DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 9/22/2022, 4/4/2025, and 1/14/2026 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Note: only the first page of the two foreign patent documents, WO 2003038118 A1 and JP 2003528624 A, in the IDS submitted on 1/14/2026, is being considered.
Priority
This application is a National-Stage entry of PCT/GB2021/050743, filed 9/22/2022, which claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Application, No. 63/000,155, filed 3/26/2020, and to U.S. Provisional Application, No. 63/010,330, filed 4/15/2020, and priority under 35 U.S.C. § 119(b) to GB Application Nos. 2005473.0 filed 4/15/2020, 2005475.5 filed 4/15/2020, 2101969.0 filed 2/12/2021, and 2101972.4 filed 2/12/2021.
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994).
The disclosure of the prior-filed applications, Application Nos. 63/000,155 and 63/010,330, fail to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application. All of the limitations and SEQ ID NOs claimed in the claims under examination on the merits do not appear to be disclosed in the provisional documents. Support for all claimed limitations and sequences claimed in the instant application are supported by foreign priority documents, 2101969.0 filed 2/12/2021, and 2101972.4 filed 2/12/2021. Therefore, the examiner is considering the effective filing date for all claims under examination to be 2/12/2021.
Election/Restrictions
Applicant’s election without traverse of Group I: a synthetic inducible cis-regulatory element (CRE) that is capable of being bound by CREB, AP1 and/or HIF, in the reply filed on September 10, 2025, is acknowledged. The restriction requirement further required the election of a single species of synthetic inducible cis-regulatory element (CRE) sequence as disclosed in claim 97. The applicant’s election of species, SEQ ID NO: 21, is acknowledged. Applicant’s statement in the election response that “claims 97-108, 110-116, and 118-119 are readable on the elected CRE sequence SEQ ID NO: 21” is not accepted. For example, claim 98, 99, 104, and 119 do not recite or require SEQ ID NO: 21 or the general architecture of “3 TFBS for ATF6, 4 TFBS for AP1 and 3 TFBS for HIF.” Claims 111 and 112 were not included in the restriction requirement and therefore are being examined on the merits in this application.
Status of Claims
Claims 1-96 are cancelled. Claims 97-119 are currently pending. Claims 109 and 117 remain withdrawn as drawn to nonelected method invention(s) in view of the restriction requirement and applicant’s election. Claims 98, 99, 104, and 119 are withdrawn from consideration by the examiner because they are directed to CRE, HRE, or promoter embodiments that do not recite or require the elected species, SEQ ID NO: 21, and therefore do not further limit the elected species. Accordingly, claims 97, 100-103, 105-108, 110-116, and 118 are being examined on the merits at this time.
Specification
The disclosure is objected to because of the following informalities: 1) the specification inconsistently identifies SEQ ID NO: 3. The sequence listing and Lines 36-39 on pg. 4 define SEQ ID NO: 3 as the AP(1) TFBS sequence TGAGTCA. However, amended claim 115 recites a hypoxia-responsive element (HRE), HRE2, as “CTGCACGTA (SEQ ID NO:3)” operably linked to a minimal promoter, which conflicts with the specification’s assignment of SEQ ID NO:3 to an AP1 motif rather than a HRE sequence. 2) The specification defines CTGCACGTA as “HRE1” and assigns it SEQ ID NO: 7 (e.g., “CTGCACGTA (named HRE1, SEQ ID NO: 7)”). However, elsewhere the text states that “the sequence of HRE2 is CTGCACGTA (SEQ ID NO: 7),” thereby using the same sequence and SEQ ID NO to represent both HRE1 and HRE2. These conflicting identifications occur in multiple passages discussing HRE1, HRE2, and their arrays/variants, and render the relationships among HRE1, HRE2, HRE32 and SEQ ID Nos: 7, 8 , and 9 unclear. 3) Figure 7 depicts experimental data for samples FORNRTV20C53, FORNRTV20MinTK, FORNRTV20MLP, FORNRTV20pJB42, FORNRTV20SV, FORNRTV20TATA-m6a, FORNRTV20YB, and FORNRTV20C which are not described or identified anywhere in the written description.
Appropriate correction is required.
Drawings
The drawings are objected to for the following reasons. First, all drawing titles are not in compliance with 37 CFR 1.437, which states “Different figures on the sheets of drawings must be numbered in Arabic numerals consecutively and independently of the numbering of the sheets and, if possible, in the order in which they appear. This numbering should be preceded by the expression “Fig.” All numberings are improperly preceded with “figure.” Second, Figure 4’s legend of treatment conditions are marked with the same symbols; thus, each treatment condition is indistinguishable from another. Third, Figure 4’s label of the control condition, “CMV-IE,” is illegible and is interfering with the y-axis legibility as it overlapping with the y-axis labelling; thus, the “CMV-IE” label should be moved to a different area of the graph for example the right side. Lastly, the legends in Figures 2 and 10 need to distinctly label each time point with unique symbols as they are currently indistinct from each other. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Objections
Claims 102, 112, 114, and 115 are objected to because of the following informalities: 1) claim 102 recites “A synthetic forskolin-inducible promoter according to claim 101,” but it should read “The synthetic…” as it depends from claim 101 which introduces “A synthetic forskolin-inducible promoter;” 2) spelling of “claim” 111 in claim 112; 3) misspelling of “linked” in claim 114; and 4) improper labeling of sequence “CTGCACGTA” as SEQ ID NO: 3 in claim 115, the sequence, “CTGCACGTA,” is defined as SEQ ID NO: 7 in the sequence listing. Appropriate correction is required.
Claim 115 is objected to because it recites the limitation "the spacing" in line 6 of the claim. There is insufficient antecedent basis for this limitation in the claim.
Claim 115 is objected to because it recites the limitation "the consensus sequence" in line 5 of the claim. There is insufficient antecedent basis for this limitation in the claim.
Claim 115 is objected to because it recites the limitation "core consensus sequences" in line 6 of the claim. There is insufficient antecedent basis for this limitation in the claim.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 97, 100-103, 105-108, 110-116, and 118 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 97, 100-103, 105-108, 110-116, and 118 are rejected because independent claims 97, 111, and 118, as well as dependent claim, 115, recite nucleic acid sequences (e.g., SEQ ID NO: 61 in claim 97, SEQ ID NO: 101 in claim 111; SEQ ID NO: 128 in claim 115, and SEQ ID NO: 139 in claim 118, among others), which mix UPPERCASE and lowercase nucleotide letters (e.g., “TGACGTGCTgataatgcgt”). Neither the claims nor the specification define the metes and bounds of lowercase letters relative to UPPERCASE (e.g., as optional spacers, variants, repeats, or non-essential). Further, the sequence listing does not provide any specific descriptors for these lower- or upper-case notations. While repeat nucleotide sequences are represented with “lowercase” letters in the art, based on the lack of description in the specification and in the sequence listings, it is not clear the intention of the applicant’s use of “lowercase” letters as the nucleotide sequences in lower case do not appear to be repeat sequences. Therefore, one of ordinary skill cannot ascertain the full scope without undue experimentation. See MPEP 2173.02. While dependent claims 100-103, 105-108, 110, 112-114, and 116, do not expressly recite sequences that contain both UPPERCASE and lowercase nucleotide letters, they are either directly or ultimately dependent from independent claims that do mix both UPPERCASE and lowercase nucleotide letters, and thus inherit the rejection applied above to their respective independent claim. Amend with wherein clause or uniform casing if a distinction is not required.
Claim 102 is rejected because the claim recites “at least one CRE comprising at least one CRM.” This is inconsistent with the specification’s definition. The specification defines a "cis-regulatory module" or "CRM" as being “a functional module made up of two or more CREs” (see pg. 11). The "CRM" is a "module" structure (e.g., combination structure) that is defined to comprise at least two elements/parts: CREs. However, as claimed, the parts/elements are claimed to comprise the "module,” which is not only contrary to the structure of CRM as defined but also structurally impossible. Thus, the claim is indefinite under 112(b) as the structure in the claim cannot be determined.
The term “minimal” in claims 102-103 and 111-112 is a relative term which renders the claims indefinite. The term “minimal” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The term “minimal” is not expressly defined nor is it defined in “minimal promoter.” The specification defines “minimal promoter” as “a short DNA segment” which does not define the length encompasses by the relative term “minimal.” For example, since it is not clear what the length of “minimal” is, the meets and bounds pertaining to a minimal promoter as comprising at least 80% identity to SEQ ID NO: 101 cannot be determined. One may interpret the term “minimal” to mean that 100 nucleotides can be added to SEQ ID NO: 101 in addition to the at least 80% identity criteria, while another may say otherwise. Therefore, the examiner will interpret a “minimal” promoter to be any length in addition to SEQ ID NO: 101 so long as it is a functional variant thereof. Claim 112 also recites “minimal” and is dependent from independent claim 111, and therefore inherits the rejection as pertaining to claim 111. Claims 102 and 103 recite a minimal promoter that is not defined, and thus as described above with respect to the applicability to claim 111, the examiner cannot determine the meets and bounds of the structure, rendering claims 102 and 103 indefinite.
A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 115 recites the broad recitation “3 or more HBS,” and the claim also recites “3 to 10 HBS, 3 to 8 HBS, and 4 to 8 HBS,” which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims.
Claim Rejections - 35 USC § 112 Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 97, 100-103, 105-108, 110, 113-116, and 118 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 97, 103, 115, and 118 recite cis-regulatory elements (CREs) and/or hypoxia-responsive elements (HREs) in the form of their general architecture or specific nucleotide sequence. For instance, claim 103 recites the architecture of the elected species, SEQ ID NO: 21 (“ATF6-S-ATF6-S-ATF6-S-AP 1-S-AP 1-S-AP 1-S-AP 1-S-HIF-S-HIF-S-HIF-S-MP”) wherein S represents a spacer sequence and MP represents minimal promoter. The specification establishes that a spacer sequence may be “from 2 to 100 nucleotides in length,” and other more narrow ranges. Thus, claims 97, 103, 115, and 118 are claiming CRE and/or HRE operatively linked to promoters with upwards of 1,000 undefined bases (100+100+100+100+100+100+100+100+100+100) used as spacing elements, where the term “spacer” is defined in the specification as:
“a nucleic acid sequence that separates two functional nucleic acid sequences (e.g. TFBS, CREs, CRMs, minimal promoters, etc.). It can have essentially any sequence, provided it does not prevent the functional nucleic acid sequence (e.g. cis-regulatory element) from functioning as desired (e.g. this could happen if it includes a silencer sequence, prevents binding of the desired transcription factor, or suchlike). Typically, it is non-functional, as in it is present only to space adjacent functional nucleic acid sequences from one another,” (page 72, first paragraph, emphasis added).
Thus, the applicant is claiming a genus of promoter which is incredibly broad and undefined because the spacers can be potentially any sequence. Furthermore, the “spacer” regions are defined as not preventing the functionality of the CIS elements of the promoter, where furthermore the functionality of the promoter as a whole is recited as a “Forskolin-inducible and hypoxia-inducible promoter.” Thus, the recited genus of spacers and promoters must both not interfere with the cis elements of the promoter and function as a Forskolin-inducible and/or hypoxia-inducible promoter. As discussed further below, the Applicant has not shown species commensurate in scope with such a large genus of undefined promoter, as recited. Furthermore, the art teaches that promoter elements are unpredictable (see below).
With regards to the guidance provided in the specification, the applicant has designed and reduced to practice twelve Forskolin-inducible promoters (FORCSV-10, FOR-CMV-009, FMP-02, FLP-01, FORNCMV, FORNMinTK, FORCMV53, FORNMLP, FORNJB42, FORNYB, FORNTATAm6a, and FORNSV40, see example 1-3 and figures 2-7) and ten hypoxia-inducible promoters (RTV-015, Synp-HYP-001, HYBNC, HYBNYB, HYBNC53, HYBNMinTK, HYBNMLP, HYBNpJB42, HYBNSV, and HYBNTATAm6a, see examples 4-7 and figures 9-15). The Applicant alleges that “results seem to validate our design principals with the strength of the promoters correlating to their theoretical relative strength,” (page 87, ln. 35-36). However, the exact rationale behind the design of the spacer elements and promoters does not appear to be discussed in the specification. Nor has the Applicant identified any core structure-function relationship between the recited genus of promoters and a reliable way of predicting their functionality. From the specification alone, the Applicant was not in possession of such a broad genus of promoters because they have not identified such a core common structure for the make-up of the spacer sequences, nor have they tested the effects of different spacer sequence elements on the promoters.
With regards to the state of the art, it is known that DNA binding domains and DNA motifs, as well as what proteins/transcription factors may bind to such sites is unpredictable and uncharacterized. For instance, Schultheis (Schultheis H et al. Sci Rep. 2024 Apr 23;14(1):9275) teaches that:
“while over 1600 TFs have been described in the human genome, only ~700 of these have a known binding motif. Thus, a substantial number of FPs without overlap to a known DNA motif are normally discarded from FP analysis. In addition, the FP method is restricted to organisms with a substantial number of known TF motifs,” (Abstract).
This teaching is relevant to the presently recited structure of the promoters; as Schultheis teaches, over half of the transcription factors/DNA binding proteins of the human genome have unknown binding motifs. In support of Schultheis, Kaluz (Kaluz S. et. al., Biochem. And Biophys. Res. Comm., 2008 Apr 08;370:613-618) teaches that:
“spacing between HBSs is a critical determinant of HRE activity and, for the purpose of constructing minimal enhancers…is optimal (pg. 616)” and “the distance between the HRE and the TATA-box also affects hypoxic activation and there is an optimal spacing between the two (pg. 617).”
Thus, the recited spacer regions of claims 97, 103, 115, and 118 which are defined to be “any” sequence that doesn’t interfere with the functionality of cis elements or transcription factors from binding to the promoter, are uncharacterized because it is unknown what other transcription factors could bind to such random spacers. It is further unclear if such binding would interfere with the functionality of the cis elements and/or the ability of a transcription factor to bind or interact with the cis elements (per the specification at page 68, second paragraph). In short, it appears that the majority of human transcription factors have uncharacterized DNA binding motifs (per Schultheis, Abstract), but claims 97, 103, 115, and 118 allow the spacer sequences to be anything, which would allow for uncharacterized transcription factor DNA binding to the recited promoters with unknown consequences/effects on promoter activity. The Applicant has therefore not characterized and was not in possession of the genus “spacer,” because unknown TFs in cells can bind to uncharacterized DNA motifs, where such effects are unknown on the promoter (e.g., such TFs could interfere with hypoxia response element transcription factor binding to the promoters).
Furthermore, the teachings of Schultheis extend beyond human transcription factors. Schultehis teaches that:
“Of note, human and mouse are some of the most studied models in terms of TF binding, but for most other organisms, the rate of TFs with known motifs is considerably lower (JASPAR CORE vertebrates: 14% non-human),” (Introduction, first paragraph).
Thus, Schultheis teaches that transcription factor DNA motifs and how transcription factors are predicted to bind to such motifs are largely uncharacterized and unknown even in highly studied organisms like humans and mice (Abstract and Introduction). Such known DNA motifs are even less characterized in non-humans (14%, above). Claims 101 and 114 recite respectively a “Forskolin-inducible promoter” and a “hypoxia inducible promoter” which broadly encompasses a promoter which can be induced within a cell. However, the undefined spacer regions, which themselves could be subject to undefined interactions with transcription factors within a cell, were not characterized by the Applicant in human, let alone non-human, cells. Thus, the recited genus of promoters with undefined spacer regions, which are recited to be inducible by Forskolin and/or in hypoxic conditions, was not shown to be in possession by the Applicant at the time of filing because unknown DNA proteins could interact with and interfere with the promoters in a manner that is contrary to the definition of “spacer” given in the specification (page 68, second paragraph). Furthermore, it is entirely unknown if such promoters are functional across all cell types (e.g., yeast and bacteria) given that other organisms and their transcription networks are largely undefined (Schultheis, Abstract and Introduction).
Claims 100-103, 105-110, 113-116 depend either directly or ultimately from independent claim 97 and do not resolve the 112(a)-issue related to the undefined and unpredictable sequences recited for the CREs of claim 97.
Regarding claim 116, this claim further recites a “cell” and is subject to the analysis given above for the unpredictability of the genus of “cell” which would support such an undefined genus as the CRE recited in claim 97 operatively linked to a promoter.
Additionally, as taught by Wang (Wang V et al. Cancer Res. 2005 Apr 15;65(8):3299-306), different cell types have fundamentally different molecular underpinnings with regards to a hypoxic response, where different hypoxia inducible factors play different roles across different cell types (Introduction, fourth paragraph). Thus, there unpredictability concerning whether the recited sequences in fact are “hypoxia-inducible promoters” across different cellular contexts, where the recited term “promoter” reasonably and broadly includes different cellular contexts. For instance, Wang teaches that different cell types can have different responses to hypoxic conditions, where HIF-1 and HIF-2 are active in different cell types (Introduction, fourth paragraph). As evidenced by Orr (Orr AL et al. Nat Chem Biol. 2015 Nov;11(11):834-6), the response element CTGCACGTA, as recited in SEQ ID NO: 7 of claims 97, 115, and 118, is associated with HIF-1 induction (page 10, final paragraph). Given that HIF-1 and HIF-2 are taught by Wang to play varying roles across cell types (Introduction, fourth paragraph), the presently recited “hypoxia-inducible promoters” in claims 114 and 115 have an unpredictable status as such “hypoxia-inducible promoters” because such promoters are reasonably expected to be inducible in a cell, where such induction is unknown across cell types.
Claims 111 and 112 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 111 recites “a minimal promoter comprising the sequence” of “SEQ ID NO: 101 or a functional variant thereof that comprises a sequence that is at least 80% identical thereto,” and claim 112 further recites this minimal promoter operatively linked to a CRE.
Adequate written description support for a claimed genus may be provided by describing sufficient identifying characteristics, describing a representative number of species, actual reduction to practice, disclosure of drawings or structural chemical formulas, complete or partial structure, physical and/or chemical properties, functional characteristics when coupled with a known or disclosed correlation between function and structure and any working examples, method of making the claimed invention, level of skill and knowledge in the art as well as predictability in the art are other determinants that are used to analyze whether applicants had possession of the claimed genus. The present specification fails to meet these requirements for several reasons.
The specification describes SEQ ID NO: 101 as a single minimal promoter sequence but does not identify which nucleotides within this 60 base long sequence are critical to minimal promoter function, nor does it disclose what substitutions, deletions, or insertions are tolerated while retaining the required activity. For variants that are “at least 80% identical” to SEQ ID NO: 101, up to 20% of the nucleotides (i.e., up to 12 out of the 60 bases) could be changed, yet the specification provided no guidance as to which 12 nucleotides could be deleted, added, or modified such that the minimal promoter will still function as a minimal/core promoter and support transcription when placed downstream of the claimed CRE array.
The art indicates that core promoters are minimal structures that support transcription initiation and that different core promoter sequences exhibit markedly different basal expression levels and inducibility properties. Ede C. et. al., (ACS Synth Biol. 5(5): 395-404, published 5/20/2016, provided in IDS) quantitatively characterized eight distinct core promoters “including minCMV, CMV53 (minCMV with the addition of an upstream GC box), minSV40 (minimal simian virus 40 promoter), miniTK (the −33 to +32 region of the Herpes simplex thymidine kinase promoter), MLP (the −38 to +6 region of the adenovirus major late promoter), pJB42CAT5 (a minimal promoter derived from the human junB gene), YB_TATA (a synthetic minimal promoter developed by Benenson and colleagues), and the TATA box alone (Table S1, Supporting Information),” and showed that this panel “spanned two to three orders of magnitude in basal gene-expression output” and that the choice of core promoter significantly affected inducibility when each was placed downstream of the same hypoxia-responsive element array. For example, Ede reported that minCMV, although “widely used,” showed high leakiness with >15% of the “constitutive CMV” level in the uninduced state and relatively modest fold-induction, whereas the synthetic YB_TATA core exhibited low basal activity with high induced output to give the highest fold-induction among the promoters tested. These data illustrate that relatively small differences in core promoter sequence (e.g., alternative TATA-containing cores of comparable lengths) can result in large differences in basal expression and fold-induction, and that core promoter properties are not predictable from sequence alone.
Therefore, the breadth of claim 111 is not supported by the disclosure. The 80% identity requirement encompasses a large number of possible variations to SEQ ID NO: 101, many of which would be expected to have substantially altered function. Yet, the specification discloses only a single species with the sequence SEQ ID NO: 101 and does not provide any representative examples of “functional variants” within the 80-99% identity range that retain the desires properties. Finally, dependent claim 112 does not cure the lack of written description as it merely adds a CRE, and inherits the rejection as applied to its independent claim 111. Since the specification lacks any structure-function correlation such as mutational analysis or identification of conserved positions within SEQ ID NO: 101, one of ordinary skill in the art cannot visualize functional variants from non-functional variants across the identity range.
Claim Rejections - 35 USC § 112 Improper Dependent Claim
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 115 rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 115 depends from independent claim 97. Claim 97 recites CRE sequences that contain up to six HIF binding sites (HBS) defined as the sequence CTGCACGTA (SEQ ID NO: 7). Claim 115 recites 3 or more HBS and 3 to 10 HBS, both of which broaden the scope of the independent claim from which it depends. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 112 Improper Markush Grouping
Claims 115 and 118 are rejected on the basis that they contain one or more improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117.
The Markush grouping of the “hypoxia-responsive element (HRE)” recited in claims 115 and 118 are improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: the claims permit the HRE to be any of multiple structurally distinct HIF-binding sequence families (e.g., NCGTG consensus sites (SEQ ID NO:5), HRE1 sites ACGTGC (SEQ ID NO:8), HRE2 sites CTGCACGTA (SEQ ID NO:7) and HRE3 composite sites ACCTTGAGTACGTGCGTCTCTGCACGTATG (SEQ ID NO:9) as well as numerous different multimer constructs built from these cores (including, for example, [ACGTGC-S]n (SEQ ID NO:108, 110), [CTGCACGTA-S]n (SEQ ID NO: 100, 114), [HRE3-S] n arrays (SEQ ID NO:118, 120-122), and longer composite HREs such as SEQ ID Nos:112, 116, 117, 126, 128 and 139), together with “functional variants” of each that are merely required to be at least 80% identical. These alternatives differ markedly in core motif length and composition (5-bp NCGTG, 6-bp ACGTGC, 8-bp CTGCACGTA, and 29-bp HRE3), in overall architecture (simple repeats verses complex composite units with internal spacers), and in flanking sequence context. The specification itself describes HRE1, HRE2, and HRE3 as separate HRE families that are designed and optimized using different rules, rather than as a single-recognized class of equivalent structures. Accordingly, the alternatives encompassed by the HRE Markush in claims 115 and 118 are not all members of the same recognized structural class, are not shown to be functionally equivalent with respect to one another, and do not share a substantial common structural feature from which a single common use flows.
The Markush grouping of “an antibodies or fragment thereof, an enzymes or fragment thereof, a cytokine, a lymphokine, an adhesion molecule, a receptors or derivative or fragment thereof, a protein antibiotic, a toxin fusion protein, a carbohydrate-protein conjugate, a structural protein, a regulatory protein, a vaccine or vaccine-like protein or particle, a process enzyme, a growth factor, or a hormone” recited in claim 115 is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: these alternatives do not belong to a recognized physical or chemical class or to an art-recognized class of biologically equivalent molecules, nor are they functionally equivalent. For example, antibodies and fragments thereof possess immunoglobulin variable domains for antigen binding, while cytokines and lymphokines possess helical bundle folds for receptor signaling; toxins feature disulfide-rich or pore-forming scaffolds absent in structural proteins or hormones; enzymes and protease enzymes require catalytic active sites unlike receptors that have ligand-binding and transmembrane domains; and etc. These proteins lack a substantial shared structural feature, and any “common use” as therapeutic expression products does not flow from such a feature but from their disparate biological functions-antigen recognition (antibodies), enzymatic catalysis (enzymes), cytotoxicity (toxins), etc.
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Section 33(a) of the America Invents Act reads as follows:
Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism.
Claim 116 rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101).
Claim 116 recites a cell comprising a bioprocessing vector that comprises an expression cassette comprising a synthetic hypoxia-inducible promoter operably linked to a transgene. The specification discloses “the cell may be present, for example, in cell culture or may be in vivo,” and further defines “suitable cells include…mammalian cells” where in preferred embodiments the “mammalian cell is a human…cell.” The specification discloses that a transgene encodes a “therapeutic expression product” wherein suitable therapeutic products may be proteins or polypeptides or other agents that have for example an antagonistic or agonistic effect in “the management of cancer or other diseases.” Therefore, when the cell of claim 116 is present in vivo, it reads on a human organism, which excluded from the scope of patentable subject matter under 35 U.S.C. 101 and section 33(a) of the America Invents Act.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C.
103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 97, 100-103, 105-108, 110, 113-116, and 118 are rejected under 35 U.S.C. 103 as being unpatentable over Lu et. al, (WO2018/169901A1, published 09/20/2018) in view of Villar D. et. al., (PLOS One 7(9): e45708, published 09/24/2012, provided in IDS), Javen B. et. al., (ecancermedicalscience 11: 751 pp. 1-10, published 06/07/2017, provided in IDS), and Toufaily C. et. al., (PLOS One 13(3): e0121486, published 3/17/2015).
Regarding claims 97, 100-103, 113-115, and 118, Lu discloses “engineered nucleic acids comprising a promoter that comprises the following consensus sequence: TFBS-AGA-TFBS-TCG-TFBS-GAC-TFBS-CTA-TFBS-ACT-TFBS-TGC-TFBS-GTA-TFBS, wherein TFBS is a transcription factor binding site sequence of Table 5” (pg. 1 ln. 29-33; pg. 113 claim 1). Table 5 is a comprehensive library of transcription factor binding site consensus sequences. Lu teaches that “a synthetic promoter comprises at least one (one or more) sequence identified in Table 5 (a specific transcription factor binding site sequence),” and that “a synthetic promoter comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 tandem repeat(s) of a sequence identified in Table 5,” which the “repeat sequence of Table 5 may be separated from each other by a linker sequence” (pg. 9 ln. 3-8). Thus, Lu expressly teaches nucleic acid sequence arrays of up to ten TFBSs comprised of one or more consensus sequences selected from a comprehensive library of known transcription factors, that are separated by spacer sequences and made part of synthetic promoters “to regulate the expression (e.g., activate or repress) the sequence to which it is operably linked” (pg. 6 ln 13-14).
Regarding claims 97, 100-103, 110, 115, and 118, Lu further expressly identifies numerous transcription factors as “regulatory proteins” whose bonding sites may be used in the synthetic promoter, including, AP-1 family members (Fos, FosB, Fra-1, Fra-2, Jun, JunB, and JunD), ATF and CREB family members, HIF family members, and others (pgs. 33-115 Table 5; pg. 28 ln. 7-12; pg. 31 ln. 30-35; pg.38 Table 5 HIF1A_2; pg. 56 Table 5 AP1_Known10; pg. 106 Table 5 AL662828.6_V$ATF6_01_Transfac/ATF6_01). Further, Lu’s examples show that synthetic promoters such as 41 and 44, which contain motifs for tumor-associated TFs including CREB, EGR1, SP1, and E2F1, display higher activity in tumor cell lines than control promoters. Lu also reports synthetic promoters containing RELA, STAT, HIF1A, and TP53 binding sites that show cell-type-specific activity patterns in organoid models. Taken together, Lu’s examples demonstrate that the use of CREB and HIF TFBSs in arrays increases performance or specificity of synthetic promoters, respectively (pgs. 22-32 all examples). In sum, Lu provides a “mix-and-match” TFBS-array framework and an exhaustive library of TFBS motifs to select from such that one can generate endless number of synthetic promoters that can be fine-tuned to be inducible under numerous conditions.
Regarding claims 101-103, 105-108, 110, 113-116, and 118, Lu teaches that “a synthetic promoter is used for therapeutic purposes to drive the expression of a therapeutic molecule (e.g., a protein, such as an antibody, or a nucleic acid, such as a siRNA) in a specific cell type (e.g., a cancer cell) or during a specific cellular state, and that “non-limiting examples of protein or polypeptide-based therapeutic molecules include enzymes, regulatory proteins (e.g., immuno-regulatory proteins), antigens, antibodies or antibody fragments, and structural proteins” (pg. 1 ln. 25-28; pg. 11 ln 11-14). Lu describes that the “engineered nucleic acids (e.g., construct) containing the synthetic promoters” are “operably linked to a nucleotide sequence encoding a molecule (e.g., a protein or nucleic acid)” (pg. 9 ln. 27-20). Lu discloses that the “engineered nucleic acid is delivered to a cell on a vector,” which he defined “vector” as “a nucleic acid (e.g., DNA) used as a vehicle to artificially carry genetic material (e.g., an engineered nucleic acid) into a cell where, for example, it can be replicated and/or expressed.” Lu teaches that a vector can be “an episomal vector” such as “a plasmid,” and in other examples Lu teaches that the “vector is a viral vector” (pg. 15 ln 1-15). Lu teaches that the payload (i.e., the engineered nucleic acids) the vector delivers modifies a cell, for example, “to overexpress an endogenous protein of interest (e.g., via introducing or modifying a promoter or other regulatory element near the endogenous gene that encodes the protein of interest to increase its expression level)” or “to produce a genetic change of interest (e.g., via insertion or homologous recombination)” (pg. 18 ln. 1-6). Lu teaches that the “engineered nucleic acids” “may be used in a broad range of host cell types” including “mammalian cells (e.g., human cells), bacterial cells (Escherichia coli cells), yeast cells, insect cells, or other types of cells,” and that they may be used in vivo, e.g., in a subject such as a human subject” (pg. 16 ln. 11-16). Lu therefore teaches TFBS-array synthetic promoters using TFBSs for AP-1, ATF/CREB-family, HIF1A, and other tumor-associated TFs, arranged in consensus 10-TFBS with spacer motifs, operatively linked to transgenes encoding therapeutic molecules in plasmid and/or viral vectors, and used in mammalian and human cells for targeted gene expression and/or gene therapy.
Lu does not explicitly teach the specific CRE architecture of SEQ ID NO: 21 as recited in claim 97, namely an array composed of three ATF6 TFBS, four AP-1 TFBS, and three HIF/HRE1 TFBS (3xATF6, 4xAP-1, 3xHRE1, total of 10 TFBS separated by a spacer sequence) in the order and sequences claimed. Lu also does not teach the specific synthetic HRE sequences and architectures recited in claims 115 and 118. Finally, Lu does not expressly teach the minimal promoter sequence SEQ ID NO: 101 and its >80-99% identity variants recited in claims 111-112.
Villar teaches that “binding of cooperating transcription factors” at “several target genes” plays a functional role in “HIF-mediated transcription.” Villar “integrated HIF1 alpha ChIP-chip binding locations across cell-types with a meta-analysis of gene expression profiles of cells exposed to hypoxia,” and computationally predicted “several stress-responsive transcription factors as potential HIF1 collaborators.” Villar further experimentally validated “these predictions in cell-based reporter assays” and reported that “binding sites for stress responsive transcription factors other than HIFs,” such as AP-1, CREB/ATF, and CEBPs, “contribute to cooperative hypoxic activation of individual targets” (pgs. 2, 8, and 10; Tables 1-2). Of note, these cooperating TFs, “such as AP-1, CREB, EGR-2 or CEBPB” are “known to be induced by hypoxia” (pg. 12). Villar further teaches that “multiple independent factors contribute, in an additive fashion, to HIF-mediated transcription,” and reports experimental data for both AP-1 family members and/or CREB family members showing cooperativity with HIF binding to achieve greater transcription induction and specificity of target genes during hypoxic conditions (pg. 13).
Javan teaches that HIF binds “hypoxia-response element (HRE) with the consensus core sequence 5'-(A/G)CGT(G/C)(G/C)-3' in the target genes” and that multimerized HRE sequences in combination with minimal promoters generates “hypoxia-inducible gene expression systems” (pgs. 2-3). Javan also teaches that the HRE cores can be combined with tissue/tumor specific promoters to generate “dual-targeting gene expression systems for cancer gene therapy” (pg. 5-6; Table 1). Javan further teaches that “several factors” including, the “nature of the minimal promoter,” the “HRE copy number,” the “spacing and arrangement of the HRE sequence” and “the origin of HRE sequences” are all key for “optimization of HIF-1/HRE system” (pg. 4, 6). Lastly, Javan teaches that even though “tissue-/tumor-specific promoters were combined with HREs to construct a dual-specificity gene expression system to increase the specificity and minimize the side effects,” “these promoters,” however, “are not as strong as viral promoters and often lack sufficient specificity. Therefore, extra regulatory elements…in combination with tissue-/tumor-specific promoters, can be used to increase their expression activity” (pg. 7). In sum, Javan teaches how to utilize HREs to create hypoxia-inducible tumor-specific promoters as a dual-targeting transcriptional regulation systems developed for cancer-specific gene therapy” (abstract).
While Villar and Javan teach that multiple TFs cooperate with HIF to elicit a transcriptional response to hypoxia, they do not teach that certain cooperating TFs such as those in the CREB/ATF and AP-1 families are responsive to forskolin treatment.
However, Toufaily teaches a forskolin-responsive region just upstream of the human Syncytin-2 promoter and demonstrate that this forskolin-responsive region contains an essential cyclin AMP responsive element “(CRE)/AP-1-like motif.” Toufaily demonstrates that just the forskolin-responsive region upstream of a TATA box (e.g., pGS2-TATA-150) is sufficient to elicit robust forskolin inducibility in cellular assays (Fig. 2), and that “mutation within the “CRE/AP-1-like motif” strongly hampered forskolin-induced luciferase activity in BeWo cells (Fig. 4C).” Toufaily further teaches that CREB2 (an ATF family member) and JunD (an AP-1 family member) are the specific TFs interacting with the CRE/AP-1-like motif by forming a “heterodimer” on this motif (Fig. 9), and that their localization at this motif is induced by forskolin treatment (sections: CREB/ATF family members are important for activation of the Syncytin-2 promoter and expression, JunD increases both Syncytin-2 promoter activity and expression, discussion, conclusion, Fig. 9, whole article). Lastly, Toufaily teaches that “forskolin treatment” leads to “an important increase in JunD expression levels” (section: JunD increases both Syncytin-2 promoter activity and expression). In sum, Toufaily teaches that promoter regions containing CREB/ATF and AP-1 family member binding motifs are forskolin inducible and that forskolin treatment positively reinforces this induction by stimulating the expression of the AP-1 family members that bind to such promoter regions.
Regarding claims 97, 100-103, 105-108, 110, 113-116, and 118, it would have been obvious to one of ordinary skill in the art before the effective filing date to select TFBSs from the CREB/ATF, AP-1, and HIF/HRE families to implement in Lu’s “mix-and-match” TFBS-array framework to arrive at the specific cis-regulatory element (CRE), SEQ ID NO: 21 (3xATF6, 4xAP-1, 3xHRE1), because it would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. One would have been motivated to do so for the advantage of increasing the potency and decreasing the leakiness of a synthetic promoter in hypoxic conditions as discussed by Villar and Javan who provide, respectively, that AP-1 and CREB/ATF motifs cooperate with HIF binding sites (HBSs) in endogenous HIF-regulated promoters to modulate the hypoxia response, and that the HIF-1/HRE system can be optimized to fine tune synthetic promoters for specific applications via various strategies including HRE copy number, HRE sequence, promoter pairing, etc., to increase robustness and decrease unwanted effects such as leakiness. Selecting the TFBSs of ATF6, AP-1, and HIF1A/HRE1 and arranging them in the 3/4/3 configuration within the design space defined by Lu (i.e., factors from Table 5 and the 1-10 TFBSs w/spacers array) represents routine optimization of members and copy number to adjust inducibility and robustness, guided by the teachings of Villar and Javan that multiple AP-1/ATF and/or HRE motifs shape hypoxia responsive transcription. The obviousness rational applied to arrive at the elected species, SEQ ID NO: 21, is also applied to arrive at the HRE of claim 118. Regarding the forskolin inducibility of SEQ ID NO: 21, Toufaily teaches that CREB and AP-1 motifs serve as canonical forskolin-responsive elements, and that inserting them upstream of a promoter confers forskolin inducibility. Once Lu’s composition array is configured to include CREB/ATF-family, AP-1 family, and HIF/HRE family TFBSs as in SEQ ID NO: 21 and linked to a minimal promoter, one would have had a reasonable expectation of success in achieving the creation of a synthetic promoter that is responsive to hypoxic conditions and/or forskolin treatment, and further, incorporating such a synthetic promoter into expression cassettes/constructs with therapeutic transgenes, vectors, and cells, is a straightforward application of Lu’s teachings.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 97, 100-103, 105-108, 110, 113-116, and 118 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1 and 16-21 of copending Application No. 17918277 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because of the following reasons:
The structure of elected species SEQ ID NO: 21 of claim 97 is recited in claim 1 of the reference application.
The structure of HRE elements of SEQ ID NO: 114 of claim 115 and SEQ ID NO: 100 in claim 118 are recited in claim 16 of the reference application.
The further limitations of minimal promoter linking, operatively linking to a transgene, expression cassette, a bioprocessing vector, and a cell are also recited in the claims 16-21.
Furthermore, claims 100-103, 105-108, 110, and 113-116, which depend from independent claim 97, inherit the reasoning of number “1” above.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
SEQ ID NO: 101 is free of the prior art of record.
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to COREY LANE BRETZ whose telephone number is (571)272-7299. The examiner can normally be reached M-F 9am-5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000
/COREY LANE BRETZ/ Patent Examiner, Art Unit 1635
/RAM R SHUKLA/ Supervisory Patent Examiner, Art Unit 1635