Prosecution Insights
Last updated: May 29, 2026
Application No. 17/802,004

G PROTEIN-COUPLED RECEPTOR 146 (GPR146) IRNA COMPOSITIONS AND METHODS OF USE THEREOF

Final Rejection §103§112
Filed
Aug 24, 2022
Priority
Feb 27, 2020 — provisional 62/982,617 +2 more
Examiner
PERSONS, JENNA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Alnylam Pharmaceuticals, Inc.
OA Round
2 (Final)
53%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 53% of resolved cases
53%
Career Allowance Rate
28 granted / 53 resolved
-7.2% vs TC avg
Strong +65% interview lift
Without
With
+65.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
33 currently pending
Career history
98
Total Applications
across all art units

Statute-Specific Performance

§101
0.5%
-39.5% vs TC avg
§103
40.0%
+0.0% vs TC avg
§102
5.6%
-34.4% vs TC avg
§112
13.0%
-27.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 53 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status Applicant’s remarks, and amendments to the claims and specification filed December 19, 2025 are acknowledged. Claims 2, 6, 13, 30, and 42 were amended. Claims 2, 5-6, 13, 25-26, 30, 32, 42-44, 49-50, 56-58, and 68-71 are pending. Restriction/Election Claims 49-50, 56-58, and 71 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention. Claims 2, 5-6, 13, 25-26, 30, 32, 42-44, and 68-70 are under consideration hereinafter. Priority Applicant’s priority claims to provisional Application Nos. 62/982,617 and 63/143,751, and PCT/US2021/019987 are acknowledged. Claims 2, 5-6, 13, 25-26, 30, 32, 42-44, and 68-70 find support in Application No. 62/982,617 filed February 27, 2020, and accordingly, the effective filing date of the claims under examination is February 27, 2020. Withdrawn Rejections Applicant’s remarks and amendments to the claims and specification have been thoroughly reviewed. Applicant’s amendments to claim 42 are sufficient to overcome the § 101 rejection raised in the prior action. Applicant’s amendments to claim 2, to recite specific antisense and sense nucleotide sequences from which the strands of the dsRNA agent must comprise 15 contiguous nucleotides differing by no more than 3 nucleotides, are sufficient to overcome the § 102 and § 103 rejections raised in the prior action. Yosten’s dsRNA agent, upon which the previous action’s prior art rejections relied, does not comprise 15 contiguous nucleotides differing by no more than 3 nucleotides of any one of the antisense or sense nucleotide sequences presently recited in claim 2. Yosten’s dsRNA agent is designed to target a different region of GPR146 mRNA (see Fig. A of the prior action). Applicant’s remarks and amendments have been thoroughly considered, but are not found persuasive to place the claims in condition for allowance for the reasons that follow. Any objection or rejection not reiterated herein has been overcome by amendment. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 30 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The rejection that follows is maintained and modified as necessitated by Applicant’s amendments to the claims. Claim 30 recites “wherein the dsRNA agent is conjugated to the ligand as shown in the following schematic.” The schematic depicts a specific species of ligand (i.e., a specific trivalent GalNAc ligand), conjugated via a specific linker group to the 3’-end of one strand of a generic double-stranded nucleic acid. Claim 25 recites that the dsRNA agent “further compris[es] a ligand.” It is not clear how the dsRNA agent of claim 25, which comprises a generic ligand, is further limited by claim 30. Specifically, it is not clear if the phrase “is conjugated to the ligand as shown in the following schematic,” should be interpreted as further limiting the attachment point of the generic ligand (i.e., at the 3’-end of a strand), the specific linker group through which the generic ligand is attached, and/or the generic ligand itself. Because it is not clear what elements of the schematic of claim 30 are required, or if all elements of the schematic of claim 30 are required, the claim is indefinite. Response to Remarks - 35 USC § 112(b) Applicant’s remarks regarding the § 112(b) rejections raised in the prior action have been reviewed. With respect to the rejection of claim 30, which is maintained above, Applicant submits that amending the claim to depend from claim 25 remedies the indefiniteness. Examiner respectfully disagrees, because it remains unclear how the generic ligand of claim 25 should be further limited by the elements depicted in the schematic of claim 30. Notice to Joint Inventors This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim Rejections - 35 USC § 103 – Yu in view of Foster, GenBank, and Reynolds The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 2, 5-6, 13, 25-26, 32, and 42-44 are rejected under 35 U.S.C. 103 as being unpatentable over Yu (Yu et al., 27 November 2019, Cell 179, pg. 1276-1288; of record) in view of Foster (Foster et al., March 2018, Molecular Therapy, Vol. 26, No. 3, pg. 708-717 and Supplemental Information; of record), GenBank (PREDICTED: Homo sapiens G protein-coupled receptor 146 (GPR146), transcript variant X4, mRNA, NCBI Reference Sequence: XM_005249613.3, available 13 June 2019), and Reynolds (Reynolds et al., 1 February 2004, Vol. 22, No. 3, pg. 326-330). The rejections that follow are new and necessitated by Applicant’s amendments to the claims. The phrase “that corresponds to the antisense sequence” is interpreted as requiring that the selected sense nucleotide sequence be sufficiently complementary to the selected antisense nucleotide sequence to “form[] a double stranded region.” For example, SEQ ID NO: 14 is understood to “correspond” to SEQ ID NO: 149. SEQ ID NO: 14 would not be interpreted as “corresponding” to SEQ ID NO: 256, however. See Fig. A below. FIGURE A 3’ UGUUCACGAACGUAGGACCCCGG 5’ SEQ ID NO: 149 5’ AAGUGCUUGCAUCCUGGGGCC 3’ SEQ ID NO: 14 3’ AAGUCAAACAGUUACUUCACUAC 5’ SEQ ID NO: 256 Yu teaches that “[a]therosclerotic cardiovascular disease remains the leading cause of death worldwide, and elevated plasma LDL-C and TG levels are major risk factors” (pg. 1276, left col.). Yu demonstrates that hepatic GPR146 regulates plasma cholesterol and TG levels in humans and mice (“these data show that GPR146 in hepatocyte plays a role in VLDL metabolism, and that reduced plasma LDL-C and TG levels in Gpr146-/- mice are very likely due to decreased hepatic VLDL secretion rate,” pg. 1277-1279; Fig. 1). Yu demonstrates that deficiency of GPR146 protects against hypercholesterolemia and atherosclerosis in mice lacking LDLR, which models the lipid profile of dyslipidemic humans (pg. 1283-1285; Fig. 6). Yu also demonstrates that administration of an AAV-encoded dsRNA agent (i.e., shRNA) targeting GPR146 lowers plasma cholesterol in mice lacking LDLR (pg. 1285-1286; Fig. 7). Yu teaches that their data suggests that “acute depletion of GPR146 in liver of adult mice reduced TC [total cholesterol] levels to a similar extent compared to germline knockout of GPR146” (pg. 1286). Yu concludes that their study “uncovers GPR146 as a new therapeutic target to treat hypercholesterolemia,” and that “antagonists targeting GPR146 are likely to be an efficient approach to tackle atherosclerotic cardiovascular disease…” (pg. 1286). Yu’s dsRNA agent is an shRNA encoded in an AAV vector, which the skilled artisan would know produces a substrate for siRNA upon expression in a cell. Yu’s dsRNA agent is not, itself, an siRNA, which may comprise various chemical modifications or a ligand, as recited in the instant claims. However, Foster teaches chemically modified dsRNA agents (i.e., siRNAs) which confer “safe and effective targeted delivery of RNAi therapeutics to hepatocytes in vivo” (pg. 708, left col.). Foster teaches that conjugation of a chemically modified siRNA to a triantennary N-acetylgalactosamine ligand targeting the asialoglycoprotein receptor which is “highly expressed on hepatocytes” allows for “robust RNAi-mediated gene silencing in the liver after subcutaneous administration across species, including human” (pg. 708, right col.). Foster teaches that specific patterns of 2’ chemical modifications, i.e., 2’-OMe and 2’-F modifications, throughout both strands of an siRNA, when coupled with terminal phosphorothioate (PS) linkages enhances in vivo stability, and is well tolerated for chronic delivery (pg. 708). Foster teaches two optimized chemical modification patterns, “DV 18” and “DV 22,” which “maintain[] in vitro activity across a large panel of sequences, [which] confirm[s] the generalizability of the [] designs,” and “show[] substantially improved in vivo efficacy and duration” in preclinical species, including non-human primates (pg. 708, 713-714; Fig. 3-5). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have adapted the dsRNA agent of Yu using an siRNA design of Foster (i.e., “DV 18” or “DV 22”), so that the dsRNA agent was an siRNA comprising a specific chemical modification pattern and a triantennary N-acetylgalactosamine ligand. It would have amounted to adapting a known dsRNA agent effective for inhibiting GPR146 gene expression, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in adapting Yu’s dsRNA agent using one of Foster’s siRNA designs comprising a chemical modification pattern and a triantennary GalNAc ligand, because I) Yu teaches their dsRNA agent is effective, II) the skilled artisan would know that Foster’s and Yu’s dsRNA agents share the same function (i.e., as a substrate, or by producing a substrate for, the RNAi pathway), and III) Foster teaches that their designs “maintain[] in vitro activity across a large panel of sequences, confirming the generalizability of the advanced designs.” Based on Yu, GPR146 inhibition, specifically in hepatocytes, is an effective strategy to reduce plasma cholesterol levels and atherosclerosis. Foster teaches dsRNA agent designs which allow for “robust RNAi-mediated gene silencing in liver after subcutaneous administration across species, including human” owing to the GalNAc ligand “targeting the asialoglycoprotein receptor,” and provide “substantially improved in vivo efficacy and duration” in the liver owing to enhanced stability conferred by refined siRNA chemistry. The skilled artisan would have recognized that Foster’s designs would be useful in inhibiting GPR146 in hepatocytes as taught by Yu, and therefore, would have been motivated to apply Foster’s designs to the effective dsRNA agent of Yu. Neither Yu or Foster teach a dsRNA agent in which the antisense and sense strand comprise 15 contiguous nucleotides differing by no more than 3 nucleotides from an antisense nucleotide sequence and corresponding sense nucleotide sequence recited in instant claim 2. However, GenBank teaches a human GPR146 mRNA sequence, to which the antisense strand sequences corresponding to SEQ ID NOs: 149, 150, and 256 are 100% complementary, and the sense strand sequences corresponding to SEQ ID NOs: 14, 15, and 121 are 100% identical. See attached alignments in Appendix I. Reynolds teaches that the knockdown efficacy of an siRNA depends on its sequence (Fig. 1, pg. 326, left col.). Reynolds teaches that the average probability of selecting an siRNA targeting a “complete mRNA” “at random,” that induces silencing by more than 50%, is 46.5% in a validation study of six different genes (pg. 327, right col.). In a separate experiment, Reynolds illustrates that a substantial proportion of siRNAs designed to a target RNA region are effective at knocking down target gene expression (“About 78% of the siRNAs induced more than 50% silencing (>F50) of the two mRNA regions targeted here,” pg. 326, left col.; Fig. 1). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the sequences of Yu’s dsRNA agent in the agent rendered obvious above, to arrive at a sense and antisense strand comprising the aforementioned SEQ ID NOs recited instant claim 2. It would have amounted to preparing dsRNAs targeting a known human GPR146 sequence, using a known “generalizable” dsRNA agent design, by known means to yield predictable results. The skilled artisan would have recognized based on Reynolds that efficacy of siRNAs differs depending on their sequence (Fig. 1), and that designing and testing siRNAs to a desired target could identify the most efficacious siRNA for a particular application. The antisense strand sequences corresponding to SEQ ID NOs: 149, 150, and 256 are 23-nts in length and 100% complementary to the GenBank sequence, and the sense strand sequences corresponding to SEQ ID NOs: 14, 15, and 121 are 21-nts in length and 100% identical to the GenBank sequence. See attached alignments in Appendix I. Foster’s siRNA designs consist of a 23-nt antisense strand, and a 21-nt sense strand (Fig. 2). The skilled artisan could have arrived at the instantly claimed dsRNA agents by simply applying one of Foster’s optimized designs to the human GPR146 mRNA sequence taught by GenBank. The GenBank sequence is 2,108 nts in length, and thus, the instantly claimed dsRNA agents would have been among the 2,085 possible solutions comprising a 23-nt antisense strand and 21-nt sense strand. As evidenced by at least Foster, designing and testing of thousands of siRNAs was within the purview of the skilled artisan (“Using an in vitro silencing dataset of 1,890 duplexes…,” pg. 709). The skilled artisan could have prepared siRNAs comprising the aforementioned SEQ ID NOs recited in instant claim 2 with one of Foster’s optimized siRNA designs (i.e., “DV 18” and “DV 22”) with a reasonable expectation of success because the GPR146 mRNA sequence was known, Foster teaches their siRNA designs are “generalizable” and effective, and Reynolds illustrates that a substantial proportion of siRNAs designed to a target RNA are effective at knocking down target gene expression. The skilled artisan would have been motivated to prepare siRNAs to the human GPR146 mRNA sequence taught by GenBank because Yu teaches that their study “uncovers GPR146 as a new therapeutic target to treat hypercholesterolemia,” and that “antagonists targeting GPR146 are likely to be an efficient approach to tackle atherosclerotic cardiovascular disease….” (pg. 1286). Regarding claims 5-6, the dsRNA agent rendered obvious above comprises at least one modified nucleotide, wherein substantially all of the nucleotides of the sense strand and antisense strand comprise a modification (Fig. 2, Foster). Regarding claim 13, the dsRNA agent rendered obvious above comprises (g) a sense strand 21 nucleotides in length and an antisense strand 23 nucleotides in length (Fig. 2, Foster). Regarding claims 25-26, the dsRNA agent rendered obvious above comprises a ligand, wherein the ligand is conjugated to the 3’ end of the sense strand of the dsRNA agent (“The GalNAc ligand was introduced at the 3’ end of the sense strand,” pg. 714, right col., Foster). Regarding claim 32, the dsRNA agent rendered obvious above comprises at least one phosphorothioate linkage (“PS linkages were introduced between antisense nucleotides 1 and 2, 2 and 3, 21 and 22, and 22 and 23 from the 5’ end, as well as sense nucleotides 1 and 2 and 2 and 3 from the 5’ end,” pg. 714, right col., Foster). Regarding claim 42, the term “isolated cell” is interpreted as any cell separated from an environment, e.g., a cell removed from an organism, a cultured cell, etc. Yu teaches isolated cells (“Cell Lines, Culture Conditions, Transfection and Infection,” e3). Regarding claim 43, Yu teaches a pharmaceutical composition comprising the dsRNA agent (“To knock down hepatic Gpr146 in vivo… were administered… via retro-orbital injection, with a dose of…,” “In vivo knockdown of hepatic Gpr-146 using AAV-delivered shRNA,” e4). Regarding claim 44, the claim recites both “unbuffered” and “buffered” solutions, such that, at present, the claim encompasses essentially any solution comprising the dsRNA agent. Yu’s composition is a solution (i.e., a mixture of two or more substances) comprising the dsRNA agent, as evidenced by the fact that it is injected at a particular dose (“To knock down hepatic Gpr146 in vivo… were administered… via retro-orbital injection, with a dose of…,” “In vivo knockdown of hepatic Gpr-146 using AAV-delivered shRNA,” e4). Thus, Yu’s composition is understood to meet the structural limitations of instant claim 44. Claim Rejections - 35 USC § 103 – Yu, Foster, GenBank, and Reynolds, in further view of Nair Claim 30 is rejected under 35 U.S.C. 103 as being unpatentable over Yu (Yu et al., 27 November 2019, Cell 179, pg. 1276-1288; of record), Foster (Foster et al., March 2018, Molecular Therapy, Vol. 26, No. 3, pg. 708-717 and Supplemental Information; of record), GenBank (PREDICTED: Homo sapiens G protein-coupled receptor 146 (GPR146), transcript variant X4, mRNA, NCBI Reference Sequence: XM_005249613.3, available 13 June 2019), and Reynolds (Reynolds et al., 1 February 2004, Vol. 22, No. 3, pg. 326-330) as applied to claims 2, 5-6, 13, 25-26, 32, and 42-44 above, and in further view of Nair (Nair et al., 1 December 2014, JACS, 136, pg. 16958-16961; of record). The rejection that follows is new and necessitated by Applicant’s amendments to the claims. Regarding claim 30, in view of the indefiniteness described above, claim 30 is interpreted as requiring that the dsRNA agent comprise the complete structure depicted in the schematic. The teachings of Yu, Foster, GenBank, and Reynolds are described above and applied as to claims 2, 5-6, 13, 25-26, 32, and 42-44 hereinafter. None of Yu, Foster, GenBank, or Reynolds provide the structure of a triantennary N-acetylgalactosamine ligand with a linker and attachment as depicted in claim 30’s schematic. However, Foster references Nair et al. as providing the siRNA design which was used as the basis to optimize the 2’ chemical modifications (“As a starting point for these experiments we utilized a previously reported siRNA design.14,17,” pg. 709, left col.). Nair discloses an siRNA design with a triantennary N-acetylgalactosamine ligand, linker, and attachment identical to that disclosed in the schematic of claim 30 (“Scheme 1. Synthesis and siRNA Conjugation of Monomer 1,” pg. 16959). Nair discloses the methods to synthesize and conjugate the ligand to an siRNA (“Syntheses of 1-4 and their conjugation to siRNA are described in detail in the Supporting Information,” pg. 16959). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to substitute the generically attached triantennary N-acetylgalactosamine ligand in the dsRNA agent rendered obvious above, for a specific triantennary N-acetylgalactosamine ligand and attachment taught by Nair. It would have amounted to a simple substitution of one triantennary N-acetylgalactosamine ligand for another, known triantennary N-acetylgalactosamine ligand, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in preparing the dsRNA agent rendered obvious above as taught by Nair, because I) Foster specifically references Nair as providing the basis for their design, which includes the triantennary N-acetylgalactosamine ligand, and II) Nair provides the instructions to synthesize and conjugate the triantennary N-acetylgalactosamine ligand to a dsRNA agent. The skilled artisan would have been motivated to substitute the ligands because Foster specifically points the skilled artisan to Nair et al. for further description of the siRNA design, and Nair, accordingly, provides the structure for Foster’s otherwise generically attached ligand. Claim Rejections - 35 USC § 103 – Yu, Foster, GenBank, and Reynolds, in further view of Tarveda Claims 68-70 are rejected under 35 U.S.C. 103 as being unpatentable over Yu (Yu et al., 27 November 2019, Cell 179, pg. 1276-1288; of record), Foster (Foster et al., March 2018, Molecular Therapy, Vol. 26, No. 3, pg. 708-717 and Supplemental Information; of record), GenBank (PREDICTED: Homo sapiens G protein-coupled receptor 146 (GPR146), transcript variant X4, mRNA, NCBI Reference Sequence: XM_005249613.3, available 13 June 2019), and Reynolds (Reynolds et al., 1 February 2004, Vol. 22, No. 3, pg. 326-330) as applied to claims 2, 5-6, 13, 25-26, 32, and 42-44 above, and in further view of Tarveda (Kadiyala et al., 27 September 2018, US 2018/0273948 A1; of record). The rejection that follows is new and necessitated by Applicant’s amendments to the claims. The teachings of Yu, Foster, GenBank, and Reynolds are described above and applied as to claims 2, 5-6, 13, 25-26, 32, and 42-44 hereinafter. None of Yu, Foster, GenBank, or Reynolds teach a kit, vial, or syringe comprising the dsRNA agent. However, Tarveda teaches dsRNA agents which are in a kit, vial, or syringe (“RNAi agents and specifically siRNA molecules are included in a kit,” [0526]; “container means of the kits will generally include at least one vial… syringe,” [0527]). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have packaged the dsRNA agent rendered obvious above in a kit, vial, or syringe in view of Tarveda. It would have amounted to a simple combination of an obvious dsRNA agent with known packaging, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in packaging the dsRNA agent in a kit, vial, or syringe, because Tarveda teaches substantially identical dsRNA agents which are packaged as such, and the skilled artisan would also know that these are common means to package nucleic acids, e.g., for the purposes of storage and administration. The skilled artisan would have been motivated to package the dsRNA agent in a kit, vial, or syringe because doing so would allow the skilled artisan to store and/or administer the dsRNA agent, which would be necessary for the therapeutic purposes described above by Yu. Response to Remarks - 35 USC § 103 Applicant’s remarks regarding the § 103 rejections raised in the prior action have been reviewed. As described above, the prior art rejections raised in the previous action have been withdrawn in view of Applicant’s amendments to the claims. Applicant’s remarks are addressed below as they pertain to the new rejections above. Applicant submits that “the claimed dsRNA agents demonstrated high efficacy of knockdown of GPR146 mRNA in vitro by about 50% for AD-1193176.1, about 40% for AD-1193177.1, and about 90% for AD-1187915.1 at 10nM (See Table 4).” Examiner has considered Applicant’s evidence of alleged unexpected results. Applicant’s evidence in Table 4 is derived from dsRNA agents which, based on the guidance in the specification regarding the synthesis of the dsRNA agents, consist of specific combinations of chemically-modified sense and antisense strand sequences (“siRNA sequences were synthesized… using the solid support mediated phosphoramidite chemistry… 2’F 2’-O-Methyl, GNA (glycol nucleic acids), 5’ phosphate and other modifications were introduced using the corresponding phosphoramidites. Synthesis of 3’ GalNAc conjugated single strands was performed on a GalNAc modified CPG support… The concentration of each duplex was normalized… and then submitted for in vitro screening assays.”“siRNA Synthesis,” pg. 118). See sense and antisense strand sequences of AD-1193176, AD-1193177, and AD-1187915 in Table 3. The instant claims encompass a genus of dsRNA agents comprising “at least 15 contiguous nucleotides differing by no more than 3 nucleotides” from one of the recited antisense nucleotide sequences and a corresponding sense nucleotide sequence. The instant claims do not require dsRNA agents with the specific combination of sense and antisense strand sequences, specific chemical modification patterns applied thereto, or the specific GalNAc ligand, to which the Applicant’s proffered data corresponds based on the specification. There is also insufficient evidence that the results obtained with the specific species referred to by Applicant would be expected across the claimed genus. In addition, the prior art teaches dsRNA agents which achieve Applicant’s “high efficacy of knockdown” of GPR146 (“50-60% knockdown,” Yosten, pg. B2; “GPR146 mRNA expression level in liver was strongly reduced by 75% compared to scramble control,” Yu, pg. 1285, Fig. S7), and illustrates that many siRNAs designed to target a gene of interest achieve the levels of knockdown achieved by Applicant (see Reynolds, Fig. 1, pg. 327, right col.). There is insufficient evidence that the levels of GPR146 knockdown achieved using the specific species referred to by Applicant were unexpected. Taken together, at present, Applicant’s proffered data is not commensurate in scope with the claims, and does not appear unexpected based on the prior art related to GPR146 knockdown using dsRNA agents. Conclusion No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JENNA L PERSONS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600
Read full office action

Prosecution Timeline

Aug 24, 2022
Application Filed
Sep 30, 2025
Non-Final Rejection mailed — §103, §112
Dec 19, 2025
Response Filed
Mar 27, 2026
Final Rejection mailed — §103, §112
May 27, 2026
Response after Non-Final Action

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12606835
AUTO-INDUCTION REGULATORY SYSTEM BASED ON QUORUM SENSING AND APPLICATION THEREOF
3y 9m to grant Granted Apr 21, 2026
Patent 12595484
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
1y 5m to grant Granted Apr 07, 2026
Patent 12570705
MODIFIED LIGAND-GATED ION CHANNELS AND METHODS OF USE
4y 7m to grant Granted Mar 10, 2026
Patent 12570975
COMPOSITION FOR DIAGNOSIS OR TREATMENT OF A CONDITION ASSOCIATED WITH INCREASED ACTIVITY OF EIF4E COMPRISING AN EIF4E INHIBITOR
4y 8m to grant Granted Mar 10, 2026
Patent 12570706
MODIFIED LIGAND-GATED ION CHANNELS AND METHODS OF USE
4y 6m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
53%
Grant Probability
99%
With Interview (+65.0%)
3y 6m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 53 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month