Prosecution Insights
Last updated: August 13, 2026
Application No. 17/907,664

COMPOSITIONS AND METHODS FOR SILENCING DNAJC15 GENE EXPRESSION

Non-Final OA §102§103
Filed
Sep 28, 2022
Priority
Mar 30, 2020 — provisional 63/002,167 +2 more
Examiner
POLIAKOVA-GEORGAN, EKATERINA
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Alnylam Pharmaceuticals Inc.
OA Round
2 (Non-Final)
64%
Grant Probability
Moderate
2-3
OA Rounds
0m
Est. Remaining
82%
With Interview

Examiner Intelligence

Grants 64% of resolved cases
64%
Career Allowance Rate
438 granted / 684 resolved
+4.0% vs TC avg
Strong +18% interview lift
Without
With
+17.9%
Interview Lift
resolved cases with interview
Typical timeline
2y 6m
Avg Prosecution
62 currently pending
Career history
747
Total Applications
across all art units

Statute-Specific Performance

§101
7.0%
-33.0% vs TC avg
§103
27.8%
-12.2% vs TC avg
§102
19.0%
-21.0% vs TC avg
§112
26.8%
-13.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 684 resolved cases

Office Action

§102 §103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 1-4, 7, 17, 22-23, 32 is/are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Shao et al (WO 2021/168373, claiming priority to 62/979833, filed 21 February 2020, of record). Concerning claims 1, 2, 17 and 32 Shao disclose a double stranded ribonucleic acids (dsRNAs) targeting MCJ (same as DNAJC15, see lines 25-30 on page 7) (see Abstract), including one with antisense strand of SEQ ID NO: 252 (see Table 6 on page 60), 23 nucleotides long and identical to instant SEQ ID NO: 419: SEQ ID NO: 419 1 UGAUAACUUGUUCUAGAGGUUUC 23 ||||||||||||||||||||||| SEQ ID NO: 252 1 UGAUAACUUGUUCUAGAGGUUUC 23 Further Shao disclose the sense strand complementary to SEQ ID NO: 252, of SEQ ID NO: 251 (see Table 6 on page 60), 21 nucleotides long and identical to instant SEQ ID NO: 325: SEQ ID NO: 325 1 AACCUCUAGAACAAGUUAUCA 21 ||||||||||||||||||||| SEQ ID NO: 251 1 AACCUCUAGAACAAGUUAUCA 21 Concerning claims 3 and 4 Shao disclose that dsRNA comprises 2'-O-methyl modified nucleotides (see explanations for abbreviations of Table 6 in Table 5). Concerning claim 7 Shao disclose that dsRNA is conjugated to GalNAc ligand (see explanations for abbreviations of Table 6 in Table 5 and ligand on page 57). Concerning claim 22 Shao disclose cell comprising dsRNA of the invention (see lines 6-7 on page 3). Concerning claim 23 Shao disclose pharmaceutical composition comprising dsRNA of the invention (see bridging paragraph between pages 2 and 3). Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1-4, 7, 14-15, 17, 22-23, 32 is/are rejected under 35 U.S.C. 103 as being unpatentable over Shao et al, above, and in further view of Rajeev et al (WO 2013/075035, May 2013, cited from IDS). Teachings of Shao are discussed above. Shao do not teach the ligand as in instant claims 14-15. Rajeev teach RNAi agents (dsRNA) conjugated to GalNAc ligand identical to the one in instant claims 14-15 (see pages 6 and 7). It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to conjugate dsRNA taught by Shao to GalNAc ligand taught by Rajeev, arriving at instant invention. One of the ordinary skill in the art would be motivated to do so, because Shao suggests conjugation to GalNAc and Rajeev provides an example of such effective ligand conjugated to dsRNAs. Allowable Subject Matter Claim 33 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Response to Arguments Applicant's arguments filed 12/17/2025 have been fully considered but they are not persuasive. Previous rejections are withdrawn in view of new amendments, arguments are moot. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to EKATERINA POLIAKOVA whose telephone number is (571)270-5257. The examiner can normally be reached Mon-Fri 8-5. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571)272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /EKATERINA POLIAKOVA-GEORGANTAS/Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Sep 28, 2022
Application Filed
Sep 26, 2025
Non-Final Rejection mailed — §102, §103
Dec 17, 2025
Response Filed
Feb 13, 2026
Final Rejection mailed — §102, §103
Apr 13, 2026
Response after Non-Final Action
May 12, 2026
Request for Continued Examination
May 19, 2026
Response after Non-Final Action

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12691134
Treatment Of Cerebrovascular Disease With Neurogenic Locus Notch Homolog Protein 3 (NOTCH3) Agents
4y 1m to grant Granted Jul 28, 2026
Patent 12662676
APTAMER NUCLEIC ACID MOLECULE, AND COMPLEX AND APPLICATION THEREOF
4y 7m to grant Granted Jun 23, 2026
Patent 12630827
ANTISENSE OLIGONUCLEOTIDES TARGETING SCN2A FOR THE TREATMENT OF SCN1A ENCEPHALOPATHIES
2y 3m to grant Granted May 19, 2026
Patent 12618068
Novel Replicase Cycling Reaction (RCR) and the Related SamRNA Designs Thereof
3y 3m to grant Granted May 05, 2026
Patent 12605400
OLIGOMERIC NUCLEIC ACID MOLECULE, AND APPLICATION THEREOF IN AN ACUTE INTERMITTENT PORPHYRIA TREATMENT
4y 5m to grant Granted Apr 21, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

2-3
Expected OA Rounds
64%
Grant Probability
82%
With Interview (+17.9%)
2y 6m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 684 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month