DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of Application/Amendment/Claims
This Office Action is in response to the communications filed on June 29th, 2026.
Claims 1-96 and 98-99 are canceled.
Claims 120 and 121 are new. Applicant’s statement that these new claims are fully supported by the instant specification and originally filed claims, e.g., claim 115, and add no new matter is acknowledged.
Claims 97 and 100-121 are pending.
Claims 104, 109, 117 and 119 are withdrawn from further consideration as being drawn to a nonelected invention and/or species, in the reply filed on 09/10/2025, there being no allowable generic or linking claim.
Claims 97, 102-104, 111, 114, 115, 118, and 119 are amended. Applicant’s statement that these
claim amendments are fully supported by the instant specification and originally filed claims, and add no new matter is acknowledged.
Claims 97, 100-103, 105-108, 110-116, 118, and 120-121 are being examined on the merits at this time.
Response to Amendments
Withdrawn objections and rejections
Any rejections and/or objections not repeated in this Office action are hereby withdrawn, and thus serves as a response to Applicant’s remarks regarding the withdrawn objections and rejections.
Maintained and/or Updated Objections and Rejections in Response to Claim Amendments
Claim Objections
Claims 102-103, 112, and 115 are objected to because of the following informalities: 1) claims 102 and 103 recite “A synthetic forskolin-inducible promoter according to claim 101,” but they should read “The synthetic forskolin-inducible promoter according to claim 101” as it depends from claim 101 which introduces “A synthetic forskolin-inducible promoter;” 2) claim 102 contains the typographical error “CMV53)”; and 3) spelling of ““claim” 111” in claim 112.
RESPONSE TO APPLICANT’S REMARKS REGARDING CLAIM OBJECTIONS:
The examiner finds the pertinent amendments that fully address the objection to claim 114. However, Applicant’s amendments are not sufficient to obviate the objections of claims 102, 112 and 115.
Claim Interpretation
Claims 97, 103, and 115 list claim limitations in the alternative using “or.” Thus, the examiner is interpreting that only one of the limitations listed in the alternative as being required by the claim.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 103 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The term “minimal” used as a modifier for promoter in claim 103 is a relative term which renders the claims indefinite. The claim recites “MP.” Now the instant amendments to the claim deleted this parenthetical definition “wherein…MP represents a minimal promoter,” which is a new issue in itself and is addressed below in the section “New Grounds of Rejection Necessitated by Amendments;” however, for the purposed of compact prosecution, the examiner is interpreting MP to represent a minimal promoter as previously drafted. The term “minimal” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The term “minimal” is not expressly defined nor is it defined in “minimal promoter.” The specification defines “minimal promoter” as “a short DNA segment” which does not define the length encompasses by the relative term “minimal.” Since it is not clear what the length of “minimal” is and since claim 103 recites a minimal promoter that is not defined, the examiner cannot determine the meets and bounds of the structure, rendering claim 103 indefinite. The examiner notes that the alternative second Markush grouping of structures recites specific minimal promoters such as “CMV-MP,” which are definite; however, the first Markush grouping of structures does not narrow or otherwise define “MP,” and since these Markush groupings of structures are listed in the alternative, only one Markush is considered required for the claim. Thus, when considering the claim under this broadest reasonable interpretation, claim 103 is indefinite when interpreted as requiring only the first Markush grouping of structures.
RESPONSE TO APPLICANT’S REMARKS REGARDING 35 USC § 112(b):
Applicant’s amendments have resolved the rejections applied to claims 97, 100-102, 105-108, 110-116, and 118 and thus the rejections applied to these claims are hereby withdrawn. However, the amendments to claim 103 are not sufficient to obviate the rejection originally set forth for claim 103, as detailed above.
Claim Rejections - 35 USC § 112 Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 97, 100-103, 105-108, 110, 113-116, and 118 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 97, 103, 115, and 118 recite cis-regulatory elements (CREs) and/or hypoxia-responsive elements (HREs) in the form of their general architecture or specific nucleotide sequence. For instance, claim 103 recites the architecture of the elected species, SEQ ID NO: 21 (“ATF6-S-ATF6-S-ATF6-S-AP 1-S-AP 1-S-AP 1-S-AP 1-S-HIF-S-HIF-S-HIF-S-MP”) wherein S represents a spacer sequence and MP represents minimal promoter. The specification establishes that a spacer sequence may be “from 2 to 100 nucleotides in length,” and other more narrow ranges. Thus, claims 97, 103, 115, and 118 are claiming CRE and/or HRE operatively linked to promoters with upwards of 1,000 undefined bases (100+100+100+100+100+100+100+100+100+100) used as spacing elements, where the term “spacer” is defined in the specification as:
“a nucleic acid sequence that separates two functional nucleic acid sequences (e.g. TFBS, CREs, CRMs, minimal promoters, etc.). It can have essentially any sequence, provided it does not prevent the functional nucleic acid sequence (e.g. cis-regulatory element) from functioning as desired (e.g. this could happen if it includes a silencer sequence, prevents binding of the desired transcription factor, or suchlike). Typically, it is non-functional, as in it is present only to space adjacent functional nucleic acid sequences from one another,” (page 72, first paragraph, emphasis added).
Thus, the applicant is claiming a genus of promoter which is incredibly broad and undefined because the spacers can be potentially any sequence. Furthermore, the “spacer” regions are defined as not preventing the functionality of the CIS elements of the promoter, where furthermore the functionality of the promoter as a whole is recited as a “Forskolin-inducible and hypoxia-inducible promoter.” Thus, the recited genus of spacers and promoters must both not interfere with the cis elements of the promoter and function as a Forskolin-inducible and/or hypoxia-inducible promoter. As discussed further below, the Applicant has not shown species commensurate in scope with such a large genus of undefined promoter, as recited. Furthermore, the art teaches that promoter elements are unpredictable (see below).
With regards to the guidance provided in the specification, the applicant has designed and reduced to practice twelve Forskolin-inducible promoters (FORCSV-10, FOR-CMV-009, FMP-02, FLP-01, FORNCMV, FORNMinTK, FORCMV53, FORNMLP, FORNJB42, FORNYB, FORNTATAm6a, and FORNSV40, see example 1-3 and figures 2-7) and ten hypoxia-inducible promoters (RTV-015, Synp-HYP-001, HYBNC, HYBNYB, HYBNC53, HYBNMinTK, HYBNMLP, HYBNpJB42, HYBNSV, and HYBNTATAm6a, see examples 4-7 and figures 9-15). The Applicant alleges that “results seem to validate our design principals with the strength of the promoters correlating to their theoretical relative strength,” (page 87, ln. 35-36). However, the exact rationale behind the design of the spacer elements and promoters does not appear to be discussed in the specification. Nor has the Applicant identified any core structure-function relationship between the recited genus of promoters and a reliable way of predicting their functionality. From the specification alone, the Applicant was not in possession of such a broad genus of promoters because they have not identified such a core common structure for the make-up of the spacer sequences, nor have they tested the effects of different spacer sequence elements on the promoters.
With regards to the state of the art, it is known that DNA binding domains and DNA motifs, as well as what proteins/transcription factors may bind to such sites is unpredictable and uncharacterized. For instance, Schultheis (Schultheis H et al. Sci Rep. 2024 Apr 23;14(1):9275) teaches that:
“while over 1600 TFs have been described in the human genome, only ~700 of these have a known binding motif. Thus, a substantial number of FPs without overlap to a known DNA motif are normally discarded from FP analysis. In addition, the FP method is restricted to organisms with a substantial number of known TF motifs,” (Abstract).
This teaching is relevant to the presently recited structure of the promoters; as Schultheis teaches, over half of the transcription factors/DNA binding proteins of the human genome have unknown binding motifs. In support of Schultheis, Kaluz (Kaluz S. et. al., Biochem. And Biophys. Res. Comm., 2008 Apr 08;370:613-618) teaches that:
“spacing between HBSs is a critical determinant of HRE activity and, for the purpose of constructing minimal enhancers…is optimal (pg. 616)” and “the distance between the HRE and the TATA-box also affects hypoxic activation and there is an optimal spacing between the two (pg. 617).”
Thus, the recited spacer regions of claims 97, 103, 115, and 118 which are defined to be “any” sequence that doesn’t interfere with the functionality of cis elements or transcription factors from binding to the promoter, are uncharacterized because it is unknown what other transcription factors could bind to such random spacers. It is further unclear if such binding would interfere with the functionality of the cis elements and/or the ability of a transcription factor to bind or interact with the cis elements (per the specification at page 68, second paragraph). In short, it appears that the majority of human transcription factors have uncharacterized DNA binding motifs (per Schultheis, Abstract), but claims 97, 103, 115, and 118 allow the spacer sequences to be anything, which would allow for uncharacterized transcription factor DNA binding to the recited promoters with unknown consequences/effects on promoter activity. The Applicant has therefore not characterized and was not in possession of the genus “spacer,” because unknown TFs in cells can bind to uncharacterized DNA motifs, where such effects are unknown on the promoter (e.g., such TFs could interfere with hypoxia response element transcription factor binding to the promoters).
Furthermore, the teachings of Schultheis extend beyond human transcription factors. Schultheis teaches that:
“Of note, human and mouse are some of the most studied models in terms of TF binding, but for most other organisms, the rate of TFs with known motifs is considerably lower (JASPAR CORE vertebrates: 14% non-human),” (Introduction, first paragraph).
Thus, Schultheis teaches that transcription factor DNA motifs and how transcription factors are predicted to bind to such motifs are largely uncharacterized and unknown even in highly studied organisms like humans and mice (Abstract and Introduction). Such known DNA motifs are even less characterized in non-humans (14%, above). Claims 101 and 114 recite respectively a “Forskolin-inducible promoter” and a “hypoxia inducible promoter” which broadly encompasses a promoter which can be induced within a cell. However, the undefined spacer regions, which themselves could be subject to undefined interactions with transcription factors within a cell, were not characterized by the Applicant in human, let alone non-human, cells. Thus, the recited genus of promoters with undefined spacer regions, which are recited to be inducible by Forskolin and/or in hypoxic conditions, was not shown to be in possession by the Applicant at the time of filing because unknown DNA proteins could interact with and interfere with the promoters in a manner that is contrary to the definition of “spacer” given in the specification (page 68, second paragraph). Furthermore, it is entirely unknown if such promoters are functional across all cell types (e.g., yeast and bacteria) given that other organisms and their transcription networks are largely undefined (Schultheis, Abstract and Introduction).
Claims 100-103, 105-110, 113-116 depend either directly or ultimately from independent claim 97 and do not resolve the 112(a)-issue related to the undefined and unpredictable sequences recited for the CREs of claim 97.
Regarding claim 116, this claim further recites a “cell” and is subject to the analysis given above for the unpredictability of the genus of “cell” which would support such an undefined genus as the CRE recited in claim 97 operatively linked to a promoter.
Additionally, as taught by Wang (Wang V et al. Cancer Res. 2005 Apr 15;65(8):3299-306), different cell types have fundamentally different molecular underpinnings with regards to a hypoxic response, where different hypoxia inducible factors play different roles across different cell types (Introduction, fourth paragraph). Thus, there unpredictability concerning whether the recited sequences in fact are “hypoxia-inducible promoters” across different cellular contexts, where the recited term “promoter” reasonably and broadly includes different cellular contexts. For instance, Wang teaches that different cell types can have different responses to hypoxic conditions, where HIF-1 and HIF-2 are active in different cell types (Introduction, fourth paragraph). As evidenced by Orr (Orr AL et al. Nat Chem Biol. 2015 Nov;11(11):834-6), the response element CTGCACGTA, as recited in SEQ ID NO: 7 of claims 97, 115, and 118, is associated with HIF-1 induction (page 10, final paragraph). Given that HIF-1 and HIF-2 are taught by Wang to play varying roles across cell types (Introduction, fourth paragraph), the presently recited “hypoxia-inducible promoters” in claims 114 and 115 have an unpredictable status as such “hypoxia-inducible promoters” because such promoters are reasonably expected to be inducible in a cell, where such induction is unknown across cell types.
RESPONSE TO APPLICANT’S REMARKS REGARDING 35 USC § 112 Written Description:
Applicant's arguments filed 06/29/2026 have been fully considered but they are not persuasive. The applicant argues that the amendments to the claims further narrow the claims; however, this is not the case and the amendments are not sufficient to obviate the rejection on record. The amendments simply delete the recitation of the nucleic acid sequence comprising generic placeholders for spacers but leave the respective recited SEQ ID NOs as originally claimed. These SEQ ID NOs are defined in the SEQ ID as comprising the generic spacer elements of 2-100 nucleotides. Thus, the written description rejection still applies because it pertains to the generic spacer elements creating a genus of promoters that was not in possession at the time of filing.
Claim Rejections - Improper Markush Grouping
Claims 115 and 118 are rejected on the basis that they contain one or more improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117.
The Markush grouping of the “hypoxia-responsive element (HRE)” recited in claims 115 and 118 are improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: the claims permit the HRE to be any of multiple structurally distinct HIF-binding sequence families (e.g., NCGTG consensus sites (SEQ ID NO:5), HRE1 sites ACGTGC (SEQ ID NO:8), HRE2 sites CTGCACGTA (SEQ ID NO:7) and HRE3 composite sites ACCTTGAGTACGTGCGTCTCTGCACGTATG (SEQ ID NO:9) as well as numerous different multimer constructs built from these cores (including, for example, [ACGTGC-S]n (SEQ ID NO:108, 110), [CTGCACGTA-S]n (SEQ ID NO: 100, 114), [HRE3-S] n arrays (SEQ ID NO:118, 120-122), and longer composite HREs such as SEQ ID Nos:112, 116, 117, 126, 128 and 139), together with “functional variants” of each that are merely required to be at least 80% identical. These alternatives differ markedly in core motif length and composition (5-bp NCGTG, 6-bp ACGTGC, 8-bp CTGCACGTA, and 29-bp HRE3), in overall architecture (simple repeats verses complex composite units with internal spacers), and in flanking sequence context. The specification itself describes HRE1, HRE2, and HRE3 as separate HRE families that are designed and optimized using different rules, rather than as a single-recognized class of equivalent structures. Accordingly, the alternatives encompassed by the HRE Markush in claims 115 and 118 are not all members of the same recognized structural class, are not shown to be functionally equivalent with respect to one another, and do not share a substantial common structural feature from which a single common use flows.
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
RESPONSE TO APPLICANT’S REMARKS REGARDING IMPROPER MARKUSH GROUPING:
Applicant’s amendment to claim 115 removed the improper Markush grouping pertaining to the transgene; however, the amendments to claims 115 and 118 are not sufficient to obviate the rejection on record regarding the Markush grouping of the hypoxia-responsive element (HRE).
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Section 33(a) of the America Invents Act reads as follows:
Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism.
Claim 116 rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101).
Claim 116 recites a cell comprising a bioprocessing vector that comprises an expression cassette comprising a synthetic hypoxia-inducible promoter operably linked to a transgene. The specification discloses “the cell may be present, for example, in cell culture or may be in vivo,” and further defines “suitable cells include…mammalian cells” where in preferred embodiments the “mammalian cell is a human…cell.” The specification discloses that a transgene encodes a “therapeutic expression product” wherein suitable therapeutic products may be proteins or polypeptides or other agents that have for example an antagonistic or agonistic effect in “the management of cancer or other diseases.” Therefore, when the cell of claim 116 is present in vivo, it reads on a human organism, which is excluded from the scope of patentable subject matter under 35 U.S.C. 101 and section 33(a) of the America Invents Act.
Applicant may remedy be amending the claim to recite “an isolated cell…”
RESPONSE TO APPLICANT’S REMARKS REGARDING CLAIM REJECTION - 35 USC § 101:
Applicant's arguments filed 06/29/2026 have been fully considered but they are not persuasive.
Applicant argues that the examiner improperly expands the claim beyond its plain language because “claim 116 is directed to a cellular composition comprising an engineered bioprocessing vector,” and that it is not directed to a human organism. However, Claim 116 recites “a cell comprising a bioprocessing vector…” Nowhere does claim 116 recite “a cellular composition comprising an engineered bioprocessing vector.” Therefore, as stated in the rejection above, when the cell of claim 116 is present in vivo in a human, the claim reads on a human.
Applicant further argues that “under the broadest reasonable interpretation, a claim to "a cell comprising a bioprocessing vector" is not a claim to a human organism.” However, also under the broadest reasonable interpretation, claim 116 as currently drafted reads on a human organism.
Applicant further argues that “a single engineered cell is not a human organism, and claim 116 does not recite, require, or encompass a human body, human embryo, fetus, patient, or multicellular human organism. Nor does claim 116 require that the cell be present in vivo.”
Contrary to applicants’ arguments, claim 115 is not drawn to “a single engineered cell”. Furthermore, instantly presented claim 116 is interpreted to encompass a human because the specification discloses intended use of administration to a human subject. Accordingly, claim encompasses a cell comprising the claimed vector present in a human; thus, the claim encompasses a human. . Furthermore, while applicant’s statement that claim 116 does not require the cell to be present in vivo, the broadest reasonable interpretation allows for the cell to be present in vivo in a human per the plain language of the claim and further evidenced by definitions in the instant specification as described in the rejection above.
Applicant may remedy by amending claim 116 to recite “an isolated cell.”
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C.
103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 97, 100-103, 105-108, 110, 113-116, and 118 are rejected under 35 U.S.C. 103 as being unpatentable over Lu et. al, (WO2018/169901A1, published 09/20/2018) in view of Villar D. et. al., (PLOS One 7(9): e45708, published 09/24/2012, provided in IDS), Javen B. et. al., (ecancermedicalscience 11: 751 pp. 1-10, published 06/07/2017, provided in IDS), and Toufaily C. et. al., (PLOS One 13(3): e0121486, published 3/17/2015).
Regarding claims 97, 100-103, 113-115, and 118, Lu discloses “engineered nucleic acids comprising a promoter that comprises the following consensus sequence: TFBS-AGA-TFBS-TCG-TFBS-GAC-TFBS-CTA-TFBS-ACT-TFBS-TGC-TFBS-GTA-TFBS, wherein TFBS is a transcription factor binding site sequence of Table 5” (pg. 1 ln. 29-33; pg. 113 claim 1). Table 5 is a comprehensive library of transcription factor binding site consensus sequences. Lu teaches that “a synthetic promoter comprises at least one (one or more) sequence identified in Table 5 (a specific transcription factor binding site sequence),” and that “a synthetic promoter comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 tandem repeat(s) of a sequence identified in Table 5,” which the “repeat sequence of Table 5 may be separated from each other by a linker sequence” (pg. 9 ln. 3-8). Thus, Lu expressly teaches nucleic acid sequence arrays of up to ten TFBSs comprised of one or more consensus sequences selected from a comprehensive library of known transcription factors, that are separated by spacer sequences and made part of synthetic promoters “to regulate the expression (e.g., activate or repress) the sequence to which it is operably linked” (pg. 6 ln 13-14).
Regarding claims 97, 100-103, 110, 115, and 118, Lu further expressly identifies numerous transcription factors as “regulatory proteins” whose bonding sites may be used in the synthetic promoter, including, AP-1 family members (Fos, FosB, Fra-1, Fra-2, Jun, JunB, and JunD), ATF and CREB family members, HIF family members, and others (pgs. 33-115 Table 5; pg. 28 ln. 7-12; pg. 31 ln. 30-35; pg.38 Table 5 HIF1A_2; pg. 56 Table 5 AP1_Known10; pg. 106 Table 5 AL662828.6_V$ATF6_01_Transfac/ATF6_01). Further, Lu’s examples show that synthetic promoters such as 41 and 44, which contain motifs for tumor-associated TFs including CREB, EGR1, SP1, and E2F1, display higher activity in tumor cell lines than control promoters. Lu also reports synthetic promoters containing RELA, STAT, HIF1A, and TP53 binding sites that show cell-type-specific activity patterns in organoid models. Taken together, Lu’s examples demonstrate that the use of CREB and HIF TFBSs in arrays increases performance or specificity of synthetic promoters, respectively (pgs. 22-32 all examples). In sum, Lu provides a “mix-and-match” TFBS-array framework and an exhaustive library of TFBS motifs to select from such that one can generate endless number of synthetic promoters that can be fine-tuned to be inducible under numerous conditions.
Regarding claims 101-103, 105-108, 110, 113-116, and 118, Lu teaches that “a synthetic promoter is used for therapeutic purposes to drive the expression of a therapeutic molecule (e.g., a protein, such as an antibody, or a nucleic acid, such as a siRNA) in a specific cell type (e.g., a cancer cell) or during a specific cellular state, and that “non-limiting examples of protein or polypeptide-based therapeutic molecules include enzymes, regulatory proteins (e.g., immuno-regulatory proteins), antigens, antibodies or antibody fragments, and structural proteins” (pg. 1 ln. 25-28; pg. 11 ln 11-14). Lu describes that the “engineered nucleic acids (e.g., construct) containing the synthetic promoters” are “operably linked to a nucleotide sequence encoding a molecule (e.g., a protein or nucleic acid)” (pg. 9 ln. 27-20). Lu discloses that the “engineered nucleic acid is delivered to a cell on a vector,” which he defined “vector” as “a nucleic acid (e.g., DNA) used as a vehicle to artificially carry genetic material (e.g., an engineered nucleic acid) into a cell where, for example, it can be replicated and/or expressed.” Lu teaches that a vector can be “an episomal vector” such as “a plasmid,” and in other examples Lu teaches that the “vector is a viral vector” (pg. 15 ln 1-15). Lu teaches that the payload (i.e., the engineered nucleic acids) the vector delivers modifies a cell, for example, “to overexpress an endogenous protein of interest (e.g., via introducing or modifying a promoter or other regulatory element near the endogenous gene that encodes the protein of interest to increase its expression level)” or “to produce a genetic change of interest (e.g., via insertion or homologous recombination)” (pg. 18 ln. 1-6). Lu teaches that the “engineered nucleic acids” “may be used in a broad range of host cell types” including “mammalian cells (e.g., human cells), bacterial cells (Escherichia coli cells), yeast cells, insect cells, or other types of cells,” and that they may be used in vivo, e.g., in a subject such as a human subject” (pg. 16 ln. 11-16). Lu therefore teaches TFBS-array synthetic promoters using TFBSs for AP-1, ATF/CREB-family, HIF1A, and other tumor-associated TFs, arranged in consensus 10-TFBS with spacer motifs, operatively linked to transgenes encoding therapeutic molecules in plasmid and/or viral vectors, and used in mammalian and human cells for targeted gene expression and/or gene therapy.
Lu does not explicitly teach the specific CRE architecture of SEQ ID NO: 21 as recited in claim 97, namely an array composed of three ATF6 TFBS, four AP-1 TFBS, and three HIF/HRE1 TFBS (3xATF6, 4xAP-1, 3xHRE1, total of 10 TFBS separated by a spacer sequence) in the order and sequences claimed. Lu also does not teach the specific synthetic HRE sequences and architectures recited in claims 115 and 118. Finally, Lu does not expressly teach the minimal promoter sequence SEQ ID NO: 101 and its >80-99% identity variants recited in claims 111-112.
Villar teaches that “binding of cooperating transcription factors” at “several target genes” plays a functional role in “HIF-mediated transcription.” Villar “integrated HIF1 alpha ChIP-chip binding locations across cell-types with a meta-analysis of gene expression profiles of cells exposed to hypoxia,” and computationally predicted “several stress-responsive transcription factors as potential HIF1 collaborators.” Villar further experimentally validated “these predictions in cell-based reporter assays” and reported that “binding sites for stress responsive transcription factors other than HIFs,” such as AP-1, CREB/ATF, and CEBPs, “contribute to cooperative hypoxic activation of individual targets” (pgs. 2, 8, and 10; Tables 1-2). Of note, these cooperating TFs, “such as AP-1, CREB, EGR-2 or CEBPB” are “known to be induced by hypoxia” (pg. 12). Villar further teaches that “multiple independent factors contribute, in an additive fashion, to HIF-mediated transcription,” and reports experimental data for both AP-1 family members and/or CREB family members showing cooperativity with HIF binding to achieve greater transcription induction and specificity of target genes during hypoxic conditions (pg. 13).
Javan teaches that HIF binds “hypoxia-response element (HRE) with the consensus core sequence 5'-(A/G)CGT(G/C)(G/C)-3' in the target genes” and that multimerized HRE sequences in combination with minimal promoters generates “hypoxia-inducible gene expression systems” (pgs. 2-3). Javan also teaches that the HRE cores can be combined with tissue/tumor specific promoters to generate “dual-targeting gene expression systems for cancer gene therapy” (pg. 5-6; Table 1). Javan further teaches that “several factors” including, the “nature of the minimal promoter,” the “HRE copy number,” the “spacing and arrangement of the HRE sequence” and “the origin of HRE sequences” are all key for “optimization of HIF-1/HRE system” (pg. 4, 6). Lastly, Javan teaches that even though “tissue-/tumor-specific promoters were combined with HREs to construct a dual-specificity gene expression system to increase the specificity and minimize the side effects,” “these promoters,” however, “are not as strong as viral promoters and often lack sufficient specificity. Therefore, extra regulatory elements…in combination with tissue-/tumor-specific promoters, can be used to increase their expression activity” (pg. 7). In sum, Javan teaches how to utilize HREs to create hypoxia-inducible tumor-specific promoters as a dual-targeting transcriptional regulation systems developed for cancer-specific gene therapy” (abstract). Javan further teaches that “several constructs of HRE sequences and a minimum viral promoter such as SV40, cytomegalovirus (CMV) and adenovirus E1B have been developed, which are chiefly investigated in gene-directed enzyme prodrug therapy (GDEPT) approaches,” see section hypoxia-inducible gene expression systems. For example, in specific embodiments, Javan further teaches “HCT-8 cells were cotransfected with two hypoxia-inducible expression vectors; p9HRE-TK/eGFP containing nine tandem repeats of human EPO gene HRE linked to the SV40 minimal promoter (SV40 min) and p9HRE-CD/UPRT/mDsRed, which contains the CD, uracil phosphoribosyl transferase (UPRT), and mDsRed fusion gene under the regulation of the 9HRE/SV40 min,” see section Hypoxia-inducible gene expression systems in cancer gene therapy. Javan further teaches that one area to consider when optimizing the HIF-1/HRE system is the nature of the minimal promoter; “for instance, replacing the minimal thymidine kinase (TK) promoter with the minimal SV40 promoter results in an increased induction ratio of 18-fold to 146-fold,” see section Optimization of HIF-1/HRE system.
While Villar and Javan teach that multiple TFs cooperate with HIF to elicit a transcriptional response to hypoxia, they do not teach that certain cooperating TFs such as those in the CREB/ATF and AP-1 families are responsive to forskolin treatment.
However, Toufaily teaches a forskolin-responsive region just upstream of the human Syncytin-2 promoter and demonstrate that this forskolin-responsive region contains an essential cyclin AMP responsive element “(CRE)/AP-1-like motif.” Toufaily demonstrates that just the forskolin-responsive region upstream of a TATA box (e.g., pGS2-TATA-150) is sufficient to elicit robust forskolin inducibility in cellular assays (Fig. 2), and that “mutation within the “CRE/AP-1-like motif” strongly hampered forskolin-induced luciferase activity in BeWo cells (Fig. 4C).” Toufaily further teaches that CREB2 (an ATF family member) and JunD (an AP-1 family member) are the specific TFs interacting with the CRE/AP-1-like motif by forming a “heterodimer” on this motif (Fig. 9), and that their localization at this motif is induced by forskolin treatment (sections: CREB/ATF family members are important for activation of the Syncytin-2 promoter and expression, JunD increases both Syncytin-2 promoter activity and expression, discussion, conclusion, Fig. 9, whole article). Lastly, Toufaily teaches that “forskolin treatment” leads to “an important increase in JunD expression levels” (section: JunD increases both Syncytin-2 promoter activity and expression). In sum, Toufaily teaches that promoter regions containing CREB/ATF and AP-1 family member binding motifs are forskolin inducible and that forskolin treatment positively reinforces this induction by stimulating the expression of the AP-1 family members that bind to such promoter regions.
Regarding claims 97, 100-103, 105-108, 110, 113-116, and 118, it would have been obvious to one of ordinary skill in the art before the effective filing date to select TFBSs from the CREB/ATF, AP-1, and HIF/HRE families to implement in Lu’s “mix-and-match” TFBS-array framework to arrive at the specific cis-regulatory element (CRE), SEQ ID NO: 21 (3xATF6, 4xAP-1, 3xHRE1), because it would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. One would have been motivated to do so for the advantage of increasing the potency and decreasing the leakiness of a synthetic promoter in hypoxic conditions as discussed by Villar and Javan who provide, respectively, that AP-1 and CREB/ATF motifs cooperate with HIF binding sites (HBSs) in endogenous HIF-regulated promoters to modulate the hypoxia response, and that the HIF-1/HRE system can be optimized to fine tune synthetic promoters for specific applications via various strategies including HRE copy number, HRE sequence, promoter pairing (with for example minTK, CMVmp, or SV40mp), etc., to increase robustness and decrease unwanted effects such as leakiness. Selecting the TFBSs of ATF6, AP-1, and HIF1A/HRE1 and arranging them in the 3/4/3 configuration within the design space defined by Lu (i.e., factors from Table 5 and the 1-10 TFBSs w/spacers array) represents routine optimization of members and copy number to adjust inducibility and robustness, guided by the teachings of Villar and Javan that multiple AP-1/ATF and/or HRE motifs shape hypoxia responsive transcription. The obviousness rational applied to arrive at the elected species, SEQ ID NO: 21, is also applied to arrive at the HRE of claim 118. Regarding the forskolin inducibility of SEQ ID NO: 21, Toufaily teaches that CREB and AP-1 motifs serve as canonical forskolin-responsive elements, and that inserting them upstream of a promoter confers forskolin inducibility. Once Lu’s composition array is configured to include CREB/ATF-family, AP-1 family, and HIF/HRE family TFBSs as in SEQ ID NO: 21 and linked to a minimal promoter, one would have had a reasonable expectation of success in achieving the creation of a synthetic promoter that is responsive to hypoxic conditions and/or forskolin treatment, and further, incorporating such a synthetic promoter into expression cassettes/constructs with therapeutic transgenes, vectors, and cells, is a straightforward application of Lu’s teachings.
RESPONSE TO APPLICANT’S REMARKS REGARDING CLAIM REJECTION - 35 USC § 103
Applicant's arguments filed 06/29/2026 have been fully considered but they are not persuasive.
In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971).
In response to applicant’s argument that there is no teaching, suggestion, or motivation to combine the references, the examiner recognizes that obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). In this case, the motivation is not derived from applicant’s disclosure but from the cited art as Villar expressly teaches that AP-1 and CREB/ATF binding sites cooperate with HIF binding sites at endogenous hypoxia-regulated genes to modulate the magnitude and specificity of the hypoxic response, and Javan expressly teaches that HRE copy number, spacing, and choice of minimal promoter are recognized, result-effective parameters for optimizing HIF-1/HRE inducible expression systems. Toufaily independently teaches that a CRE/AP-1-like motif bound by CREB2 and JunD confers forskolin inducibility. Each reference therefore supplies its own express reason grounded in art recognized transcription factor biology rather than in applicant’s specification, for a person of ordinary skill in the art to select and combine ATF6/CREB-family, AP-1 family, and HIF/HRE family binding sites within Lu’s disclosed 1-10 TFBS “mix-and-match” array framework in order to obtain a synthetic promoter with that is forskolin-inducible.
Regarding applicant’s remarks in sections A. and B. of their response:
Applicant’s argument that the cited art does not teach “every possible synthetic CRE sequence” or the “specific ordered architectures” is not commensurate with the standard for obviousness. Obviousness does not require that a single reference or combination of references teach the exact claimed sequence of/arrangement; it requires only that the combination of known elements, combined according to known methods was obvious and, would have yielded predictable results to one of ordinary skill. Here, Lu discloses the general design platform (1-10 TFBs selected from a defined library, separated by spacers, in a synthetic promoter), and Villar and Javan each specifically identify which TF families (AP-1, CREB/ATF, and HIF) cooperate with one another and which parameters (copy number, spacing, and minimal promoter identity) are known to modulate the resulting inducibility. Selecting members from the very three families the art identifies as cooperative, and arranging them in a 3/4/3 ratio within Lu’s expressly disclosed member array represents an art-guided selection into a finite set of options that KSR identifies as obvious to try rather than an unguided search of an unbounded design space. The order/copy-number selection is a routine optimization of recognized variables of known function.
Regarding applicant’s remarks in section C. of their response:
Claims 105-108 and 110 add only the expression cassette, vector, gene therapy vector, and therapeutic-use context already expressly taught by Lu around the CRE/promoter of the base claims, and applicant has not separately argued rejection of these claims.
Regarding applicant’s remarks in section D. of their response:
The same reasoning, as discussed for the specific CRE sequences and ordered architecture above, applies to the HRE-specific claims as Javan expressly teaches the HRE consensus core sequence 5'-(A/G)CGT(G/C)(G/C)-3', teaches that multimerized HRE copies combined with a minimal promoter for the basic hypoxia-inducible unit, and teaches specific minimal promoters used with HREs including the SV40 minimal promoter, the CMV minimal promoter and the minTK promoter. Thus, the newly amended claim 102 Markush group of minimal promoters are art recognized interchangeable components of an HRE-driven expression system. Therefore, the amendment does not remove the claim from the scope of the existing rejection but is met by Javan’s teaching of named minimal promoters.
As to claim 115, applicant argues that the claim has been narrowed to require that all HBS present in the HRE consist of the same one of HRE1, HRE2, HRE3, or SEQ ID NO: 106. This narrowing does not obviate the rejection, because Javan’s disclosed HRE consensus core sequence satisfies instantly recited SEQ ID NO: 8, which was one of the alternative limitations in the amended claim 115. It is emphasized that claim 115 recites elements as alternatives and thus the art only need to read on one of the alternatives.
Regarding applicant’s remarks in section E. of their response:
Applicant argues that, even if the references could be combined, the art fails to establish a reasonable expectation of success because promoter activity depends on numerous interrelated variables (motif identity, order, copy number, spacing, minimal promoter, cell type) and small changes can materially alter basal expression, inducibility, dynamic range, and specificity. This argument is not persuasive for the following reasons:
First, obviousness requires only a reasonable expectation of success, not absolute predictability of success. Applicant’s own framing, that variables can affect the degree or character of activity, is fully consistent with a reasonable expectation rather than a certain expectation, which is all that is required.
Second, applicant’s argument is unsupported by any objective evidence. Applicant does not provide any evidence to support these assertions. Arguments presented by the applicant cannot take the place of evidence in the record. In re Schulze, 346 F.2d 600, 602, 145 USPQ 716, 718 (CCPA 1965) and In re De Blauwe, 736 F.2d 699, 705, 222 USPQ 191, 196 (Fed. Cir. 1984). By contrast, the obviousness rejection is grounded in affirmative, objective teachings in the cited references. Villar demonstrates that AP-1 and CREB/ATF binding sites cooperate with HIF binding to produce greater, not diminished or unpredictable hypoxic induction. Javan reports that combining HREs in tandem with minimal promoters reliably increases induction ratio. Toufaily demonstrates that the CREB/AP-1 motif is necessary and sufficient for forskolin-induced activity. Thus, each reference provided objective, experimental evidence, not mere assertion that combining these specific classes of elements produces the claimed inducibility. Absent objective evidence to the contrary, and where the prior art affirmatively demonstrates that the combination is expected to work as intended, applicant’s unsupported assertion that the combination “might” fail is insufficient to rebut the prima facie case.
Third, applicant’s functional arguments are directed to features that are not commensurate in scope with the claims. The claims are compositions claims directed to a CRE or promoter defined by its recited sequence(s)/architecture and inducibility, they do not recite any particular level, magnitude, dynamic range, or degree of basal expression, induction, or specificity. Arguments premised on the notion that “small changes…can materially alter basal expression, inducibility, dynamic range, and cell-type specificity” therefore address properties that are not claimed limitations. Arguments based on limitations not appearing in the claims are not persuasive. The cites references teach the inducibility of each of the element providing the requisite reasonable expectation of success.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 97, 100-103, 105-108, 110, 113-116, and 118 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1 and 16-21 of copending Application No. 17918277 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because of the following reasons:
The structure of elected species SEQ ID NO: 21 of claim 97 is recited in claim 1 of the reference application.
The structure of HRE elements of SEQ ID NO: 114 of claim 115 and SEQ ID NO: 100 in claim 118 are recited in claim 16 of the reference application.
The further limitations of minimal promoter linking, operatively linking to a transgene, expression cassette, a bioprocessing vector, and a cell are also recited in the claims 16-21.
Furthermore, claims 100-103, 105-108, 110, and 113-116, which depend from independent claim 97, inherit the reasoning of number “1” above.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
RESPONSE TO APPLICANT’S REMARKS REGARDING DOUBLE PATENTING:
Applicant has not provided remarks regarding the double patenting rejection and thus the double patenting rejection is maintained and remains unrebutted.
New Rejections Necessitated by Amendment
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 103 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 103 recites the limitation "MP" in lines 3-6, 8, 10, 13-16, 21, and 24 and “S” in lines 3-10, 13-17, 19-20, and 22-23. There is insufficient antecedent basis for this limitation in the claim.
The abbreviations “MP” and “S” lack a clear antecedent basis and are undefined within claim 103. Applicant has canceled the clause “wherein S represents an optional, but preferable, spacer sequence, and MP represents a minimal promoter,” which was previously was previously the only language in the claim identifying what “MP” denotes, and while “S” was also previously defined in independent claim 97, claim 97 has also been amended to cancel the definition of “S; thus, leaving “S” undefined as currently drafted. Absent any definition within claim 103 or the claims from which it depends, the metes and bounds of the claim cannot be determined from the claim language alone, rendering claim 103 indefinite.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim 120 is rejected under 35 U.S.C. 103 as being unpatentable over Lu et. al, (WO2018/169901A1, published 09/20/2018) in view of Villar D. et. al., (PLOS One 7(9): e45708, published 09/24/2012, provided in IDS), Javen B. et. al., (ecancermedicalscience 11: 751 pp. 1-10, published 06/07/2017, provided in IDS), and Toufaily C. et. al., (PLOS One 13(3): e0121486, published 3/17/2015) as applied to claims 97 and 113-114 above.
The teachings of Lu, Villar, Javen, and Toufaily are incorporated herein by reference to the 103 rejection above.
While Javen teaches the hypoxia-response element (HRE) with the consensus core sequence 5'-(A/G)CGT(G/C)(G/C)-3' corresponding to instantly claimed SEQ ID NO: 8 and that this HIF binding sequence may be used in tandem with minimal viral promoters such as CMVmin, neither Lu, Villar, Javen, or Toufaily explicitly teach SEQ ID NOs: 100, 108, 110, 112, 114, 116-118, 120-122, 126, 128, or 139. However, it is emphasized that the aforementioned sequences are presented in the alternative; thus, claim 120 only requires one of the sequences.
It would have been obvious to a person having ordinary skill in the art (PHOSITA) to arrive at HRE comprising SEQ ID NO: 108 by arranging the consensus sequence of Javan in tandem separated by a spacer sequence of 2-100 nucleotides. A PHOSITA would have been motivated to do so because Javen teaches to multimerize HREs with the consensus sequence and doing so results in hypoxia-inducible gene expression systems with greater activity. The consensus sequence taught by Javen reads on SEQ ID NO: 8 of the instant application, and instant SEQ ID NO: 108 is merely two copies of instant SEQ ID NO: 8 separated by undefined spacer sequence of 2-100 nucleotides in length, and Javen explicitly teaches to provide multiple copies of the HIF binding sequence in an HRE. Therefore, a PHOSITA would have had a reasonable expectation of success that providing at least two HIF binding sites separated by a spacer as in instant SEQ ID NO: 108 would predictably result in a HRE that is hypoxia inducible.
Conclusion
Claims 111-112 and 121 are free of the art of record.
Claim 121 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to COREY LANE BRETZ whose telephone number is (571)272-7299. The examiner can normally be reached M-F 7:30am - 6:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/COREY LANE BRETZ/Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Prosecution Insights