 100.0%; Score 20; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
SEQ 4 1 CTCAGTAACATTGACACCAC 20
SEQ 118 1 CTCAGTAACATTGACACCAC 20
Freier et al. teach the antisense oligonucleotide can be modified (see claims 1-11). Freier et al. teach methods of treating individuals suffering from Huntington’s disease (HD) comprising administration of antisense oligonucleotides (see col. 3 lines 22-66). Freier et al. teach the methods are to improve one or more symptoms of HD (see col 9). Freier et al. teach the antisense can be a sodium salt and teach pharmaceutical compositions (see col. 11). Freier et al. teach administration such as intrathecal (see col. 12, lines 1-5). Freier et al. teach HD is a mutation of an expansion of a CAG repeat region and an individual suffering from HD has been diagnosed thru genetic testing for mutations in the huntingtin gene (see col.1 and 2). Freier et al. teach the antisense targets the gene encoding huntingtin to modulate mRNA and proteins expression (col. 5). Freier et al. do not teach the gapmer specifically has the 5-10-5 configurations represented by the structures and in claim 4.
Regarding claim 4, Gaus et al. teach making different figurations of gamers and teach a gapmer (ASO 2) wherein the wings are 2’-MOE, the gap region is DNA, all linkages are phosphorothioate except the underlined nucleotides that was capable of efficiently binding to a target sequence (see Fig. 2).
PNG
media_image1.png
252
356
media_image1.png
Greyscale
It would have been obvious to try modifying the antisense of Freier et al. with modified linkages and modified sugar moieties. Gaus et al. teach their objective was to assess direct binding of a variety of antisense oligonucleotides to determine which chemistries provide the weaker or stronger interaction with a target sequence. Gaus et al. tested 10 different modification patterns and their effect on binding to a particular target sequence and because there was a finite number of modification patterns that could be used to modify the antisense oligonucleotide, it would have been obvious to try the modifications using the gapmer taught by Freier et al.to assess optimal binding to the target sequence.
In KSR International Co. v. Teleflex Inc., 550 U.S. 398 (2007), the Supreme Court held that "obvious to try" was a valid rationale for an obviousness finding, for example, when there is a "design need" or "market demand" and there are a "finite number" of solutions. 550 U.S. at 421 ("The same constricted analysis led the Court of Appeals to conclude, in error, that a patent claim cannot be proved obvious merely by showing that the combination of elements was ‘[o]bvious to try.’ ... When there is a design need or market pressure to solve a problem and there are a finite number of identified, predictable solutions, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense. In that instance the fact that a combination was obvious to try might show that it was obvious under §103."). Thus, after KSR, the presence of a known result-effective variable would be one, but not the only, motivation for a person of ordinary skill in the art to experiment to reach another workable product or process.
Regarding claim 4, Freier et al. do not teach using a base modification comprising a 5-methylcytosine or 2′-β-D-deoxyribosyl sugar moiety. Bennett et al. describes using this common modification in antisense oligonucleotides to decrease pro-inflammatory properties and increase binding affinity (see Figure 3 and page 312). Likewise, Mahato et al. teach common chemical modifications, such as 2′-β-D-deoxyribosyl sugar moieties, that improve the stability and activity of antisense oligonucleotides (Fig. 2). One of skill in the art would have been motivated to incorporate this modification into the antisense sequence taught by Freier et al. to enhance the properties of the oligonucleotide.
Regarding the limitation of administration of 60-100 mg to a subject, Rigo et al. teach using antisense to treat neurological diseases and teach methods of administration into the intrathecal space (col. 37) wherein the antisense can be administered in doses of .0.1-100 mg (see col. 50 lines 1-25). Given Rigo et al. teach using antisense to treat neurological diseases and teach administration of a range of doses intrathecally, it would have been obvious to one of ordinary skill in the art to use different doses as claimed to identify an optimal dose that results in desired amelioration of symptoms. This is within the skilled artisan routine experimentation to find the workable concentration for treatment. See MPEP 2144.05 "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955).
Regarding claim 79, Freier et al. do not teach detection of mHTT before and after administration of the claimed antisense. Zeun et al. teach biomarkers of neuropathology have great potential to track disease change and response to therapeutic intervention (see page 72.4). Zeun et al. teach methods of measuring mHTT in cerebral spinal fluid (CSF) before and after treatment using an antisense oligonucleotide (see page 72.4.1). It would have therefore been obvious to measure mHTT before and after treatment in the methods taught by Freier et al. as a way to track disease change and response to therapeutic intervention.
Regarding claims 95-99 and102, Chen et al. teach methods of treatment of HD using targeting sequences of antisense to reduce mHTT in subjects (see 0005) wherein the treatment can be administered every 1-12 months or up to 12 months in length (which encompasses 16 weeks or 4 months) (see 0100). Chen et al. teach the methods can be used to slow down, delay or reverse HD progression and the tests to evaluate these results can be cUHDRS, TFC, MoCA, C-SSRS and TNS. It would have been obvious to one of ordinary skill in the art to use these tests to determine the effectiveness of treatments of HD and one of skill would have been capable of using known methods of evaluating results such as taught in Chen et al.
Regarding claims 100 and 101, Byrne et al. teach other tests were known to evaluate progression of HD, such as SDMT and SWR, and it would have been obvious to use these tests along with the other known tests as taught by Chen to evaluate treatment and progression of the disease. One of skill in the would have been capable of using these known tests as taught by Byrne et al.
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the "right to exclude" granted by a patent and to prevent possible harassment by multiple assignees. See In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970);and, In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on a nonstatutory double patenting ground provided the reference application or patent either is shown to be commonly owned with this application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP §§ 706.02(l)(1) - 706.02(l)(3) for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/forms/. The filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to http://www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp.
Claims 1-14, 52, 53, 65-70, 79 and 95-102 are provisionally rejected under the judicially created doctrine of double patenting over claims 201-219 of co-pending Application No. 18/291,214 (App ‘214). This is a provisional double patenting rejection since the conflicting claims have not yet been patented. Although the conflicting claims are not identical, they are not patentably distinct from each other because the instant claims and the claims of the patent are drawn to patently indistinguishable subject matter.
Claims of App ‘214 are drawn to methods of reducing Tau protein using an antisense oligonucleotide having SEQ ID No. 4. The instant claims are drawn to using an antisense oligonucleotide having the identical structure of SEQ ID No. 4 to treat Huntington’s disease.
The prior art of Vuono et al. ("The role of tau in the pathological process and clinical expression of Huntington’s disease." Brain 138.7 (2015): 1907-1918) teach Tau protein plays a role in the pathogenic process and clinical expression of Huntington’s disease (see Abstract and page 1908). Thus it would have been obvious to use the method of inhibiting Tau using SEQ ID NO. 4 of App ‘214 in the instant methods of treatment of ameliorating Huntington’s disease. Thus the claims are not patentably distinct from each other because the instant claims and the claims of the patent application are drawn to patently indistinguishable subject matter.
This is a provisional obviousness-type double patenting rejection.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Kimberly Chong at (571)272-3111. The examiner can normally be reached Monday thru Friday between M-F 8:00am-4:30pm.
If attempts to reach the examiner by telephone are unsuccessful please contact the SPE for 1636 Neil Hammell at 571-272-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. For more information about the PAIR system, see http://pair-direct.uspto.gov.
For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199.
/KIMBERLY CHONG/
Primary Examiner Art Unit 1636