DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
Applicant’s amendments to the claims filed March 10, 2023 are acknowledged. Claim 13 was amended, and claims 3 and 14 were cancelled. Claims 1-2, 4-13, and 15-29 are pending.
Restriction/Election
Restriction to one of the following inventions is required under 35 U.S.C. 121:
Group I, claims 1-2, 4-9, and 27-29, drawn to a method of treating or preventing a disease in a subject, comprising administering to the subject an effective amount of the nucleic acid molecule according to claim 10 (described in Group II below), an in vivo or in vitro method for inhibiting SBDS expression in a target cell expressing SBDS, comprising administering an effective amount of the nucleic acid molecule according to claim 10, and a method of treating or preventing a Hepatitis B virus (HBV) infection in a subject, comprising administering to the subject an effective amount of an SBDS inhibitor. The invention is classified in at least A61K 48/005.
Group II, claims 10-13, and 15-26, drawn to a nucleic acid molecule of 12 to 30 nucleotides in length comprising a contiguous nucleotide sequence of at least 12 nucleotides which is 90% complementary to a mammalian SBDS target sequence, wherein the nucleic acid molecule is capable of inhibiting the expression of SBDS mRNA, as well as a pharmaceutically acceptable salt of the nucleic acid molecule, and a conjugate compound and pharmaceutical composition comprising the nucleic acid molecule. The invention is classified in at least C12N 15/113 and C12N 2310/351.
The inventions are independent or distinct, each from the other because:
Groups I and II are related as product and processes of use. The inventions can be shown to be distinct if either or both of the following can be shown: (1) the process for using the product as claimed can be practiced with another materially different product or (2) the product as claimed can be used in a materially different process of using that product. See MPEP § 806.05(h). In the instant case, the nucleic acid molecule of Group II can be used in materially different processes from those of Group I. For example, the nucleic acid molecule could be used in a method of inhibiting expansion of differentiating erythroid cells as taught by Sen (Sen et al., 8 December 2011, Red Cells, Iron, and Erythropoiesis, Vol. 118, No. 24, pg. 6407-6417), or in a method of shortening telomeres as disclosed by Liu (specification, pg. 2, lines 22-26).
Restriction for examination purposes as indicated is proper because all inventions listed in this action are independent or distinct for the reasons given above and there would be a serious search and/or examination burden if restriction were not required because one or more of the following reasons apply:
The Groups of inventions are classified in different areas (see paragraph 3 of this action). Examination of each Group would require unique search queries within at least the classifications listed above, as well as unique text searches.
Applicant’s Response
Applicant is advised that the reply to this requirement to be complete must include (i) an election of an invention to be examined (i.e., one of Groups I-II above) even though the requirement may be traversed (37 CFR 1.143), and (ii) identification of the claims encompassing the elected invention.
Means for Traversal
The election of an invention may be made with or without traverse. To reserve a right to petition, the election must be made with traverse. If the reply does not distinctly and specifically point out supposed errors in the restriction requirement, the election shall be treated as an election without traverse. Traversal must be presented at the time of election in order to be considered timely. Failure to timely traverse the requirement will result in the loss of right to petition under 37 CFR 1.144. If claims are added after the election, applicant must indicate which of these claims are readable upon the elected invention.
Should applicant traverse on the ground that the inventions are not patentably distinct, applicant should submit evidence or identify such evidence now of record showing the inventions to be obvious variants or clearly admit on the record that this is the case. In either instance, if the examiner finds one of the inventions unpatentable over the prior art, the evidence or admission may be used in a rejection under 35 U.S.C. 103 or pre-AIA 35 U.S.C. 103(a) of the other invention.
Notice of Possible Rejoinder
The examiner has required restriction between product or apparatus claims and process claims. Where applicant elects claims directed to the product/apparatus, and all product/apparatus claims are subsequently found allowable, withdrawn process claims that include all the limitations of the allowable product/apparatus claims should be considered for rejoinder. All claims directed to a nonelected process invention must include all the limitations of an allowable product/apparatus claim for that process invention to be rejoined.
In the event of rejoinder, the requirement for restriction between the product/apparatus claims and the rejoined process claims will be withdrawn, and the rejoined process claims will be fully examined for patentability in accordance with 37 CFR 1.104. Thus, to be allowable, the rejoined claims must meet all criteria for patentability including the requirements of 35 U.S.C. 101, 102, 103 and 112. Until all claims to the elected product/apparatus are found allowable, an otherwise proper restriction requirement between product/apparatus claims and process claims may be maintained. Withdrawn process claims that are not commensurate in scope with an allowable product/apparatus claim will not be rejoined. See MPEP § 821.04. Additionally, in order for rejoinder to occur, applicant is advised that the process claims should be amended during prosecution to require the limitations of the product/apparatus claims. Failure to do so may result in no rejoinder. Further, note that the prohibition against double patenting rejections of 35 U.S.C. 121 does not apply where the restriction requirement is withdrawn by the examiner before the patent issues. See MPEP § 804.01.
Oral Election – September 4, 2025
Applicant’s representative Yan Qi (Reg. No. 73,252) elected Group I (claims 1-2, 4-9, and 27-29) telephonically on September 4, 2025. Affirmation of this election must be made by Applicant in reply to this Office action. Claims 10-13, and 15-26 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a non-elected invention. Accordingly, claims 1-2, 4-9, and 27-29 are under examination herein.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - The Incorporation by Reference paragraph required by 37 CFR 1.821(c)(1) is missing. See item 1) a) or 1) b) above.
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Priority
Applicant’s priority claims to Application Nos. EP19217783.0 and PCT/EP2020/086665 are acknowledged. Claims 1-2, 4-9, and 27-29 find support in Application No. EP19217783.0, filed December 19, 2019. The effective filing date of the claims under examination is December 19, 2019.
Claim Objections
Claims 4, and 6-7 are objected to because of the following informalities:
Claim 4 recites “an nucleic acid molecule,” which should be amended to recite “a[[n]] nucleic acid molecule.”
Claim 6 recites “the mammalian SBDS target sequence,” whereas claim 4 recites “a mammalian SBDS target nucleic acid.” It would be preferable to amend claim 6 to recite the same terminology as claim 4, i.e., “the mammalian SBDS target nucleic acid
Claim 7 recites “the target nucleic acid,” whereas claim 4 recites “a mammalian SBDS target nucleic acid.” It would be preferable to amend claim 7 to recite the same terminology as claim 4, i.e., “the mammalian SBDS target nucleic acid.”
Appropriate correction is required.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 8 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 8 is indefinite for being incomplete due to its dependence from cancelled claim 3 (“The method according to claim 3”). The claim is also indefinite due to lack of antecedent basis for its limitations (“the amount of cccDNA in an HBV infected cell is reduced by at least 60%”), which are not present due to its dependence from cancelled claim 3.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-2, 4-9, and 28-29 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method of reducing HBV intracellular DNA, pgRNA, and/or cccDNA levels in HBV-infected primary human hepatocytes in vitro, by administering the specific siRNA pool or LNAs described in Examples 1-2 (pgs. 62-63), does not reasonably provide enablement for treating or preventing a disease in a subject, or treating or preventing a Hepatitis B virus (HBV) infection in a subject, by administering an SBDS inhibitor, or a nucleic acid molecule according to claim 10. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims for the reasons that follow.
The test of enablement is whether one skilled in the art could make or use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics Inc., 857 F.2d 778, 785, 8 USPQ2d 1217, 1223 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor, but rather is a conclusion reached by weighing many factors. These factors were outlined in In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988), and the most relevant factors are indicated below:
Nature of the Invention and Breadth of the Claims – Claims 1 and 28-29
Claims 1 and 28-29 are directed to methods of treating or preventing “a Hepatitis B virus (HBV) infection in a subject,” and “a disease in a subject,” “wherein the disease is a Hepatitis B Virus (HBV) infection,” respectively. Based on the specification, the claims are interpreted as encompassing methods which relieve or ameliorate one or more symptoms of existing disease, or prevent the onset or progression of disease in any subject, e.g., “humans and other animals… and other organisms” (pg. 33, lines 5-16). For example, in the case of a HBV infection, “preventing” encompasses preventing acute HBV infection, or “preventing an HBV infection from turning into a chronic HBV infection or the prevention of severe liver diseases…” (pg. 33, lines 8-10).
The method of claim 1 requires “administering to the subject… a SBDS (SBDS ribosome maturation factor) inhibitor.” The structure of the SBDS inhibitor is not limited, and the specification generally describes small molecule inhibitors, antibodies and antibody fragments, aptamers, and antisense nucleic acids (pg. 34-40). The methods of claims 28-29 require “administering to the subject… a nucleic acid molecule according to claim 10,” wherein the nucleic acid molecule of claim 10 is capable of inhibiting the expression of SBDS mRNA, is 12-30 nucleotides in length, and comprises a contiguous nucleotide sequence at least 12 nucleotides, which is 90% complementary to a mammalian SBDS target sequence. The phrase “which is 90% complementary to a mammalian SBDS target sequence” in claim 10 is interpreted as requiring the contiguous nucleotide sequence be at least 90% identical. Every instance of “90% complementary” in the specification is preceded by the phrase “is at least” (or “is least”). Further support for this interpretation is found in claim 11, which depends from claim 10; claim 11 recites a “fully complementary” contiguous nucleotide sequence.
Accordingly, enablement of the methods of claims 1, and 28-29, requires that the skilled artisan be able to treat or prevent any disease, or an HBV infection, in any subject, using the scope of SBDS inhibitors and nucleic acid molecules encompassed by the claims, without undue experimentation.
Guidance in the Specification
The specification is directed to treating or preventing HBV infection. While the specification generally describes the role of SBDS in Shwachman-Diamond syndrome, and studies which interrogated SBDS function with antisense nucleic acids (pg. 1, line 31 to pg. 2, line 30), this description does not provide any working examples or predictability for “treating or preventing a disease” in general, as recited in instant claim 28. Accordingly, the remaining analysis of the guidance in the specification focuses on treating or preventing HBV infection, as it is the subject of the present application based on the description.
Regarding treating or preventing HBV infection specifically, the specification teaches that “[t]reatment success is usually measured as loss of hepatitis B surface antigen (HBsAg). However, a complete HBsAg clearance is rarely achieved since Hepatitis B virus DNA persists in the body after infection. HBV persistence is mediated by… “covalently closed circular DNA” (cccDNA)… [which] serves as a template for all HBV transcripts, including pregenomic RNA (pgRNA)” (pg. 1, lines 21-26). The specification teaches that “[t]he presence of a few copies of cccDNA might be sufficient to reinitiate a full-blown HBV infection… [a] cure for chronic HBV infection, however, would require the elimination of cccDNA” (pg. 1, lines 27-29).
The specification demonstrates that reducing SBDS mRNA levels using an siRNA pool (Table 6A) reduces the levels of intracellular HBV DNA and covalently closed circular DNA (cccDNA) in HBV-infected primary human hepatocytes (PHH) (Example 1, pg. 62). The specification also demonstrates that reducing SBDS mRNA levels by more than 85% relative to control values using “naked LNAs” (Table 7) reduces the levels of HBV pre-genomic RNA (pgRNA) and cccDNA in HBV-infected PHH (Example 2, pg. 62-63). Use of the siRNA pool reduces the levels of cccDNA by at most ~ 67% (23/71), and levels of intracellular HBV DNA by at most ~ 72% (34/123) compared to the negative control (Table 9, pg. 62). Use of an LNA reduces the levels of cccDNA by at most ~30% (68.78/98.15), and the levels of pgRNA by at most ~78% (21.57/100) compared to non-treated cells (Table 10, pg. 63).
The specification does not provide any in vivo working examples. The working examples in the specification, while demonstrating reduced levels of intracellular HBV DNA, cccDNA, and/or pgRNA in vitro, I) do not demonstrate any reductions in HBsAg levels, which the specification teaches is usually the metric to determine treatment success, II) do not “eliminate” any of the aforementioned molecules, which the specification teaches is required for a cure of chronic HBV infection, and III) leave at least “a few copies of cccDNA,” which the specification teaches “might be sufficient to reinitiate a full-blown HBV infection.” The specification also does not provide any working examples or predictability for preventing an acute HBV infection, because the only working examples relate to administration to actively infected cells. Together, it is not apparent that a reduction in HBV DNA, cccDNA, and/or pgRNA to the levels achieved in the in vitro examples described in the specification would be sufficient to treat or prevent an HBV infection in a subject. It is also not apparent that the levels of reduction in HBV DNA, cccDNA, and/or pgRNA achieved in vitro would even be achieved in vivo, given added challenges related to at least delivery and stability.
Regarding the scope of nucleic acid molecules encompassed by claims 28-29, the specification teaches that for at least one working example, SBDS mRNA levels were reduced by more than 85% compared to a control (Table 10, pg. 63). Thus, the skilled artisan would predict that similar levels of knockdown would need to be achieved in order to observe the same levels of reduction in HBV DNA, cccDNA, and/or pgRNA. The nucleic acid molecules encompassed by the claims are structurally, and therefore, functionally diverse, i.e., having various levels of knockdown efficiency. It is not apparent that any nucleic acid molecule meeting the structural limits of the claims will reduce the levels of HBV DNA, cccDNA, and/or pgRNA to the levels observed in the working examples, let alone in vivo.
Finally, regarding the scope of SBDS inhibitors encompassed by claim 1, the specification fails to describe any examples of small molecules, antibodies or antibody fragments, aptamers, etc., that inhibit SBDS and affect HBV infection in vitro or in vivo. Furthermore, because the mechanisms through which inhibiting SBDS expression reduces intracellular HBV DNA, pgRNA, and/or cccDNA remain unknown, it is not predictable that small molecules, antibodies or antibody fragments, aptamers, etc., which may alter SBDS activity (i.e., at the protein level) will have the same result(s) as an siRNA, or other antisense nucleic acid molecule that operates at the transcript level to reduce SBDS expression.
Taken together, the specification provides predictability for a method of reducing HBV intracellular DNA, pgRNA, and/or cccDNA levels in HBV-infected primary human hepatocytes in vitro, by administering the specific siRNA pool or LNAs described in Examples 1-2 (pgs. 62-63).
State of the Prior Art
The prior art was thoroughly searched for additional working examples or predictability for the instantly claimed methods. Regarding treating or preventing disease in general, the search failed to uncover working examples of reducing SBDS expression and/or activity in a subject and treating a disease. For example, the search did not uncover any examples of treating neurodegenerative disease, cancer, or other viral infections by reducing SBDS expression and/or activity. The search did uncover various roles of SBDS in cellular biology, e.g., in translation (In et al., 2016, Nucleic Acids Research, Vol. 44, No. 9, pg. 4134-4146), erythropoiesis (Sen et al., 8 December 2011, Red Cells, Iron, and Erythropoiesis, Vol. 118, No. 24, pg. 6407-6417), and apoptosis (Watanabe et al., 2008, Apoptosis (2009), Vol. 14, pg. 77-89), as well as evidence that specific mutations in SBDS are casual to Shwachman-Diamond syndrome (Ganapathi et al., 1 September 2007, Blood, Vol. 110, No. 5, pg. 1458-1465). Guidance regarding these roles does not provide sufficient predictability for treating or preventing diseases in general. Regarding treating or preventing HBV infection specifically, the search failed to uncover any working examples of the instantly claimed method, or any evidence of a causal relationship or reasonable connection between SBDS expression and/or activity and HBV infection.
Regarding the predictability of treating or preventing HBV infection based on the in vitro results provided in the specification, the prior art supports the teachings of the specification described above. For example, Dong (Dong et al., 2017, Digestive Diseases and Sciences, Vol. 63, pg. 7-15) teaches that currently approved therapeutic regimens for treating HBV infection largely aim to inhibit HBV replication and stimulate clearance of infected hepatocytes (pg. 7, right col.; Table 1). Dong teaches that cccDNA is “responsible for persistent infection,” and in order to cure chronic HBV, “it is important to find a strategy to remove cccDNA” (pg. 8). Dong suggests that reduced HBsAg levels and HBV DNA can be indicative of treatment success in vivo (see at least the examples described on pg. 9, and pg. 12), but neither Dong, nor the remaining prior art reviewed during the search provides guidance that would allow the skilled artisan to determine whether reduction of HBV DNA, cccDNA, and/or pgRNA to the levels achieved in the in vitro experiments in the specification would be sufficient “treat” or “prevent” HBV infection in vivo. For example, the search did not uncover any guidance which correlated the levels of HBV DNA, cccDNA, and/or pgRNA knockdown in vitro with symptomatic relief or prophylactic efficacy in vivo. Finally, with respect to the use of antisense nucleic acid molecules (“HBV RNAi-based therapies), Dong teaches that delivery and stability issues in vivo remain obstacles to their therapeutic potential (pg. 12). Thus, it is not apparent that the levels of HBV DNA, cccDNA, and/or pgRNA knockdown in vitro are even predictive of the levels of knockdown which would be achieved in vivo.
Taken together, the prior art fails to remedy the lack of predictability for the claimed methods. The prior art does not provide any working examples of the claimed methods, or establish causal relationships or reasonable connections between SBDS expression and/or activity that would allow the skilled artisan to predict “treatment” or “prevention” of disease in general, or HBV infection specifically, as claimed. The prior art also does not provide sufficient guidance to allow the skilled artisan to determine whether reduction of HBV DNA, cccDNA, and/or pgRNA to the levels achieved in the in vitro experiments in the specification would be sufficient “treat” or “prevent” HBV infection in vivo.
Experimentation Required and Level of Skill in the Art
In order to practice the claimed methods across their full scope, a large amount of highly unpredictable experimentation would be required. For example, with respect to the methods of claims 28-29, the skilled artisan would need to prepare the scope of nucleic acid molecules encompassed by the claims, i.e., shRNAs, siRNAs, antisense oligonucleotides, aptamers, etc. at least 90% complementary to any mammalian SBDS mRNA, and recruit subjects having or susceptible to the scope of diseases encompassed by the claims, i.e., virtually any disease, including neurodegenerative disease, genetic disease, cancer, HBV infection, etc. With respect to the method of claim 1, the skilled artisan would need to prepare the scope of SBDS inhibitors encompassed by the claim, i.e., small molecules, antibodies and antibody fragments, aptamers, antisense molecules, etc., and recruit subjects having or susceptible to HBV infection. The skilled artisan would need to establish the delivery vehicles, and route(s), dose(s), and duration of administration, for each disease and/or nucleic acid molecule and/or SBDS inhibitor. The skilled artisan would also need to establish metrics to assess “treating” and “preventing” the scope of disease(s) encompassed by the claims. The experimental designs would certainly vary widely owing to, at least, I) the extremely diverse diseases encompassed by claim 28, which have differing onset, progression, and clinical manifestations, and II) the extremely diverse SBDS inhibitors encompassed by claim 1, and nucleic acid molecules encompassed by claims 28-29, which have differing chemical composition, function, effectivity, stability, etc. The skilled artisan would then need to administer the scope of agents encompassed by the claims, to the subjects having or susceptible to the disease(s) encompassed by the claims, and determine whether the disease(s) was treated or prevented.
The level of skill in the art is high, and the experimentation described above is within the capabilities of the skilled artisan. However, the amount of experimentation above is undue and unpredictable. Neither the specification nor prior art provide any working examples of treating or preventing a disease, or an HBV infection, in a subject with an SBDS inhibitor, or a nucleic acid molecule at least 90% complementary to a mammalian SBDS target sequence. Neither the specification nor prior art establish a causal or correlative relationship between SBDS expression or activity and the scope of diseases encompassed by the claims, so as to allow the skilled artisan to reasonably predict that the claimed methods would work across their scope. The specification provides the only available evidence with respect to HBV infection and SBDS expression or activity. While the specification demonstrates predictability for an in vitro method of reducing HBV intracellular DNA, pgRNA, and/or cccDNA with specific siRNAs or LNAs which reduce SBDS mRNA levels (see Examples 1-2), the specification does not provide any working examples of the claimed methods in vivo, or establish that the effects achieved in vitro would be sufficient to treat or prevent HBV infection in vivo. In contrast, the teachings of the specification related to the need to “eliminate” cccDNA, and the ability of very few molecules of cccDNA to trigger full blown HBV infection, strongly suggest that the in vitro results would be insufficient to treat or prevent HBV infection. The specification does not provide working examples or predictability for the many, generically claimed nucleic acid molecules at least 90% complementary to a mammalian SBDS mRNA target sequence, which would have various levels of knockdown efficiency, and therefore, unpredictable effects, even in the in vitro method described in the specification. The specification also does not provide any working examples or predictability for using any other SBDS inhibitors, e.g., small molecules, antibodies or antibody fragments, aptamers, etc. The prior art does not remedy the specification’s lack of predictability for the scope of the claimed methods. As stated above, the prior art does not provide any working examples of the claimed methods, establish causal relationships or reasonable connections between SBDS expression and/or activity and HBV infection, or provide guidance to suggest that the in vitro working examples described in the specification are predictive of the results which would need to be achieved in vivo to prevent or treat HBV infection.
Taking into consideration the factors outlined above, including the nature of the invention and breadth of the claims, the lack of working examples to meet the scope of the claims, and the lack of evidence in the specification or prior art that reducing SBDS expression and/or activity would “treat” or “prevent” disease in general, or HBV infection specifically, it is the conclusion that undue experimentation would be required to use the invention as claimed.
Dependent Claims
Claims 2, and 4-9 fail to further limit claim 1 so as to resolve the scope of enablement issues raised above, and are also rejected for the reasons described above.
Claim Rejections - 35 USC § 102 – Ganapathi as evidenced by Rubinson and GenBank
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim 27 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Ganapathi (Ganapathi et al., 1 September 2007, Blood, Vol. 110, No. 5, pg. 1458-1465) as evidenced by Rubinson (Rubinson et al., 2003, Nature Genetics, 33, pg. 401-406) and GenBank (Homo sapiens SBDS, ribosome maturation factor (SBDS), mRNA, NCBI Reference Sequence: NM_016038.4, available 29 December 2018).
Claim 27 requires a nucleic acid molecule according to claim 10. For the reasons described above, the phrase “which is 90% complementary to a mammalian SBDS target sequence” in claim 10 is interpreted as requiring the contiguous nucleotide sequence be at least 90% identical to a mammalian SBDS target sequence.
Regarding claim 27, Ganapathi teaches an in vitro method for inhibiting SBDS expression in a target cell which is expressing SBDS (“Cell transfection and lentivirus infection,” pg. 1459, left col.; Fig. 6; pg. 1462, left col. to pg. 1463, right col.). Ganapathi teaches the method comprises administering an effective amount of siRNA to the cell (“siRNAs directed against SBDS… were introduced into wild-type human skin fibroblasts,” pg. 1462, left col.), wherein the nucleic acid molecule is capable of inhibiting the expression of SBDS mRNA (see siRNA sequences disclosed on pg. 1459, left col. and Fig. 6A).
Ganapathi is silent as to whether the siRNA(s) comprises at least 12 nucleotides at least 90% complementary to a mammalian SBDS target sequence. Ganapathi teaches that the “SBDS knockdown was performed using 3 separate small-interfering RNA (siRNA) hairpins in the LentiLox3.7 system” (pg. 1459, left col.). Ganapathi teaches the siRNA sequence “AAGGAAGATCTCATCAGTGCGTT” which as shown in Fig. A below is 100% identical to a mammalian SBDS target sequence disclosed by GenBank. Rubinson, which describes the LentiLox3.7 system used by Ganapathi, shows that the LentiLox3.7 system encodes siRNA hairpins (“shRNAs”) comprising two strands 100% complementary to one another (Fig. 1A-C). Thus, as evidenced by Rubinson, the siRNA of Ganapathi must also comprise a second strand which is at least 90% complementary to the mammalian SBDS target sequence disclosed by GenBank. See the alignment in Fig. A below and Appendix I. Finally, Rubinson teaches the siRNA hairpins (“shRNAs”) in the LentiLox3.7 system are processed in a cell such that the loop region is removed, and an siRNA remains (“A sequence known to silence CD8 as an siRNA was adapted with a loop sequence,” “Generation of processed shRNAs in cells infected with pLL3.7 CD8,” Fig. 1 description; “lentivirus-encoded shRNAs were being expressed and processed into siRNAs,” pg. 404, right col.; Fig. 1F). Thus, also as evidenced by Rubinson, Ganapathi’s siRNA is between 12 to 30 nucleotides in length as shown in Fig. A below.
Figure A.
AAGGAAGATCTCATCAGTGCGTT 371..393 NM_016038.4
AAGGAAGATCTCATCAGTGCGTT “siRNA sequence[],” Ganapathi et al.
TTCCTTCTAGAGTAGTCACGCAA complement, as evidenced by Rubinson
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JENNA L PERSONS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600