Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Election Response
The Election filed 10/30/2025, in response to the Office Action of 7/30/2025, is acknowledged and has been entered. Applicants elected the following species: (A) individual has a low tumor burden (claim 2j); (B) the tumor is a urothelial tumor (claim 23a); (C) the RNA vaccine is administered to the individual at an interval of 7 days or 1 week, or an ineerval of 14 days or 2 weeks (claim 40 c); and the dose administered is about 35 micrograms (claim 40a); (D) the method further comprises administering a PD-1 axis binding antagonist (claim 74); (E) the PD-1 antagonist is nivolumab (claim 76b).
Claims 1, 2, 5, 10, 20, 23, 30, 34, 36, 37, 40, 45, 46, 48, 51, 53, 54, 55, 58, 73-76, 85, 88, and 98 are pending. Claims 5, 20, 45, 46, 48, 51, 85 and 88 are withdrawn as being drawn to non-elected species. Claims 1, 2, 10, 23, 30, 34, 36, 37, 40, 53-55, 58, 73-76, and 98 are currently under prosecution.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 2, 10, 23, 30, 34, 36, 37, 40, 53, 54, 55, 58, 73-76, and 98 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a WRITTEN DESCRIPTION rejection.
The claims are drawn to a method of inducing neoepitope-specific CD8+ T cells in an individual with a tumor, comprising administering to the individual an effective amount of a personalized RNA vaccine, wherein the RNA vaccine comprises one or more polynucleotides encoding one or more neoepitopes resulting from cancer-specific somatic mutations present in a tumor specimen obtained from the individual, and wherein at least 1% of CD8+ T cells in a peripheral blood sample obtained from the individual after administration of the RNA vaccine are neoepitope-specific CD8+ T cells that are specific for at least one of the neoepitopes encoded by the one or more polynucleotides of the RNA vaccine. Thus, the claims recite any personalized RNA vaccine comprising any polynucleotide that encodes one or more neoepitopes.
Dependent claims 74-76 are drawn to method of claim 1 (inducing neoepitope-specific CD8+ T-cells by administering a personalized RNA vaccine) and further administering a PD-1 axis binding antagonist.
The instant application fails to provide adequate written description support for the genus of administered personalized RNA vaccines within the scope of the claims, and fails to provide adequate written description support for any PD-1 axis binding antagonist.
Regarding the vaccine:
It has been interpreted that a personalized RNA vaccine comprising neoepitopes is capable of inducing an immune response in a patient, specifically inducing neoepitope-specific CD8+ T cells. The definition of vaccine in the online Merriam-Webster on-line dictionary is a preparation that is administered (as by injection) to stimulate the body's immune response against a specific infectious agent or disease.
The instant specification does not disclose any examples of any neoepitope structure or list. The instant specification discloses the following:
[0526 of the published specification]: RNA vaccine was manufactured on a per-patient basis including in-house determination of cancer mutation profiles, computational prediction of neoantigens, design, and manufacturing of the vaccine based on liposomally formulated RNA (RNA-LPX). Each vaccine contained up to 20 tumor-specific neoepitopes. Importantly, the manufacturing of the vaccine for individual patients within clinical practice compatible turn-around times was shown to be feasible using clinical biopsies or routine clinical specimens across a range of tumor types including those with low or intermediate tumor mutational burden.
Thus, the instant specification does not provide adequate written description of the genus of personalized RNA vaccines to be administered in the claimed invention. Although the specification discloses neopeptides using algorithms for tumor specific mutations, the claims encompass all neoepitopes discovered in the future. Furthermore, the specification does not disclose which peptides are capable of inducing an immune response.
The MPEP further states that if a biomolecule is described only by a functional characteristic, without any disclosed correlation between function and structure of the sequence, it is “not sufficient characteristic for written description purposes, even when accompanied by a method of obtaining the claimed sequence.” MPEP 2163. The MPEP does state that for generic claim the genus can be adequately described if the disclosure presents a sufficient number of representative species that encompass the genus. MPEP 2163. If the genus has a substantial variance, the disclosure must describe a sufficient variety of species to reflect the variation within that genus. See MPEP 2163. Although the MPEP does not define what constitute a sufficient number of representative, the Courts have indicated what do not constitute a representative number species to adequately describe a broad generic. In Gosteli, the Court determined that the disclosure of two chemical compounds within a subgenus did not describe that subgenus. In re Gosteli, 872 F.2d at 1012, 10 USPQ2d at 1618.
The specification does not provide adequate written description of the claimed invention. The legal standard for sufficiency of a patent's (or a specification's) written description is whether that description "reasonably conveys to the artisan that the inventor had possession at that time of the. . .claimed subject matter", Vas-Cath, Inc. V. Mahurkar, 19 USPQ2d 1111 (Fed. Cir. 1991). In the instant case, the specification does not convey to the artisan that the Applicant had possession at the time of invention of the claimed invention, the cancer vaccine.
The Federal Circuit addressed the application of the written description requirement to DNA-related inventions in University of California v. Eli Lilly and Co., 119 F.3d 1559, 43 USPQ2d 1398 (Fed. Cir. 1997). The court stated that “[a] written description of an invention involving a chemical genus, like a description of a chemical species, requires a precise definition, such as by structure, formula, [or] chemical name, of the claimed subject matter sufficient to distinguish it from other materials.” Id. At 1567, 43 USPQ2d at 1405. The court concluded that “naming a type of material generally known to exist, in the absence of knowledge as to what that material consists of, is not a description of that material.” Id.
In this case, the specification does not describe the genus of RNA vaccines of that are capable of functioning in a vaccine that satisfies either the Lilly or Enzo standards. The instant claims attempt to administer every type of RNA cancer vaccine and do not limit it to the specific type of cancer vaccine that is recited in the claims. A search of the art demonstrates the complexity and challenges of utilizing cancer vaccines. Gracia-Grijo et al. (Frontiers in Immunology 2019 10 1-19) teaches the complications of cancer vaccines targeting neoantigens. Gracia-Grijo teaches although clinical trials testing vaccines targeting neoantigens have demonstrated they are safe and well tolerated, whether individualized immunotherapies targeting neoantigens can mediate effective antitumor responses in a broader patient population, remains an open question. Gracia-Grijo teaches that despite all the technological innovation and development of novel screening assays, the rapid and precise identification of the bona fide neoantigens in any given patient remains a major hurdle that will need to be overcome to translate the potential of neoantigen targeting into effective therapies for patients with cancer. [Conclusion, pg 14] Hu et al (Nature Reviews Immunology 2018 18, 168–182) teaches the complications of cancer vaccine production and use, including but not limited to, tumor heterogeneity between and within tumors is a major challenge to the development of cancer immunology. [pg 3, building cancer vaccines] Although the specification provides an example of one cancer vaccine, it does not provide enough support for the full scope of cancer vaccines as claimed. Thus, out of an unknown and likely very large number of structures and targets capable of being used in a vaccine, the specification only discloses one example of a cancer vaccine. The specification does not disclose sufficient examples of cancer vaccines that are capable of treating cancer.
Thus, the specification does not provide an adequate written description of the genus of neopeptides that is required to practice the claimed invention. The instant disclosure does not adequately describe the scope of the claimed genus of administered agents, which encompasses a substantial variety of subgenera. Since the disclosure fails to provide sufficient relevant identifying characteristics, and because the genus is highly variant, one of skill in the art would reasonably conclude that the disclosure fails to provide a representative number of species to describe the genus as broadly claimed.
Regarding the PD-1 axis antagonist:
With regards to the genus of PD-1 axis antagonist, the instant specification discloses the following:
[0041] In some embodiments, which may be combined with any of the preceding embodiments, the PD-1 axis binding antagonist is a PD-1 binding antagonist. In some embodiments, the PD-1 binding antagonist is an anti-PD-1 antibody. In some embodiments, the anti-PD-1 antibody is nivolumab or pembrolizumab.
[0042] In some embodiments, which may be combined with any of the preceding embodiments, the PD-1 axis binding antagonist is a PD-L1 binding antagonist. In some embodiments, the PD-L1 binding antagonist is an anti-PD-L1 antibody. In some embodiments, the anti-PD-L1 antibody is avelumab or durvalumab. In some embodiments, the anti-PD-L1 antibody includes: (a) a heavy chain variable region (VH) that includes an HVR-H1 including an amino acid sequence of GFTFSDSWIH (SEQ ID NO:1), an HVR-2 including an amino acid sequence of AWISPYGGSTYYADSVKG (SEQ ID NO:2), and HVR-3 including an amino acid RHWPGGFDY (SEQ ID NO:3), and (b) a light chain variable region (VL) that includes an HVR-L1 including an amino acid sequence of RASQDVSTAVA (SEQ ID NO:4), an HVR-L2 including an amino acid sequence of SASFLYS (SEQ ID NO:5), and an HVR-L3 including an amino acid sequence of QQYLYHPAT (SEQ ID NO:6). In some embodiments, the anti-PD-L1 antibody includes a heavy chain variable region (VH) including an amino acid sequence of SEQ ID NO:7 and a light chain variable region (VL) including an amino acid sequence of SEQ ID NO:8. In some embodiments, the anti-PD-L1 antibody is atezolizumab.
The instant specification does not disclose any other structure or agent that is outside the scope of anti-PD-1 antibodies or anti-PD-L1 antibodies.
The use of anti-PD-1 and anti-PD-L1 antibodies are known in the art as taught by Sunshine et al (2015; Current opinion in pharmacology, vol 23, 2015, pgs 32-38) and supported in the instant specification. However, Surmiak et al (Int. J. Mol. Sci. 2021, 22(21), 11797) teaches that targeting PD-1 with small molecules is considered much more difficult to achieve compared to antibodies targeting PD-1 or PD-L1. [pg 1, 2nd paragraph] Surmiak teaches that although there are new ideas of small molecules, there has only been moderate improvement of the bioactivity of these molecules that could be achieved, and that the activities of these drug candidates are far lower than the therapeutic antibodies. [pg 7, Discussion] Thus, the art and the specification do not provide support for the broad genus of any PD-1 axis antagonist.
To provide adequate written description and evidence of possession of the claimed composition genus, the instant specification can structurally describe representative antibodies or structures, or describe structural features common to the members of the genus, which features constitute a substantial portion of the genus. Alternatively, the specification can show that the claimed invention is complete by disclosure of sufficiently detailed, relevant identifying characteristics, functional characteristics when coupled with a known or disclosed correlation between function and structure, or some combination of such characteristics (see University of California v. Eli Lilly and Co., 119 F.3d 1559, 43 USPQ2d 1398 (Fed. Cir. 1997) and Enzo Biochem, Inc. V. Gen-Probe Inc.). A disclosure that does not adequately describe a product itself logically cannot adequately describe a method of using that product.
Although Applicants may argue that it is possible to screen for structures that function as claimed, the court found in (Rochester v. Searle, 358 F.3d 916, Fed Cir., 2004) that screening assays are not sufficient to provide adequate written description for an invention because they are merely a wish or plan for obtaining the claimed chemical invention. “As we held in Lilly, “[a]n adequate written description of a DNA … ‘requires a precise definition, such as by structure, formula, chemical name, or physical properties,’ not a mere wish or plan for obtaining the claimed chemical invention.” 119 F.3d at 1566 (quoting Fiers, 984 F.2d at 1171). For reasons stated above, that requirement applies just as well to non-DNA (or RNA) chemical inventions.” Knowledge of screening methods provides no information about the structure of any future agent yet to be discovered that may function as claimed.
Given the lack of representative examples to support the full scope of the PD-1 axis antagonist to be administered, that function as claimed, the present claims lack adequate written description. Thus, the specification does not provide an adequate written description of agents that are required to practice the claimed invention. Since the specification fails to adequately describe the product to which the claimed method uses, it also fails to adequately describe the method.
Claims 74 rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for administering atezolizumab as the PD- axis binding antagonist in combination with the personalized RNA vaccine, does not reasonably provide enablement for any . The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to practice the invention commensurate in scope with these claims.
Breadth of the claims: The claims are drawn to the method of claim 1 (inducing neoepitope-specific CD8+ T-cells by administering a personalized RNA vaccine) and further administering a PD-1 axis binding antagonist.
State of the art: It is well known that the art of anti-cancer therapy is highly unpredictable. Lopez et al (Combine and conquer: challenges for targeted therapy combinations in early phase trials. Nat Rev Clin Oncol. 2017;14(1):57-66) teaches that the challenges include finding the best combination to explore and that the scale of biological complexity of the mechanisms of resistance to targeted treatment is large and requires several novel approaches. Lopez also teaches that there are hundreds of targeted treatments and the number of combinations trials outweigh the number of patients who can be entered into trials to evaluate them. Lopez also teaches that combination therapy in clinic results into issues including toxicity, pharmacokinetic interactions and finding the correct timing and context of using these combinations [pg 3, 2nd paragraph] Furthermore, Gura (Science, 1997, 278:1041-1042) teaches that researchers face the problem of sifting through potential anticancer agents to find ones promising enough to make human clinical trials worthwhile and teach that since formal screening began in 1955, many thousands of drugs have shown activity in either cell or animal models that only 29 have actually been shown to be useful for chemotherapy See p. 1041, see 1st and 2nd para. Furthermore, Kaiser (Science, 2006, 313: 1370) teaches that 90% of tumor drugs fail in patients. See 3rd col., 2nd to last para. Chames et al (British J. of Pharmacology, 2009, 157, 220-233) teach that there are several challenges to development therapeutic antibodies. These challenges include functional limitations such as inadequate pharmacokinetics, tissue accessibility and impaired interactions with the immune system (Abstract). Additionally, Chames teaches several limitations of therapeutic antibodies such as affinity between the antibody and its antigen, competition with patient’s IgG, and efficiency issues in triggering the immune response (pages 224-225). More specifically, de Miguel M et al (Clinical Challenges of Immune checkpoint inhibitors. Cancer Cell. 2020 Sep 14;38(3):326-333) teaches the complication and challenges surrounding immune checkpoint inhibitors, including toxicity and efficacy. [whole document] Thus, it is unpredictable to claim that any PD-1 axis antagonist can be combined with any therapeutic agent, including other therapeutic antibodies.
Presence or Absence of Example: The Examples in the specification only disclose the combination of atezolizumab, an anti-PD-L1 antibody, in combination with an RNA vaccine. The instant specification does not disclose any other examples of any other PD-1 axis antagonist that can be combined with an RNA vaccine for inducing immune responses.
Predictability: Reasonable correlation must exist between the scope of the claims and scope of enablement set forth, and it cannot be reasonably predicted that administration of any PD-1 axis antagonist can be combined with any personalized RNA vaccine to induce a response.
Quantity of Experimentation: Undue experimentation would be required to determine which PD-1 axis antagonist can be combined with the personalized RNA vaccine, and function as claimed. MPEP 2164.01 recites that “The test of enablement is not whether any experimentation is necessary, but whether, if experimentation is necessary, it is undue. In re Angstadt, 537 F.2d 498, 504, 190 USPQ 214, 219 (CCPA 1976)”. The experimentation needed to practice this method is undue and unreasonable as it requires determining exactly which agent can be combined, and is not routine in the art as these diseases are unrelated and comprise various subgroups within each disease state. A person skilled in the art will not be able to use the invention without undue experimentation. (In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988))
Accordingly, the instant claims do not comply with the enablement requirement of §112, since to practice the invention claimed in the patent a person of ordinary skill in the art would have to engage in undue experimentation to practice the full scope of the claims, with no assurance of success.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim(s) 1, 10, 23, 30, 34, 36, 37, 40, 54, and 74-76 are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by Valiante et al (WO2018144082 A1; Published 8/9/2018; cited in IDS dated 11/16/2022).
With regards to “wherein at least 1% of CD8+ T cells in a peripheral blood sample obtained from the individual after administration of the RNA vaccine are neoepitope-specific CD8+ T cells that are specific for at least one of the neoepitopes encoded by the one or more polynucleotides of the RNA vaccine.” The “wherein” clause of claim 1 states the intended result of the step of administering a personalized RNA vaccine. The wherein clause does not require steps to be performed and does not limit the claim to a particular structure, therefore does not distinguish the claimed method from that taught by the prior art. See MPEP 2111.04.
Regarding claim 1, Valiante teaches a method of inducing neoepitope-specific CD8+ T-cells in an individual with a tumor, comprising administering to the individual an effective amount of a personalized RNA vaccine. [pg 2, lines 5-11] Valiante teaches that the RNA vaccine comprises one or more polynucleotides encoding one or more neoepitopes resulting from cancer-specific somatic mutations present in a tumor specimen obtained from the individual, [pg 2, lines 28-30; lines 24-29; pg 62 lines 26-31] wherein at least about 1% of the CD8+ T-cells in a peripheral blood sample obtained from the individual after administration of the RNA vaccine are neoepitope -specific D8 T-cells thar are specific for at least one of the neoepitopes encoded by the one or more polynucleotides of the RNA vaccine. [pg 42, lines 22-32-lines 43 lines 14-20] It is noted that the intended result of “1% of the CD8+ T-cells in a peripheral blood sample obtained from the individual after administration of the RNA vaccine are neoepitope -specific D8 T-cells thar are specific for at least one of the neoepitopes encoded by the one or more polynucleotides of the RNA vaccine” is an expected outcome once the method is practiced.
Regarding claim 10, Valiante teaches a method of inducing trafficking of neoepitope-specific CD8+ T cells to a tumor in an individual, comprising administering to the individual an effective amount of a personalized RNA vaccine, [pg 2, lines 5-11] wherein the RNA vaccine comprises one or more polynucleotides encoding one or more neoepitopes resulting from cancer-specific somatic mutations present in a tumor specimen obtained from the individual, [pg 2, lines 28-30; lines 24-29; pg 62 lines 26-31] and wherein the neoepitope-specific CD8+ T cells trafficked to the tumor after administration of the RNA vaccine are specific for at least one of the neoepitopes encoded by the one or more polynucleotides of the RNA vaccine. [pg 42, lines 22-32-lines 43 lines 14-20]
Regarding claim 34, 36 and 37, Valiante teaches that the RNA vaccine is formulated in a lipid nanoparticle. Valiante teaches that the nanoparticle is a lipoplex nanoparticle. [pg 6 lines 12-15, pg 186]
Regarding claim 23, Valiante teaches that the tumor is urothelial tumor. [pg 14, lines 28-30; pg 160 lines 27-30] Regarding claim 30, Valiante teaches that prior to administration of the RNA vaccine: the individual has been treated with a checkpoint inhibitor therapy. Regarding claim 40, Valiante teaches that the RNA vaccine is administered to the individual at a dose of about 25 mcg at an interval of 7 days or 1 week or 14 days or 2 weeks. [pg 13, lines 28-31; pg 17 lines 31-34- pg 18 lines 1-2; pg 21 lines 15-16, 30-35]
Regarding claims 53-54, Valiante teaches that the RNA vaccine comprises an RNA molecule, comprising: (1) a 5’ cap; (2) a 5’ untranslated region (UTR); (3) a polynucleotide sequence encoding the one or more neoepitopes from caner specific somatic mutation present in the tumor specimen; (4) 3’ UTR; (5) a poly(A) sequence). [pg 63, lines 10-14] Valiante teaches that the poly(A) sequence comprises 120 adenine nucleotides. [pg 131-132] Valiante teaches that the polynucleotides can include any useful linkers, and that any components can be directly linked to another or may be connected through a linker.
Regarding claims 74-76, Valiante teaches that the method further comprises administering a PD-1 binding antagonist, such as nivolumab, a PD-1 antibody. [pg 14 lines 3-17]
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim(s) 1, 10, 23, 30, 34, 36, 37, 40, 54-55, 58, and 74-76 is/are rejected under 35 U.S.C. 103 as being unpatentable over Valiante et al (WO2018144082 A1; Published 8/9/2018; cited in IDS dated 11/16/2022), in view of Sahin et al (Personalized RNA mutanome vaccines mobilize poly-specific therapeutic immunity against cancer. Nature. 2017 Jul 13;547(7662):222-226).
The teachings of Valiante are recited in above. Valiante teaches the use of a linker between each peptide epitope. However, Valiante does not teach the exact limitations of claims 55 and 58.
Sahin teaches an RNA molecule comprising, in the 5' to 3' direction: a 5' cap; a 5' untranslated region (UTR); a signal peptide, an open reading frame containing 5 linkers, MHC class I trafficking domain, 3’UTR and poly (A) tail. (pg 223, Fig 1b) Sahin teaches the linking five neoepitopes connected by linkers, and that this allowed optimizing routing to HLA class I and II pathways and backbone sequence elements for improved RNA stability and translational efficacy. [Methods section]
It is noted that claim 55 requires at least a second linker epitope module that comprises a polynucleotide sequence encoding an amino acid linker and a polynucleotide sequence encoding a neoepitope. It is noted that claim 58 requires that the RNA molecule comprises 5 linker epitope modules. These limitations would have been obvious to those of ordinary skill in the art because: (1) Valiante teaches the a method of inducing neoepitope-specific CD8+ T-cells in an individual with a tumor, comprising administering to the individual an effective amount of a personalized RNA vaccine, wherein the RNA vaccine comprises the instantly claimed RNA molecule, (2) Valiante teaches the use of a linker between each peptide epitope, (3) Sahin teaches an RNA molecule comprising 5 linker epitope modules and teaches that the linking five neoepitopes connected by linkers, and that this allowed optimizing routing to HLA class I and II pathways and backbone sequence elements for improved RNA stability and translational efficacy. Given the known methods of utilizing RNA vaccine comprising RNA molecules, and given the known use of linking linker epitope modules as taught by the prior art, one skilled in the art could have modifying the RNA molecule of Valiante to include at least 5 linker epitope modules, with a reasonable expectation of success.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 2, 10, 23, 30, 34, 36, 37, 40, 53, 54, 55, 58, 73-76, and 98 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 39, 40, 42, 44, 45, 49, 52, 54, 56, 61, 63, 66, 67, 68, 72, 104, and 105 of copending Application No. 17/373,175 in view of Valiante et al (WO2018144082 A1; Published 8/9/2018).
This is a provisional nonstatutory double patenting rejection.
The co-pending application recites all the elements of the instantly claimed RNA molecule. The copending application recites that the RNA molecule comprises the polynucleotide sequences SEQ ID NO: 19 and SEQ ID NO: 20, which match 100% to the instantly claimed SEQ ID NO: 19 and 20, respectively. The copending application recites that the RNA molecule comprises a polynucleotide encoding at least 1 neoepitope and an amino acid linker which comprises the sequence SEQ ID NO: 39, or a polynucleotide sequence that encodes the amino acid linker SEQ ID NO: 37, which matches 100% to the instantly claimed SEQ ID NO: 39 and 37, respectively. The co-pending application teaches treating cancer comprising administering the RNA molecule, in combination with a PD-1 axis binding antagonist. The referenced co-pending application and the instant application are claiming common subject matter, as follows:
Co-pending application: 17/373,175
Instant Application: 17/854,649
Claim 39: An RNA molecule, comprising in the 5’ [Wingdings font/0xE0] 3’ direction:
5’ cap
A 5’ untranslated region (UTR)
A polynucleotide sequence encoding a secretory signal peptide
A polynucleotide sequence encoding a transmembrane cytoplasmic domain of an MHC molecule
A 3’ UTR: comprising (a) a 3’ untranslated region of AES mRNA and (b) non-coding RNA of a mitochondrially encoded 12S RNA
Poly(A) sequence,
Wherein the RNA molecule comprises, in the 5’ [Wingdings font/0xE0] 3’ direction, the polynucleotide sequence SEQ ID NO: 9 and SEQ ID NO: 20
Claim 40. The RNA molecule of claim 39, further comprising a polynucleotide sequence encoding at least 1 neoepitope; wherein the polynucleotide sequence encoding the at least 1 neoepitope is between the polynucleotide sequence encoding the secretory signal peptide and the polynucleotide sequence encoding a transmembrane and cytoplasmic domain of the MHC molecule in the 5′→3′ direction.
Claim 53: The method of claim 1, wherein the RNA vaccine comprises an RNA molecule comprising, in the 5’ [Wingdings font/0xE0] 3’ direction:
5’ cap
A 5’ untranslated region (UTR)
A polynucleotide sequence encoding a secretory signal peptide
A polynucleotide sequence encoding the one or more neoepitopes resulting from cancer-specific somatic mutations present in the tumor specimen
A polynucleotide sequence encoding at least a portion of transmembrane cytoplasmic domain of an MHC molecule
A 3’ UTR comprising (a) a 3’ untranslated region of AES mRNA and (b) non-coding RNA of a mitochondrially encoded 12S RNA
Poly(A) sequence.
Claim 54.The method of claim 53, wherein (a) wherein RNA molecule further comprises a polynucleotide sequence encoding an amino acid linker; wherein the polynucleotide sequences encoding the amino acid linker and a first of the one or more neoepitopes form a first linker-neoepitope module; and wherein the polynucleotide sequences forming the first linker-neoepitope module are between the polynucleotide sequence encoding the secretory signal peptide and the polynucleotide sequence encoding the at least portion of the transmembrane and cytoplasmic domain of the MHC molecule in the 5′→3′ direction.
Claim 42. The RNA molecule of claim 41, wherein the amino acid linker comprises the sequence GGSGGGGSGG (SEQ ID NO:39) and/or the polynucleotide sequence encoding the amino acid linker comprises the sequence GGCGGCUCUGGAGGAGGCGGCUCCGGAGGC (SEQ ID NO:37).
Claim 55. The method of claim 54, wherein the amino acid linker comprises the sequence GGSGGGGSGG (SEQ ID NO:39).
Claim 45. The RNA molecule of claim 44, wherein the RNA molecule comprises:
(a) 5 linker-epitope modules, and wherein the 5 linker-epitope modules each encode a different neoepitope;
(b) 10 linker-epitope modules, and wherein the 10 linker-epitope modules each encode a different neoepitope; or
(c) 20 linker-epitope modules, and wherein the 20 linker-epitope modules each encode a different neoepitope.
Claim 63. The RNA molecule of claim 44, wherein the RNA molecule comprises:
(a) 5 linker-epitope modules, and wherein the 5 linker-epitope modules each encode a different neoepitope;
(b) 10 linker-epitope modules, and wherein the 10 linker-epitope modules each encode a different neoepitope; or
(c) 20 linker-epitope modules, and wherein the 20 linker-epitope modules each encode a different neoepitope.
Claim 58. The method of claim 55, wherein the RNA molecule comprises:
(a) 5 linker-epitope modules, and wherein the 5 linker-epitope modules each encode a different neoepitope;
(b) 10 linker-epitope modules, and wherein the 10 linker-epitope modules each encode a different neoepitope; or
(c) 20 linker-epitope modules, and wherein the 20 linker-epitope modules each encode a different neoepitope.
Claim 49 The RNA molecule, wherein the 5’ cap comprises a D1 diastereomer of the recited structure.
Claim 54. The method of claim 53, wherein (c) the 5’ cap comprises a D1 diastereomer of the recited structure.
Claim 52. The RNA molecule, wherein the secretory signal peptide comprises the amino acid sequence SEQ ID NO: 27;
Claim 54. The RNA molecule of claim 39, wherein the transmembrane and cytoplastic domain of the MHC molecule comprises the amino acid sequence SEQ ID NO: 30
Claim 56. The RNA molecule of any one of claims 39-55, wherein the 3′ untranslated region of the AES mRNA comprises the sequence
(SEQ ID NO: 33)
Claim 54: (e) and (g)
Claim 61. An RNA molecule comprising, in the 5′→3′ direction: the polynucleotide sequence
(SEQ ID NO: 19) and the polynucleotide sequence SEQ ID NO: 20.
Claim 73. The method of claim 1, wherein the RNA vaccine comprises an RNA molecule comprising, in the 5′→3′ direction: the polynucleotide sequence
(SEQ ID NO: 19) and the polynucleotide sequence SEQ ID NO: 20.
Claim 68. A liposome comprising the RNA molecule of any one of claims 39-67 and one or more lipids, wherein the one or more lipids form a multilamellar structure that encapsulates the RNA molecule.
Claims 34: The method of claim 1, wherein the RNA vaccine is formulated in a liposome.
Claim 36: he method of claim 34, wherein the liposome comprises one or more lipids that form a multilamellar structure that encapsulates the RNA molecule.
Claim 105. A method of treating or delaying progression of cancer in an individual, comprising administering to the individual the RNA molecule of claim 39 in combination with a PD-1 axis binding antagonist.
Claim 74-76. The method of claim 1, wherein the method further comprises administering a PD-1 axis binding antagonist.
However, the co-pending application does not recite that the RNA molecule is administered via RNA vaccine.
Regarding claim 1, Valiante teaches a method of inducing neoepitope-specific CD8+ T-cells in an individual with a tumor, comprising administering to the individual an effective amount of a personalized RNA vaccine. [pg 2, lines 5-11] Valiante teaches that the RNA vaccine comprises one or more polynucleotides encoding one or more neoepitopes resulting from cancer-specific somatic mutations present in a tumor specimen obtained from the individual, [pg 2, lines 28-30; lines 24-29; pg 62 lines 26-31] wherein at least about 1% of the CD8+ T-cells in a peripheral blood sample obtained from the individual after administration of the RNA vaccine are neoepitope -specific D8 T-cells thar are specific for at least one of the neoepitopes encoded by the one or more polynucleotides of the RNA vaccine. [pg 42, lines 22-32-lines 43 lines 14-20] It is noted that the intended result of “1% of the CD8+ T-cells in a peripheral blood sample obtained from the individual after administration of the RNA vaccine are neoepitope -specific D8 T-cells thar are specific for at least one of the neoepitopes encoded by the one or more polynucleotides of the RNA vaccine” is an expected outcome once the method is practiced.
Regarding claim 10, Valiante teaches a method of inducing trafficking of neoepitope-specific CD8+ T cells to a tumor in an individual, comprising administering to the individual an effective amount of a personalized RNA vaccine, [pg 2, lines 5-11] wherein the RNA vaccine comprises one or more polynucleotides encoding one or more neoepitopes resulting from cancer-specific somatic mutations present in a tumor specimen obtained from the individual, [pg 2, lines 28-30; lines 24-29; pg 62 lines 26-31] and wherein the neoepitope-specific CD8+ T cells trafficked to the tumor after administration of the RNA vaccine are specific for at least one of the neoepitopes encoded by the one or more polynucleotides of the RNA vaccine. [pg 42, lines 22-32-lines 43 lines 14-20]
Regarding claim 34, 36 and 37, Valiante teaches that the RNA vaccine is formulated in a lipid nanoparticle. Valiante teaches that the nanoparticle is a lipoplex nanoparticle. [pg 6 lines 12-15, pg 186]
Regarding claim 23, Valiante teaches that the tumor is urothelial tumor. [pg 14, lines 28-30; pg 160 lines 27-30] Regarding claim 30, Valiante teaches that prior to administration of the RNA vaccine: the individual has been treated with a checkpoint inhibitor therapy. Regarding claim 40, Valiante teaches that the RNA vaccine is administered to the individual at a dose of about 25 mcg at an interval of 7 days or 1 week or 14 days or 2 weeks. [pg 13, lines 28-31; pg 17 lines 31-34- pg 18 lines 1-2; pg 21 lines 15-16, 30-35]
Regarding claims 53-54, Valiante teaches that the RNA vaccine comprises an RNA molecule, comprising: (1) a 5’ cap; (2) a 5’ untranslated region (UTR); (3) a polynucleotide sequence encoding the one or more neoepitopes from caner specific somatic mutation present in the tumor specimen; (4) 3’ UTR; (5) a poly(A) sequence). [pg 63, lines 10-14] Valiante teaches that the poly(A) sequence comprises 120 adenine nucleotides. [pg 131-132] Valiante teaches that the polynucleotides can include any useful linkers, and that any components can be directly linked to another or may be connected through a linker.
Regarding claims 74-76, Valiante teaches that the method further comprises administering a PD-1 binding antagonist, such as nivolumab, a PD-1 antibody. [pg 14 lines 3-17]
It would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed to formulate an RNA vaccine comprising the RNA molecule, of the co-pending application. One would have been motivated to, and have a reasonable expectation of success, because: (1) Valiante teaches a method of inducing neoepitope-specific CD8+ T-cells comprising administering a personalized RNA vaccine, wherein the RNA vaccine comprises an RNA molecule, (2) Valiante teaches that this RNA vaccine can be used to treat cancer, in combination with a PD-1 axis binding antagonist, nivolumab, (3) the co-pending application recites the instantly claimed RNA molecule, and teaches that this can be used to treat cancer, and (4) the copending application recites that this can be combined with a PD-1 axis binding antagonist.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SARAH A ALSOMAIRY whose telephone number is (571)272-0027. The examiner can normally be reached Monday-Friday 7:30 AM to 5:30 PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gregory Emch can be reached at (571) 272-8149. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SARAH A ALSOMAIRY/Examiner, Art Unit 1646
/GREGORY S EMCH/Supervisory Patent Examiner, Art Unit 1678