Prosecution Insights
Last updated: April 19, 2026
Application No. 17/845,178

USE OF SCAMP3 INHIBITORS FOR TREATING HEPATITIS B VIRUS INFECTION

Non-Final OA §112
Filed
Jun 21, 2022
Examiner
POLIAKOVA-GEORGAN, EKATERINA
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Hoffmann-La Roche, Inc.
OA Round
1 (Non-Final)
65%
Grant Probability
Favorable
1-2
OA Rounds
2y 8m
To Grant
81%
With Interview

Examiner Intelligence

Grants 65% — above average
65%
Career Allow Rate
434 granted / 668 resolved
+5.0% vs TC avg
Strong +16% interview lift
Without
With
+16.2%
Interview Lift
resolved cases with interview
Typical timeline
2y 8m
Avg Prosecution
55 currently pending
Career history
723
Total Applications
across all art units

Statute-Specific Performance

§101
5.4%
-34.6% vs TC avg
§103
28.6%
-11.4% vs TC avg
§102
22.8%
-17.2% vs TC avg
§112
24.2%
-15.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 668 resolved cases

Office Action

§112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of Group I, claims 1-7, 9, 27, 28, in the reply filed on 08/07/2025 is acknowledged. Claims 10-11, 13-16, 18-26 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Group, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 08/07/2025. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-3 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Claims are broadly drawn to methods of treating diseases such as Hepatitis B virus (HBV) infection in a subject in need thereof by administering inhibitors of SCAMP3. Instant claims encompass administration of a wide genus of SCAMP3 inhibitors such as small molecule inhibitors, antibodies and nucleic acid-based inhibitors. Instant specification describes a wide genus of possible SCAMP3 inhibitors such as antibodies, antibody fragments and small molecules (see paragraph [0204]) and nucleic acid-based inhibitors (see paragraphs [0205-0208]). Further, instant specification demonstrates effectiveness in HBV treatment of only one class of inhibitors, nucleic acid-based ones, siRNAs and antisense oligonucleotides (see Examples). It is well known in the art that mechanism of action of different inhibitors varies drastically between them. For example, antibodies generally bind to specific protein and prevent its interactions with other metabolites. Antisense oligonucleotides and siRNAs have extremely different way of activity: they generally bind to mRNA encoding specific protein, destroying it, therefore preventing translation of the protein in the cell. Because mechanisms of action vary so widely, one can never predict if an inhibitor with one action mechanism can be substituted with the inhibitor with totally different mechanism of action, providing the same effect. Instant specification does not describe structure for representative species of Applicant’s broadly claimed genus. Thus their function of treating HBV is either unknown or unpredictable. The genus of SCAMP3 inhibitors encompasses a large number of unknown structures and one of skilled in the art cannot reliably predict which member of the genus would successfully treat HBV, and which will not. There is no description of the necessary and sufficient elements of the species encompassed by the breadth of the claims. The only species described in specification are siRNAs and ASOs. Applicant fails to describe representative members of Applicant's broadly claimed genus. One of the skill in the art would not recognize that Applicant was in possession of the necessary common attributes or features of the genus in view of the disclosed species. Since the disclosure fails to describe the common attributes that identify members of the genus, and because the genus is highly variant, siRNAs and ASOs are not sufficient to describe the claimed genus. Therefore, given the lack of written description in the specification with regard to the structural and functional characteristics of the claimed compositions, it is not clear that Applicant was in possession of the claimed genus at the time this application was filed. Claim 28 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Claims are broadly drawn to methods of treating diseases such as Hepatitis B virus (HBV) infection in a subject in need thereof by administering inhibitors of SCAMP3. Instant claims encompass treatment of a wide variety of diseases, which are not specifically defined. Instant specification describes treatment of only one disease, HBV (see Examples). Instant specification does not describe structure for representative species of Applicant’s broadly claimed genus. Thus it is not clear which diseases can be treated by instantly claimed method. The genus of diseases to treat encompasses a large number of unknown diseases and one of skilled in the art cannot reliably predict which member of the genus can be treated by instant method, and which will not. There is no description of the necessary and sufficient elements of the species encompassed by the breadth of the claims. The only species described in specification is HBV. Applicant fails to describe representative members of Applicant's broadly claimed genus. One of the skill in the art would not recognize that Applicant was in possession of the necessary common attributes or features of the genus of diseases to treat in view of the disclosed species. Since the disclosure fails to describe the common attributes that identify members of the genus, and because the genus is highly variant, HBV is not sufficient to describe the claimed genus. Therefore, given the lack of written description in the specification with regard to the structural and functional characteristics of the claimed compositions, it is not clear that Applicant was in possession of the claimed genus at the time this application was filed. Claims 1-7, 9, 27-28 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for treatment of HBV with siRNAs of SEQ ID NOs: 6-9 and ASOs of SEQ ID NOs: 19-21, does not reasonably provide enablement for treatment of HBV with any oligonucleotide with complementarity to SEQ ID NOs: 1-4. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims. The claimed invention is not supported by an enabling disclosure taking into account the Wands factors. In re Wands, 858/F.2d 731, 8 USPQ2d 1400 (Fed. Cir. 1988). In re Wands lists a number of factors for determining whether or not undue experimentation would be required by one skilled in the art to make and/or use the invention. These factors are: the quantity of experimentation necessary, the amount of direction or guidance presented, the presence or absence of working examples of the invention, the nature of the invention, the state of the prior art, the relative skill of those in the art, the predictability or unpredictability of the art, and the breadth of the claim. Instant claims are broadly drawn to treatment of HBV by administering oligonucleotides 12-30 nucleotides long with 95-98% complementarity to instant SEQ ID NOs: 1-4. Instant claims encompass treatment of HBV by administering an extremely wide genus of possible oligonucleotides targeting instant SEQ ID NOs: 1-4. In case of claim 7 such oligonucleotide is required to target BOTH SEQ ID NOs: 1 and 2 (emphasis added). Instant specification demonstrates activity in HBV treatment for only 7 oligonucleotides, siRNAs of SEQ ID NOs: 6-9 and ASOs of SEQ ID NOs: 19-21, which target only instant SEQ ID NO: 1 and are fully complementary to it (see Examples). Specification does not show any examples of oligonucleotides with less than 100% complementarity to instant SEQ ID NO: 1, or targeting any of SEQ ID NOs: 2-4. Prior art has examples of oligonucleotides targeting different genes than SCAMP3 and still 100% complementary to instant SEQ ID NO: 1. For example, Zhang et al (WO 2019/200185, October 2019) disclose oligonucleotides targeting dystrophin transcript (see Abstract), one of which, of SEQ ID NO: 1608 (see claim 13, sequence listing), is fully complementary to oligonucleotides 3055-3084 of instant SEQ ID NO: 1 (see sequence alignment below): CC PN WO2019200185-A1. XX CC PD 17-OCT-2019. XX CC PF 11-APR-2019; 2019WO-US027109. XX PR 12-APR-2018; 2018US-0656949P. PR 11-MAY-2018; 2018US-0670709P. PR 07-AUG-2018; 2018US-0715684P. PR 27-AUG-2018; 2018US-0723375P. PR 06-DEC-2018; 2018US-0776432P. XX CC PA (WAVE-) WAVE LIFE SCI LTD. CC PA (ZHAN/) ZHANG J J. CC PA (VARG/) VARGEESE C. CC PA (IWAM/) IWAMOTO N. CC PA (SHIV/) SHIVALILA C S. CC PA (KOTH/) KOTHARI N. CC PA (DURB/) DURBIN A F. CC PA (RAMA/) RAMASAMY S. CC PA (KAND/) KANDASAMY P. CC PA (KUMA/) KUMARASAMY J. CC PA (BOMM/) BOMMINENI G R. CC PA (MARA/) MARAPPAN S. CC PA (DIVA/) DIVAKARAMENON S. CC PA (BUTL/) BUTLER D C D. CC PA (LUGG/) LU G. CC PA (YANG/) YANG H. CC PA (SHIM/) SHIMIZU M. CC PA (MONI/) MONIAN P. XX CC PI Zhang JJ, Vargeese C, Iwamoto N, Shivalila CS, Kothari N; CC PI Durbin AF, Ramasamy S, Kandasamy P, Kumarasamy J, Bommineni GR; CC PI Marappan S, Divakaramenon S, Butler DCD, Lu G, Yang H, Shimizu M; CC PI Monian P; XX DR WPI; 2019-86541L/88. XX CC PT Oligonucleotide composition comprises multiple of oligonucleotides of CC PT particular oligonucleotide type defined by base sequence, pattern of CC PT backbone linkages, pattern of backbone chiral centers, pattern of CC PT backbone phosphorus modifications. XX CC PS Claim 13; SEQ ID NO 1608; 981pp; English. XX CC The present invention relates to a novel oligonucleotide composition, CC useful in altering the splicing of a target transcript. The CC oligonucleotide composition comprises a plurality of oligonucleotides of CC a particular oligonucleotide type defined by (1) base sequence, (2) CC pattern of backbone linkages, (3) pattern of backbone chiral centers, and CC (4) pattern of backbone phosphorus modifications. The invention also CC provides: a pharmaceutical composition comprising the oligonucleotide CC composition and a pharmaceutically acceptable carrier; a method for CC altering the splicing of a target transcript by administering the CC oligonucleotide composition; a method for treating muscular dystrophy, CC Duchenne muscular dystrophy (DMD), or Becker muscular dystrophy (BMD); a CC method for preparing the oligonucleotide or oligonucleotide composition; CC and an oligonucleotide comprising an internucleotide linkage. XX SQ Sequence 30 BP; 8 A; 4 C; 7 G; 0 T; 11 U; 0 Other; Query Match 0.5%; Score 30; Length 30; Score over Length 100.0%; Best Local Similarity 100.0%; Matches 30; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 3055 ATGGTGAAACCCTGTCTCTACTAAAAATAC 3084 |||||||||||||||||||||||||||||| Db 30 ATGGTGAAACCCTGTCTCTACTAAAAATAC 1 Thus prior art shows that at least some oligonucleotides targeting instant SEQ ID NO: 1 also target other genes, meaning that administration of such oligonucleotide will at least have some non-specific effects or even might have no effect on SCAMP3 at all, therefore not treating HBV. The guidance provided in the specification concerning HBV treatment is only limited to 7 specific oligonucleotides targeting instant SEQ ID NO: 1 and fails to address the issue of identifying other oligonucleotides targeting instant SEQ ID NOs: 1-4 and capable of HBV treatment. In the absence of guidance, undue trial and error experimentation would have been required by one skilled in the art at the time invention was made to isolate oligonucleotides targeting instant SEQ ID NOs: 1-4 for HBV treatment as instantly claimed. Given the breadth of the claims, unpredictability of the art and lack of guidance of the specification, as discussed above, undue experimentation would be required by one skilled in the art to make and use the claimed invention commensurate in scope with the claims. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to EKATERINA POLIAKOVA whose telephone number is (571)270-5257. The examiner can normally be reached Mon-Fri 8-5. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571)272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /EKATERINA POLIAKOVA-GEORGANTAS/Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Jun 21, 2022
Application Filed
Aug 21, 2025
Non-Final Rejection — §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600964
Compound for treatment of heart failure
2y 5m to grant Granted Apr 14, 2026
Patent 12595477
COMPLEMENT FACTOR B-MODULATING COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Apr 07, 2026
Patent 12584130
ANGIOTENSINOGEN (AGT) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Mar 24, 2026
Patent 12576030
COMPOSITIONS FOR DELIVERY OF CODON-OPTIMIZED MRNA
2y 5m to grant Granted Mar 17, 2026
Patent 12570977
NOVEL MRNA COMPOSITION AND PRODUCTION METHOD FOR USE IN ANTI-VIRAL AND ANTI-CANCER VACCINES
2y 5m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
65%
Grant Probability
81%
With Interview (+16.2%)
2y 8m
Median Time to Grant
Low
PTA Risk
Based on 668 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month