DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group I (i.e., claims 1-9 and 28-29 drawn to a method of treating or preventing a Hepatitis B virus) in the reply filed on Aug 27, 2025, is acknowledged. Since claims 28 – 29 depend from a non-elected group claim; i.e., claim 10, claims 28 -29 will be examined to the extent that the remaining method claims of Group I (claims 1 – 9) encompass. Claims 10 - 20 and 22 - 27 withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Group, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on Aug 27 2025.
Status of Claims
Claim 21 is cancelled.
Claims 1 - 9 and 28 - 29 are under consideration.
Claim Interpretation
I. Wherein clause:
It is noted that the subject matter of a properly construed claim is defined by the terms that limit its scope. It is this subject matter that must be examined. As a general matter, the grammar and intended meaning of terms used in a claim will dictate whether the language limits the claim scope. Language that suggests or makes optional but does not require steps to be performed or does not limit a claim to a particular structure does not limit the scope of a claim or claim limitation. “Wherein” clauses are examples of language that may raise a question as to the limiting effect of the language in a claim. See MPEP 2103 I.C. and MPEP § 2111.04.
It is also noted that a “wherein” clause, such as that in (claim 2 - 10), must give “meaning and purpose to the manipulative steps.” See, MPEP § 2111.04.
In the instant claims, the wherein clauses are followed by functional language: the SARAF inhibitor is capable of reducing cccDNA (covalently closed circular DNA) in an HBV infected cell (claim 3), the cccDNA in an HBV infected cell is reduced by at least 60% when compared to a control. (claim 8), and the SARAF mRNA is reduced by at least 60% when compared to a control (claim 9) rather than a structural limitation. Thus, the wherein clauses recite inherent functions which will flow from the structural limitations of the claims they depend from. See, MPEP § 2112.01: II. COMPOSITION CLAIMS — IF THE COMPOSITION IS PHYSICALLY THE SAME, IT MUST HAVE THE SAME PROPERTIES.
II. Alternate names: SARAF is also referred to as "HBV X-transactivated gene 3 protein", "HBV XAg- transactivated protein 3", "FOAP-7" or "Transmembrane protein 66" [top of pg. 3].
NCBI provides further aliases: TMEM66 (Genbank Nucleotide SARAF).
III. SEQ ID NO: 1 is 20,206 nucleotides long while SEQ ID NO: 2 is 19,890 nucleotides long. However, an alignment of the two shows considerable (69% query match) between the two.
Therefore, claim 7 that recites, wherein the contiguous nucleotide sequence is at least 98% complementary to the target sequence of SEQ ID NO: 1 and SEQ ID NO: 2, is being interpreted as: the contiguous nucleotide is designed to be complementary to those regions of SEQ ID NO: 1 and SEQ ID NO: 2 that have considerable overlap.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1 - 9 and 28 - 29 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Scope of the Invention
The rejection is limited to the elected invention (claim 1: method of treating or preventing…with a SARAF inhibitor, and dependent claims 2 – 9; and dependent claims 28 – 29: in vivo or in vitro method of …with …the antisense oligomer utilized in the method Group I).
The broadest reasonable interpretation of the claimed method is a SARAF inhibitor to treat/prevent HBV infection which is accomplished in one of two ways:
1. The inhibitor is a functional inhibitor of SARAF that directly or indirectly inhibits SARAF expression in a subject having a HBV infection (claim 1).
2. The inhibitor embraces a nucleic acid molecule that is 90% complementary to SARAF in a subject having a HBV infection (claim 10).
The end-goal is to achieve treatment/ prevent HBV infection in a subject (claims 1 and 28) and modulate SARAF expression (claim 28).
Regarding #1: Such a functional definition of a chemical compound covers all compounds possessing the activity or effect specified in the claims. Such compounds could be small molecules, nucleic acid inhibitors, polypeptides, etc. See pgs. 29 – 44, 51 – 78 of McDonald (WO 2010110914 A2).
Regarding #2: The BRI of a nucleic acid molecule comprises an antisense oligonucleotide or another oligomeric nucleic acid molecule, such as CRISPR RNA, a siRNA, shRNA, an aptamer or a ribozyme (instant specification pg. 7 lines 15 -18).
Applicants disclose in pg. 36: Preferably, the subject is a mammal. More preferably the subject is human.
Disclosure of a Complete or Partial structure
Table 3 provides a list of SARAF sequences and Table 4 provides a list of SARAF target regions with SEQ ID NO: 1. Figures describe exemplary ASO conjugates. Specification discloses the ASOs of the invention are single stranded, do not contain RNA nucleosides rather are modified nucleosides or if unmodified are DNA nucleosides (pg. 9 lines 1 -12). Further RNAi molecules, such as siRNA and shRNA, are described and stated to be distinct from ASO (pg. 9 -12).
Thus, Applicant provides written description for an antisense oligonucleotide, a siRNA or shRNA that comprises a sequence that is complementary to a SARAF nucleotide sequence represented by SEQ ID NO: 1.
Regarding the end-goal: The specification discloses commercially available siRNAs (Table 6) and LNA ASOs (Table 7) complementary to SARAF. Application of these oligomers to fresh primary human hepatocytes (PHH) resulted in decrease in SARAF mRNA and cccDNA (Tables 9 and 10; Examples 1 and 2).
Species not Disclosed
On top of pg. 37 Applicants disclose: In some embodiments, the inhibitor may be an antibody, antibody fragment or a small molecule that specifically binds to the SARAF protein.
However, this does not provide written support for the types of functional inhibitors as required by #1 above or of nucleic acid molecules such as CRISPR RNA, aptamers and ribozymes as required by #2 above.
Although the specification discloses exemplary target regions that are specific for SEQ ID NO: 1, the specification does not describe such agents directed to any other sequence of possible mammalian SARAF sequences (e.g., other species, SEQ ID NO: 2, 4 - 10) to describe the instantly claimed genus of ASOs. Each of the instantly disclosed genus of inhibitors is targeted to a specific sequence, although the claims are drawn to any inhibitor. Further, the genus of inhibitors as recited, includes substantially different sequences. For e.g., SEQ ID NO: 4 and SEQ ID NO: 1. SEQ ID NO: 1 is extremely long, 20,206 nucleotides in length, while SEQ ID NO: 4 is 2,020 nucleotides. Further, the few species disclosed in the specification cannot represent the substantial structural variations (nucleotide sequences) of the nucleic acid inhibitors against SEQ ID NO:1. For example, Table 10 shows three ASOs that showed SARAF mRNA reduction in vitro compared to negative control. However, even for the three ASOs, substantial variation in function is seen within the genus (mRNA knockdown varies from 2.29% to 20.22%). This same table shows cccDNA claimed in claims 3 and 8 is not positively correlated with SARAF mRNA% reduction, thus unpredictable. Since it is unpredictable in vitro, it would be unpredictable in vivo, which is what is claimed.
With respect to structure, SEQ ID NOs: 24-25 are designed against SEQ ID NO:4, and SEQ ID NO:26 is targeting SEQ ID NO:1. While SEQ ID NO: 4 and SEQ ID NO:1 show a continuous region of overlap, as shown below, SEQ ID Nos; 24 – 26 could not be found in this overlapping region.
RESULT 1
US-17-845-535-4
Query Match 4.5%; Score 913; DB 1; Length 2020;
Best Local Similarity 100.0%;
Matches 913; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 19294 AGGATATGGTGGTACCAGGAGACGATAAAGTAGAAAGTTGGAGTCAAACACTGGATGCAG 19353
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1108 AGGATATGGTGGTACCAGGAGACGATAAAGTAGAAAGTTGGAGTCAAACACTGGATGCAG 1167
Qy 19354 AAATTTTGGATTTTTCATCACTTTCTCTTTAGAAAAAAAGTACTACCTGTTAACAATTGG 19413
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1168 AAATTTTGGATTTTTCATCACTTTCTCTTTAGAAAAAAAGTACTACCTGTTAACAATTGG 1227
Qy 19414 GAAAAGGGGATATTCAAAAGTTCTGTGGTGTTATGTCCAGTGTAGCTTTTTGTATTCTAT 19473
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1228 GAAAAGGGGATATTCAAAAGTTCTGTGGTGTTATGTCCAGTGTAGCTTTTTGTATTCTAT 1287
Qy 19474 TATTTGAGGCTAAAAGTTGATGTGTGACAAAATACTTATGTGTTGTATGTCAGTGTAACA 19533
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1288 TATTTGAGGCTAAAAGTTGATGTGTGACAAAATACTTATGTGTTGTATGTCAGTGTAACA 1347
Qy 19534 TGCAGATGTATATTGCAGTTTTTGAAAGTGATCATTACTGTGGAATGCTAAAAATACATT 19593
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1348 TGCAGATGTATATTGCAGTTTTTGAAAGTGATCATTACTGTGGAATGCTAAAAATACATT 1407
Qy 19594 AATTTCTAAAACCTGTGATGCCCTAAGAAGCATTAAGAATGAAGGTGTTGTACTAATAGA 19653
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1408 AATTTCTAAAACCTGTGATGCCCTAAGAAGCATTAAGAATGAAGGTGTTGTACTAATAGA 1467
Qy 19654 AACTAAGTACAGAAAATTTCAGTTTTAGGTGGTTGTAGCTGATGAGTTATTACCTCATAG 19713
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1468 AACTAAGTACAGAAAATTTCAGTTTTAGGTGGTTGTAGCTGATGAGTTATTACCTCATAG 1527
Qy 19714 AGACTATAATATTCTATTTGGTATTATATTATTTGATGTTTGCTGTTCTTCAAACATTTA 19773
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1528 AGACTATAATATTCTATTTGGTATTATATTATTTGATGTTTGCTGTTCTTCAAACATTTA 1587
Qy 19774 AATCAAGCTTTGGACTAATTATGCTAATTTGTGAGTTCTGATCACTTTTGAGCTCTGAAG 19833
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1588 AATCAAGCTTTGGACTAATTATGCTAATTTGTGAGTTCTGATCACTTTTGAGCTCTGAAG 1647
Qy 19834 CTTTGAATCATTCAGTGGTGGAGATGGCCTTCTGGTAACTGAATATTACCTTCTGTAGGA 19893
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1648 CTTTGAATCATTCAGTGGTGGAGATGGCCTTCTGGTAACTGAATATTACCTTCTGTAGGA 1707
Qy 19894 AAAGGTAGAAAATAAGCATCTAGAAGGTTGTTGTGAATGACTCTGTGCTGGCAAAAATGC 19953
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1708 AAAGGTAGAAAATAAGCATCTAGAAGGTTGTTGTGAATGACTCTGTGCTGGCAAAAATGC 1767
Qy 19954 TTGAAACCTCTATATTTCTTTCGTTCATAAGAGGTAAAGGTCAAATTTTTCAACAAAAGT 20013
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1768 TTGAAACCTCTATATTTCTTTCGTTCATAAGAGGTAAAGGTCAAATTTTTCAACAAAAGT 1827
Qy 20014 CTTTTAATAACAAAAGCATGCAGTTCTCTGTGAAATCTCAAATATTGTTGTAATAGTCTG 20073
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1828 CTTTTAATAACAAAAGCATGCAGTTCTCTGTGAAATCTCAAATATTGTTGTAATAGTCTG 1887
Qy 20074 TTTCAATCTTAAAAAGAATCAATAAAAACAAACAAGGGGTTTAGTCTCATTCTTTCTATT 20133
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1888 TTTCAATCTTAAAAAGAATCAATAAAAACAAACAAGGGGTTTAGTCTCATTCTTTCTATT 1947
Qy 20134 AGCCTAGGCGCAAATAAATGTTACTTTTTGTTTTTTTAAACCCTTTTTCCCAAAGGGGAA 20193
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1948 AGCCTAGGCGCAAATAAATGTTACTTTTTGTTTTTTTAAACCCTTTTTCCCAAAGGGGAA 2007
Qy 20194 AGTTCATGCAGAA 20206
|||||||||||||
Db 2008 AGTTCATGCAGAA 2020
Further, variation is seen in the fact that SEQ ID NO: 2 and SEQ ID NO: 1 are from different organisms (Macaca fascicularis vs. human), which means the inhibitor targeting human (SEQ ID NO: 1) may not work for SEQ ID NO: 2.
The latter could be overcome by disclosing homology between SEQ ID NO: 1 and the other recited sequences. However, no homology between SEQ ID NO: 1 and other sequences recited is disclosed. This is significant because for e.g., one would not know if an ASO designed to be complementary to any region of SEQ ID NO: 2 would still be complementary to human SARAF. The skilled artisan would not be able to readily envision which sequences are necessarily included or excluded from being a target sequence.
Given the breadth of sequences embraced in the instantly claimed genus, one could not envision the member agents that target such a broad genus.
Regarding the end-goal: The specification provides no information on in vivo treatment or prevention, only treatment of cells are disclosed. Further, the scope of the claimed invention is broad and the skilled artisan would not be able to envisage the entire genus claimed of sequences that modulate the expression of SARAF.
Structure/Function Correlation
Antisense oligonucleotides, siRNA and shRNA have a different structure and/or mechanism of action compared to other types of inhibitors or even other nucleic acid molecules. There is no essential structure of record required for SARAF inhibitors to treat HBV in a subject that would support written description for the genus of inhibitors. The skilled artisan cannot envision small molecules, peptides, CRISPR RNA, aptamers and ribozymes having the desired biological activity (treat HBV infection by reducing SARAF expression) based on the nucleic acid inhibitors described in the specification. Other than generically contemplating these molecules, the specification does not provide adequate written description of the small molecules, peptides, CRISPR RNA, aptamer, ribozyme itself. See MPEP 2163, Amgen v. Sanofi, 872 F.3d 1367 (Fed. Cir. 2017). While it is acknowledged that it is routine and conventional to prepare these molecules, in view of MPEP 2163, adequate written description of SARAF inhibitors requires more than just generically contemplating the species of inhibitors. In view of the lack of description for these species, the skilled artisan would have to use an assay to make these molecules and then empirically determine if they have the desired biological activity.
Method of Treatment / Prevention
To demonstrate possession of a method of treatment or prevention one must provide substantially more than the description of a compound having in vitro activity, in combination with a hypothesis that the administration of a compound having that activity to an individual suffering from a particular disease or disorder might produce a beneficial effect. What is required is an established nexus between the administration of such a compound to an individual and a beneficial result consequent thereto. Such a nexus can be established by the presentation of evidence demonstrating clinical efficacy of the claimed method in the treatment or prevention of a particular disease or disorder, demonstrating efficacy of that method in the treatment or prevention of an art accepted animal model of a disease or disorder wherein that model is known to be reasonably predictive of the efficacy of a treatment or prevention protocol in the treatment of that disease or disorder, or providing evidence of an in vitro activity for the recited compound in combination with a showing that other compounds possessing that activity (mode of action) have been shown to have clinical efficacy in the treatment or prevention of the recited disease or disorder. The instant specification fails to show possession of the claimed method as of the effective filing date of the instant application because it provides none of these.
As stated in MPEP 2163(II)(A)(3), a specification may describe an actual reduction to practice by showing that the inventor constructed an embodiment or performed a process that met all the limitations of the claim and determined that the invention would work for its intended purpose. Cooper v. Goldfarb, 154 F.3d 1321, 1327, 47 USPQ2d 1896, 1901 (Fed. Cir. 1998). See also UMC Elecs. Co. v. United States, 816 F.2d 647, 652, 2 USPQ2d 1465, 1468 (Fed. Cir. 1987) (“[T]here cannot be a reduction to practice of the invention ... without a physical embodiment which includes all limitations of the claim.”); Estee Lauder Inc. v. L’Oreal, S.A., 129 F.3d 588, 593, 44 USPQ2d 1610, 1614 (Fed. Cir. 1997) (“[A] reduction to practice does not occur until the inventor has determined that the invention will work for its intended purpose.”); Mahurkar v. C.R. Bard, Inc., 79 F.3d 1572, 1578, 38 USPQ2d 1288, 1291 (Fed. Cir. 1996) (determining that the invention will work for its intended purpose may require testing depending on the character of the invention and the problem it solves).
Whereas a reduction to practice of an uncomplicated invention such as a simple mechanical or electrical device can be achieved by merely providing a diagram of the device wherein one skilled in the relevant art can predict the likely operability of the device by reviewing the diagram, the operability of the claimed invention cannot be predicted by merely reviewing diagrams or illustrations. To demonstrate the reduction to practice of a method of treating or preventing a recurrence of an infection in an animal requires either a working embodiment, a demonstration of operability in the prevention method, an art accepted animal model of the condition to be prevented wherein that animal model has been shown to be reliably predictive of efficacy in the prevention of the condition, or a demonstration that the treatment or preventive agent employed therein possesses an activity in which the majority of compounds possessing that activity have been shown to be effective in the prevention of that condition.
The instant specification, however, fails to describe even a single example of the successful reduction to practice of a method of treating or preventing an HBV recurrence by the administration of a SARAF inhibitor to a mammal afflicted therewith. In fact, the specification fails to provide evidence that SARAF inhibitors in general are treatment or preventive options (in vivo) or that a representative number of species of such compounds have ever been shown to produce a beneficial treatment or preventive response when exogenously administered to a mammal afflicted with HBV. Further, whereas the clinical administration of ASO inhibitors to subjects afflicted with viral infections was a practice that was old and well known in the art before the filing of the instant application, there is no evidence that in vivo treatment or preventive activity has ever been reported for SARAF inhibitors, and Applicant provides no evidence to the contrary.
An adequate written description of such a method of preventing requires the disclosure of specific protocol that has been shown or can reasonably be predicted to produce the desired result.
In addition, the prior art and the as-filed specification do not provide written description for any molecule that indirectly modulates SARAF expression in a cell infected with HBV, in vitro or in vivo.
Conclusion
The written description requirement for the claimed genus of inhibitors is not satisfied through sufficient description of a representative number of species. A representative number of species are not adequately described to be considered representative of the entire genus. There is substantial variation within the genus of agents that are SARAF inhibitors, and the applicant does not describe a sufficient variety of species to reflect the variation within the genus. See Enzo Biochem., 323 F.3d at 966, 63 USPQ2d at 1615; Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004)(“[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated.”). See also MPEP §2163.
In view of the foregoing, it is clear that the instant specification fails to convey that the inventors had possession of the genus of SARAF inhibitors in claims 1, 4, 10, and 28 or methods of modulating SARAF expression, as of the effective filing date sought in the instant case. Only methods of treating by decreasing expression of SARAF comprising ASO, siRNA, shRNA that have substantial complementarity to select target regions within SARAF gene disclosed by SEQ ID NO: 1, and not the full breadth of the claims, is supported by Applicant’s disclosure.
Dependent claims 2 – 9 and 29 are also rejected because they depend on Claim 1 and 10 respectively and do not remedy the issues of lack of written description as discussed above.
Examiner Suggestion: Amend the claims to recite the structure of an inhibitor or recite publicly available or deposited clones expressing the same, and a definite target, and a precise method such as increasing/decreasing a particular molecule for which there is adequate written description support in the disclosure or prior art.
Claims 1 - 9 and 28 -29 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for inhibiting SARAF target gene expression in cells comprising administering an antisense oligomer specific for the target, wherein the sequence of the ASO is specific for SARAF, does not reasonably provide enablement for treating or preventing (claim 1) and does not reasonably provide enablement for the instant method of treating or preventing via introduction of an oligomer with only 12 contiguous nucleotides specific for any region of the target sequence (claims 4) and also does not provide enablement for modulating SARAF expression (claim 28). The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims.
Factors to be considered in a determination of lack of enablement include, but are not limited to:
(A) The breadth of the claims;
(B) The nature of the invention;
(C) The state of the prior art;
(D) The level of one of ordinary skill;
(E) The level of predictability in the art;
(F) The amount of direction provided by the inventor;
(G) The existence of working examples; and
(H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure.
In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988)
Breadth of the Claims
Instant claims encompass:
“treating”
This encompasses both treatment of an existing disease or prevention of a disease, i.e. prophylaxis. Prophylactic can be understood as preventing an HBV infection from turning into a chronic HBV infection or the prevention of severe liver diseases such as liver cirrhosis and hepatocellular carcinoma caused by a chronic HBV infection (pg. 36 first para).
“a subject”
This encompasses all possible mammalian subjects preferably, human mammals.
“administering”
This encompasses all ways of administering which includes but is not necessarily limited to:
All routes of administration including topical, injection, inhalation, and others.
a “SARAF inhibitor” that decreases levels of SARAF mRNA anywhere in the subject.
These encompass all possible agents that are capable of decreasing levels of SARAF mRNA which includes: All possible proteins or RNA/DNA that encodes that them that are present at any point in a biological pathway of SARAF mRNA or protein that would affect the pathway and result in an decrease of SARAF mRNA or protein;
All possible inhibitors of all possible types (i.e. RNA interference agents, pharmaceutical inhibitors, prions and others) of proteins or RNA/DNA that encodes that them that are present at any point in a biological pathway of SARAF mRNA or protein that would affect the pathway and result in an decrease of SARAF mRNA or protein;
All possible pharmaceutical agents that decrease SARAF mRNA or protein by acting directly on SARAF mRNA or protein or any point in a biological pathway of SARAF mRNA or protein that would affect the pathway and result in an decrease of SARAF mRNA or protein;
All possible vectors of all possible types including the above mentioned agents that include viral and non-viral vectors of all types.
Thus, the breath of claims is vast.
Direction or Guidance Presented
The focus here will be on elements for which some written description is provided.
The nucleic acid molecule
At the outset, it is noted that the claims do not recite a specific nucleotide range by SEQ ID NO, but rather refer to the broad genus of any sequence within the genus of sequences of mammalian SARAF genes including all variants.
The instant claims embrace contacting any biological system via any means of delivery with any antisense oligomer with the proviso that 12 contiguous nucleotides are at least 90% (claim 4) identical to a mammalian SARAF sequence.
It is highly unpredictable that sequences without a particular locus to target would in fact be specific for SARAF (or any given target).
For e.g., a 12-mer taken from positions stated in the disclosure as shown below in this excerpt from Table 5. See range staring at nucleotide # 14052:
PNG
media_image1.png
200
400
media_image1.png
Greyscale
shows that these positions correspond to a series of AAA nucleotides. See bolded:
ggtggaggtt gcggtgagcc gagattgcgc cactgcactc cagcctgagt gacagagcga 14040
gaccctgtct ccaaaaaaaa aaaaaaaaaa aaaatgcctg attaaattat aaatactctt 14100
aatcagagaa acttgatcaa ctttgctaat aatcatttgc cctgactcct gtctcacact 14160
Such a stretch of nucleotides cannot be specific to any target sequence let alone the intended target SARAF.
The scope of the claims in view of the specification as filed together do not reconcile the unpredictability in the art to enable one of skill in the art to make and/or use the claimed invention, namely a broad method of delivering an antisense oligomer with minimal specificity to a target sequence and the resultant in vivo effects.
MPEP 2164.01
Any analysis of whether a particular claim is supported by the disclosure in an application requires a determination of whether that disclosure, when filed, contained sufficient information regarding the subject matter of the claims as to enable one skilled in the pertinent art to make and use the claimed invention.
Also, MPEP 2164.01(a)
A conclusion of lack of enablement means that, based on the evidence regarding each of
the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation. In re Wright, 999 F.2d 1557,1562, 27 USPQ2d 1510, 1513 (Fed. Cir. 1993).
Method of treating or preventing ( in vivo); i.e., In vitro – In vivo correlation
As discussed for the written description section above, there is no disclosure on how treatment or prevention is achieved. Only in vitro treatment of a cell line is described.
The practice of a method without the need for substantial undue experimentation and additional inventive contribution requires the disclosure of an effective route, duration and quantity of administration of that inhibitor to a subject and this information is not provided by the instant specification. The background text on page 1 of the instant specification clearly fails to supply the guidance that would be needed by a routine practitioner. In fact, this paragraph says, see quotation:
The presence of a few copies of cccDNA might be sufficient to reinitiate a full-blown
HBV infection.
The instantly closed disclosure shows results of decrease in cccDNA (discussed in written description section). However, this decrease is not 100%; i.e., a few copies of cccDNA remain. Therefore, one would not be able to reconcile the decrease seen by following instant method and achieving any treatment or prevention in a subject.
Absent Working Examples and Undue Experimentation
The instant specification has also failed to disclose how the parameter measured in vitro may be translated to determine prevention has been achieved in vivo, how a similar method was practiced in the art with a different agent or to provide even a single working example, prophetic or actual, of the claimed method. In the absence of this guidance a practitioner would have to resort to a substantial amount of undue experimentation involving the variation in the amount and duration of administration of a SARAF inhibitor of the instant invention and in determining a suitable route of administration.
Without further guidance, one of skill in the art would have to practice a substantial amount of trial and error experimentation, an amount considered undue and not routine, to practice the instantly claimed invention.
State of the Art and Unpredictability of the Art
In vitro vs. In vivo methods
As stated above, while Applicant’s claim specifically encompasses in vivo embodiments “in a subject,” Applicant only provides working examples in vitro.
Regarding translation of in vitro methods to in vivo methods, Applicant is directed to the post-filing art of Mattes (Current Opinion in Toxicology 2020, 23-24:114–118). Mattes evidences that around the time of filing, and post-filing, translating in vitro data to in vivo data is unpredictable. Specifically, Mattes evidences “the challenge of validating a system’s performance and extrapolating it’s responses to those of an animal or human remains” (abstract) and “the question of relevance to the in vivo setting remains an issue” (Summary; pg. 116).
Accordingly, because translation of in vitro methods to in vivo methods is unpredictable, Applicant cannot be enabled for instant claims, which encompass in vivo methods.
Conclusion
A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation (see MPEP 2164.01(a)). Accordingly, claims 1 – 9 and 27 – 28 are rejected for lack of scope of enablement. Claims are enabled only for inhibiting SARAF target gene expression in cells comprising administering an antisense oligomer specific for certain regions within SEQ ID NO: 1.
Examiner Suggestion: The suggestion made in the written description section applies here as well.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1 - 5, 7 – 9, and 28-29 are rejected under 35 U.S.C. 103 as being unpatentable over McDonald (WO 2010110914 A2).
Regarding claim 1, McDonald teaches a method of treating or preventing Hepatitis B virus (HBV) infection in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an agent that inhibits expression of a mammalian gene involved in infection (title, pg. 2 first para, pg. 1 line 14, pg. 85 lines 25 – 29, pg. 103 lines 10 – 15; HBV: pg. 39 line 11, claims 36 – 37, claim 69). McDonald teaches that traditional treatments for viral infection, which include pharmaceuticals aimed at specific virus derived proteins, have several limitations and drawbacks that include limited effectiveness and toxicity. Further, high rates of viral mutations render antiviral pharmaceuticals ineffective (pg. 1 last para). Therefore, the method taught by McDonald presents an alternative since it targets the mammalian host genes that are involved in the viral life cycle (abstract).
McDonald further provide tables with mammalian genes that are involved in viral life cycle (Table 1, 2, 3, or 4; pg. 40 lines 29 - 30). One mammalian gene to target is TMEM66 (aka SARAF). See excerpt from Table 1 found in the middle of pg. 12 showing Entrez Gene ID (1st column) and Gene (2nd column):
PNG
media_image2.png
200
400
media_image2.png
Greyscale
Thus, McDonald’s administration of an agent that inhibits expression of a mammalian gene involved in viral life cycle, wherein one such gene is TMEM66, reads on instant application’s method of treating or preventing a HBV infection in a subject comprising administering to the subject a therapeutically or prophylactically effective amount of an inhibitor of SARAF.
Regarding claim 2, the term chronic infection is not defined by the specification so is being given the plain English meaning of the term to mean continuing over a long time; repeatedly recurring (Oxford dictionary, 2008). McDonald teaches wherein the method comprises an HBV infection that is recurring (For example, the disclosed method is considered to be a prevention if there is about a 10% reduction in onset, incidence, severity, or recurrence of infection, pg. 86 lines 18 – 20). This reads on instant applications recitation of the HBV infection is a chronic infection.
Regarding claims 3 and 8, capable of reducing cccDNA, by at least 60%, is an intended outcome. Since McDonald teaches the method steps as discussed for claims 1 – 2 above, the intended outcome is expected to follow.
Regarding claim 4, the method of claim 1 is discussed above. McDonald further teaches that a decrease in expression or activity can occur by decreasing transcription of mRNA or decreasing translation of RNA. Various examples are provided. See recitation from pg. 40 lines 32 – 35, “For example, the composition can be a chemical, a small or large molecule (organic or inorganic), a drug, a protein, a peptide, a cDNA, an antibody, an aptamer, a morpholino, a triple helix molecule, an siRNA, an LNA, a shRNA, an miRNA, an antisense RNA, a ribozyme or any other compound now known or identified in the future that decreases the expression and/or activity of a gene or gene product set forth in Table 1, 2, 3 or 4.”. McDonald further teaches that the GenBank Accession numbers set forth in Table 1 can be readily obtained from the National Center for Biotechnology Information at the National Library of Medicine (http://www.ncbi.nlm.nih.gov/entrezJquery.fcgi?db=nucleotide) (pg. 5 lines 16 – 20).McDonald further teach modified antisense nucleic acids in pgs. 54 – 56. McDonald. See a specific recitation from middle of pg. 56:
PNG
media_image3.png
200
400
media_image3.png
Greyscale
These teachings read on a contiguous nucleotide sequence of at least 12 nucleotides in length which is at least 95% complementary to a target sequence and is capable of reducing the target mRNA, as recited in claim 4.
Regarding claim 5, McDonald teaches wherein said inhibitor is selected from the group consisting of single stranded antisense oligonucleotide, siRNA and shRNA molecule (pgs. 53 – 56).
Regarding claim 9, wherein the SARAF mRNA is reduced by at least 60% when compared to a control is an intended outcome. Since McDonald teaches the method step as discussed for claim 4 above, such intended outcome is expected to follow.
Regarding claim 28, McDonald teaches an in vivo or in vitro method for decreasing TMEM66 expression in a target cell which is infected with HBV, said method comprising administering a nucleic acid molecule in an effective amount to said cell as discussed for claims 1 and 4 and 10 (McDonald pgs. 53 – 56; which can be directly administered to a cell…for example by administering to the subject a vector, pg. 55 1st para).
Regarding claim 29, McDonald teaches a method for treating or preventing a disease in a subject suffering from or susceptible to the disease, the method comprising administering to the subject a therapeutically effective amount of a nucleic acid inhibitor that as discussed for claim 10 (McDonald: treating, pg. 85 last para; stop recurrence of infection, pg. 86 middle para; a subject susceptible to an unspecified infection, pg. 87 last para; claims 33 - 35).
McDonald does not teach nucleic acid molecules for TMEM66 as the only option, and TMEM66 as the only mammalian target to inhibit, in order to treat or prevent a recurrent an HBV infection.
It would have been prima facie obvious to an artisan of ordinary skill in the art before the effective filing date of the claimed invention to have tried TMEM66 as one of the optimal targets chosen from the finite list of mammalian targets presented by McDonald and designed inhibitors to it in the form of a single treatment/prevention method. One of ordinary skill in the art would have been motivated by McDonald’s teachings that a mammalian target gene such as TMEM66 (SARAF) is a better target than a viral gene in the treatment and prevention of HBV infection. McDonald taught that given the Gene ID NO., one of skill in the art can find the target sequence of TMEM66 in the NCBI database, further design complementary nucleic acid molecules and test the same for their effectiveness in decreasing expression of TMEM66 in cells where expression of this gene is seen. One of skill in the art would have a reasonable expectation of success in doing so because McDonald teaches that it is within the skill of the ordinary artisan to do so. See MPEP 2143 I. Exemplary Rationale (E) and MPEP 2144 II.
Thus, McDonald makes obvious instant claims 1 – 5, 8 – 9, and 28 - 29.
Claims 6 - 7 are rejected under 35 U.S.C. 103 as being unpatentable over McDonald (WO 2010110914 A2) as applied to claims 1 – 5, 8 – 9, and 28 – 29 above in view of JHA et al., (JHA A. et al., THE JOURNAL OF CELL BIOLOGY, vol. 202, no. 1, 1 July 2013 (2013-07-01), pages 71-79).
Regarding claims 6 - 7, the method of claim 1 and 4 is discussed above.
McDonald does not teach wherein the mammalian SARAF target sequence is selected from the group consisting of SEQ ID NOs: 1, 4, 5, 6, 7, 8, 9 and 10 (claim 6) or wherein the contiguous nucleotide sequence is at least 98% complementary to the target sequence of SEQ ID NO: 1 and SEQ ID NO: 2 (claim 7).
However, before the effective filing date, Jha et al. teach discloses (see p.77 right-hand column) a siRNA that inhibits the expression of SARAF/TMEM66. The disclosed siRNA is 23 nucleotides in length and is a 100% match to SARAF target. See alignment of Jha et al’s sequence with instant SEQ ID NO: 1 and SEQ ID NO: 2:
RESULT 1
NASEQ2_09242025_094352
Query Match 0.1%; Score 25; DB 1; Length 25;
Best Local Similarity 92.0%;
Matches 23; Conservative 2; Mismatches 0; Indels 0; Gaps 0;
Qy 19308 CCAGGAGACGATAAAGTAGAAAGTT 19332
|||||||||||:||||:||||||||
Db 1 CCAGGAGACGAUAAAGUAGAAAGTT 25
Wherein Qy = SEQ ID NO: 1 and Db = Jha’s disclosed siRNA.
And:
RESULT 1
NASEQ2_09242025_094426
Query Match 0.1%; Score 25; DB 1; Length 25;
Best Local Similarity 92.0%;
Matches 23; Conservative 2; Mismatches 0; Indels 0; Gaps 0;
Qy 19336 CCAGGAGACGATAAAGTAGAAAGTT 19360
|||||||||||:||||:||||||||
Db 1 CCAGGAGACGAUAAAGUAGAAAGTT 25
Wherein Qy = SEQ ID NO: 2 and Db = Jha’s disclosed siRNA.
Jha et al., further disclose wherein the SARAF mRNA is reduced by at least 60% when compared to a control (Fig. 5b).
It would have been prima facie obvious to a person of ordinary skill in the art at the time the effective filing date to combine the teaching of McDonald taken with Jha et al., to reduce SARAF expression in a subject having a HBV infection, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated by McDonald’s teachings that a mammalian target gene such as TMEM66 (SARAF) is a better target than a viral gene in the treatment and prevention of HBV infection to combine the teaching to reduce HBV infection in a subject infected with HBV comprising administering the siRNA to SARAF as disclosed by Jha et al., to the subject. See MPEP 2143 I. Exemplary Rationale (A) and 2144 II. One would have had reasonable expectation of success because Jha et al., have validated their siRNA and provided the proof that more than 60% of SARAF mRNA is reduced with the use of their siRNA and SARAF is a target taught by McDonald that must be inhibited to treat/prevent HBV recurrence in a patient.
Thus, McDonald in view of Jha make obvious instant claims 6 - 7.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
SHABANA S. MEYERING, Ph.D.
Examiner
Art Unit 1635
/SHABANA S MEYERING/ Examiner, Art Unit 1635
/RAM R SHUKLA/ Supervisory Patent Examiner, Art Unit 1635