Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
1. Applicant’s election without traverse of Group I in the reply filed on October 01, 2025 is acknowledged. During a telephone conversation with Jila Bakker on December 15, 2025 a provisional election of SEQ ID NO. 1 was made without traverse. Affirmation of this election must be made by applicant in replying to this Office action.
Status of the Application
2. Claims 1-3, 5-8, 17-20 (in-part) and 24-26 (in-part) are considered for examination along with the elected SEQ ID NO:1. Claims 21-23, 27-29 are withdrawn from further consideration under 37 CFR 1.142(b), as being drawn to a non-elected Seq ID Nos. Claims 4, 9 and 11-16 were canceled.
Priority
3. This application filed on September 30, 20222 is a CON of PCT/US2022/077221 filed on September 29, 2022 which claims priority benefit to US 63/351, 170 filed on June 10, 2022 and US 63/250,563 filed on September 30, 2021.
Informalities
4. The following informalities are noted.
(i) claim 7 recites ‘28S, 23S, 18S, 5.8S, 5S, 16S, 12S, HBA-A1, HBA-A2, HBB, HBB-B1, HBB-B2, HBG1 or HBG2’. Expanding the abbreviated terms at least for the first time that they appear in the claims is suggested. Appropriate correction is required.
Claim Rejections - 35 USC § 112
5. The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
(i) Claim 10 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 10 recites ‘providing the said support of claim 9’. The limitations are unclear and indefinite because claim 9 is canceled and it is not clear what support of canceled claim 9, the limitations are referring to. Further, Claim 10 recites the limitation "the said support in step(a), the first pool of oligonucleotides in step (c and d) and the second pool of oligonucleotides in step (d)" in the claim. There is insufficient antecedent basis for this limitation in the claim because the claim 10 (dependent on canceled claim 9) lacks support to said limitations and it is not clear what the limitations are referring to.
(ii) Claims 5-7 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 5 recites ‘wherein at least one unwanted RNA sequence’ in line 1 of the claim. The limitations are unclear and indefinite because the claim 1 upon which claim 5 depends lacks support to said unwanted RNA sequence and it is not clear what the limitations are referring to.
Claim Rejections - 35 USC § 102
6. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim 1-3 and 5-8 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Christians et al. (US 6,613,516).
Christians et al. teach a method of claim 1, selecting cDNA library fragments from a library of cDNA fragments prepared from RNA, comprising:
a) preparing a solid support comprising a pool of immobilized oligonucleotides, wherein each immobilized oligonucleotide in the pool comprises a nucleic acid sequence corresponding to an RNA sequence or its complement (col. 11, line 14-62, col. 7, line 43 to line 64: indicating preparing bait oligonucleotides or probes immobilized on a solid support, wherein the solid support is a bead, array or solid substrate);
b) adding the library of fragments to the solid support and hybridizing the library fragments to at least one immobilized oligonucleotide to allow binding of library fragments to at least one immobilized oligonucleotide (col. 11, line 14-67, col. 12, line 1 to line 29 on col. 13, col. 6, line 27 to line 64 on col. 7, col. 8, line 42-67, col. 9, line 1-10, claims 1-26), and
C) collecting (enriching) library fragments either bound or not bound to at least one immobilized oligonucleotide (col. 11, line 14-62, col. 13, line 30 to line 57 on col. 15, col. 6, line 27 to line 64 on col. 7, col. 8, line 42-67, col. 9, line 1-10, claims 1-26, indicating enriching by separating and purifying the fragments of interest).
With reference to claim 2, Christians et al. teach that a) the selecting is depleting unwanted cDNA library fragments, wherein the RNA sequence comprises an unwanted RNA sequence, the unwanted library fragments comprise those prepared from unwanted RNA sequences, and the collecting comprises collecting library fragment not bound to at least one immobilized oligonucleotide ; or b) the selecting is enriching desired cDNA library fragments, wherein the RNA sequence comprises a desired RNA sequence, the desired library fragments comprise those prepared from desired RNA sequences, and the collecting comprises collecting library fragment bound to at least one immobilized oligonucleotide (col. 6, line 27 to line 64 on col. 7, col. 8, line 42-67, col. 9, line 1-10).
With reference to claim 3, Christians et al. teach that the library of fragments is subjected to depleting unwanted cDNA library fragments and the collected library fragments not bound to at least one immobilized oligonucleotides are then subjected to enriching desired cDNA library fragments (col. 6, line 27 to line 64 on col. 7, col. 8, line 42-67, col. 9, line 1-10).
With reference to claim 5-7, Christians et al. teach that at least one unwanted RNA sequence has at least 90%, at least 95%, or at least 99% homology to a high-abundance RNA sequence in a sample used to prepare the library of fragments, wherein the high-abundance RNA sequence is a ribosomal RNA (rRNA) sequence. wherein the unwanted RNA sequence is 23S or 16S or a fragment thereof (col. 5, line 27-48, col. 8, line 42-67, col. 9, line 1-10, claims 8-10).
With reference to claim 8, Christians et al. teach that each pool of immobilized oligonucleotides comprises 2 or more to 1100 or more oligonucleotides (col. 17, line 52-55, col. 18, line 1-3: indicating probe set comprising 4,216 probe sets). For all the above the claims are anticipated.
Claim Rejections - 35 USC § 103
7. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
A. Claims 1-3, 5-8 and 10 are rejected under 35 U.S.C. 103 as being unpatentable over Kuersten et al. (WO2020/132304) in view of Vogelstein et al. (US 2019/0256924).
Kuersten et al. teach a method of claim 1, 10, selecting cDNA library fragments from a library of cDNA fragments prepared from RNA, comprising: a) and b) adding the library of fragments to the pool of oligonucleotides, wherein each oligonucleotide in the pool comprises a nucleic acid sequence corresponding to an RNA sequence or its complement and hybridizing the library fragments to at least one oligonucleotide to allow binding of library fragments to at least one oligonucleotide (para 0008-0009, 0011-0012, 0065-0073), and
C) collecting library fragments either bound or not bound to at least one oligonucleotide (para 0008-0009, 0011).
With reference to claim 2, Kuersten et al. teach that a) the selecting is depleting unwanted cDNA library fragments, wherein the RNA sequence comprises an unwanted RNA sequence, the unwanted library fragments comprise those prepared from unwanted RNA sequences, and the collecting comprises collecting library fragment not bound to at least one oligonucleotide; or
b) the selecting is enriching desired cDNA library fragments, wherein the RNA sequence comprises a desired RNA sequence, the desired library fragments comprise those prepared from desired RNA sequences, and the collecting comprises collecting library fragment bound to at least one oligonucleotide (para 0008-0009, 0011-0012, 0030-0032).
With reference to claim 3, Kuersten et al. teach that the library of fragments is subjected to depleting unwanted cDNA library fragments and the collected library fragments not bound to at least one oligonucleotides are then subjected to enriching desired cDNA library fragments.
With reference to claim 5, teach that at least one unwanted RNA sequence has at least 90%, at least 95%, or at least 99% homology to a high-abundance RNA sequence in a sample used to prepare the library of fragments (para 0040).
With reference to claim 6-7, Kuersten et al. teach that the high-abundance RNA sequence is a ribosomal RNA (rRNA) sequence. wherein the unwanted RNA sequence is globin mRNA or 28S, 23S, 18S, 5.88, 5S, 16S, 128, HBA-Al, HBA-A2, HBB, HBB-B1, HBB-B2, HBG1, or HBG2 RNA, or a fragment thereof (para 0006, 0042).
With reference to claim 8, Kuersten et al. teach that each pool of oligonucleotides comprises 2 or more, 5 or more, 10 or more, 25 or more, 50 or more, 100 or more, 200 or more, 300 or more oligonucleotides (para 0040-0041, 0020: indicating probe set comprising 2 to 333 oligonucleotides).
With reference to claim 10, Kuersten et al. also teach adding adapters (sequencing primers) to the library of fragments and amplifying the nucleic acids (para 0074-0079).
However, Kuersten et al. did not specifically teach pool of oligonucleotides immobilized on a solid substrate.
Vogelstein et al. teach a method for preparing depleted RNA composition, wherein the method comprises hybridizing RNA sample with probe molecules, depleting unwanted target RNA, adding sequencing primer adaptors, and amplifying the desired nucleic acids and sequencing, wherein Vogelstein et al. teach that the amplification comprises bridge amplification (para 0551-0552, 0615, 0604-0605, 0541, 0570-0575).
It would be prima facie obvious to an ordinary person skilled in the art before the effective filing date of the invention to modify the method of Kuersten et al. with immobilized oligonucleotide sets and bridge amplification as taught by Vogelstein et al. to develop an improved method for solid phase amplification of enriched nucleic acids. The ordinary person skilled in the art would have motivated to combine the method of Kuersten et al. with immobilized oligonucleotides as taught by Vogelstein et al. and have a reasonable expectation of success that the combination would improve the enrichment of desired nucleic acids because Vogelstein et al. explicitly taught reducing complexity and enriching desired nucleic acids using capture oligonucleotide array and bridge amplification on solid phase resulting in monoclonal cluster of immobilized population of amplification products (para 0469, 0541) and such a modification is considered obvious over the cited prior art.
B. Claims 17-20 and 24-26 are rejected under 35 U.S.C. 103 as being unpatentable over Kuersten et al. (WO2020/132304) in view of Vogelstein et al. (US 2019/0256924) as applied to claims 1-3, 5-8 and 10 above, and further in view of Grant et al. (US 2017/0360856) and Lowe et al. (Nucleic Acids Research, Vol. 18, No. 7, page 1757-1761, 1990).
Kuersten et al. and Vogelstein et al. teach a method of selecting cDNA library fragments as discussed above. However, Kuersten et al. and Vogelstein et al. did not specifically teach a probe of the pool comprising the sequence of the elected SEQ ID NO: 1.
Grant et al. teach analyzing rRNA genes in bacterial strains wherein a bacterial strain comprises a nucleic acid comprising a sequence of the SEQ ID NO: 1 (para 0111, and following sequence alignment).
For SEQ ID NO:1
Publication No. US20170360856A1
GENERAL INFORMATION: APPLICANT: 4D PHARMA RESEARCH LIMITED; TITLE OF INVENTION: COMPOSITIONS COMPRISING BACTERIAL STRAINS; CURRENT APPLICATION NUMBER: US/15/673,270
CURRENT FILING DATE: 2017-08-09; PRIOR APPLICATION NUMBER: PCT/GB2016/051770; PRIOR FILING DATE: 2016-06-15; PRIOR APPLICATION NUMBER: GB 1606810.8; PRIOR FILING DATE: 2016-04-19;
SEQ ID NO 5; LENGTH: 3415035; TYPE: DNA; ORGANISM: Blautia stercoris; FEATURE: OTHER INFORMATION: strain 830 chromosome;
Query Match 100.0%; Score 50; Length 3415035; Best Local Similarity 100.0%; Matches 50; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CTCATCCCCACCCTTTTCAACGGATGTGGGTTCGGTCCTCCACTGCCTCT 50
||||||||||||||||||||||||||||||||||||||||||||||||||
Db 98274 CTCATCCCCACCCTTTTCAACGGATGTGGGTTCGGTCCTCCACTGCCTCT 98323
Lowe et al. teach a method for designing primers and evaluating their performance wherein Lowe et al. disclose a computer program for rapid selection of oligonucleotide primers/probes for polymerase chain reaction, Lowe et al. teach that all primers/probes designed for over 10 gene products were experimentally tested and the results showed that all the amplification products specified by the primers are of the predicted size and also hybridize with the appropriate cDNA or internal oligonucleotide probe (see page 1759-1760, col. 2, paragraph 1, table 1).
It would be prima facie obvious to an ordinary person skilled in the art before the effective filing date of the invention to modify the method of Kuersten et al. and Vogelstein et al. with the sequence comprising SEQ ID NO:1 as taught by Grant et al. and designing a primer/probe from a known sequence as taught by Lowe et al. to develop an improved method for capturing desired sequences. The ordinary person skilled in the art would have motivated to combine the method of Kuersten et al. and Vogelstein et al. with the known sequence as taught by Grant et al. and generating primer/probe oligonucleotide from a known sequence as taught by Lowe et al. and have a reasonable expectation of success that it would result in improving the specificity of the method because it would be obvious to modify the method of Kuersten et al. and Vogelstein et al. with a method to design primers/ probes from a known sequence as taught by Grant et al. and Lowe et al. to improve the specificity of primers/probe for capturing target nucleic acid in a sample. The claimed primers/probe are functional equivalents of the polynucleotide sequence taught by Grant et al. in view of Lowe et al. because Lowe et al. explicitly taught that the primers/probe generated from a known sequence using a computer program would specifically amplify the target sequence and all primers designed for over 10 gene products from known sequences were experimentally tested and the results showed that all the amplification products specified by the primers are of the predicted size also hybridizes with the appropriate cDNA or internal oligonucleotide probe (see page 1760, col. 2, paragraph 1) and such a modification of the known sequences is considered obvious over the prior art. As noted in In re Aller, 105 USPQ 233 at 235, more particularly, where the general conditions of a claim such as oligomer length and sequence, are disclosed in the prior art (Kuersten et al. and Vogelstein et al., Grant et al. and Lowe et al.), it is not inventive to discover the optimum or workable ranges by routine experimentation. Routine optimization is not considered inventive and no evidence has been presented that the selection of hybridization conditions performed was other than routine, that the products resulting from the optimization have any unexpected properties, or that the results should be considered unexpected in any way as compared to the closest prior art and such a modification of the method is considered obvious over the cited prior art.
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SURYAPRABHA CHUNDURU whose telephone number is (571)272-0783. The examiner can normally be reached 8.00am-4.30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at 571-272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Suryaprabha Chunduru
Primary Examiner
Art Unit 1681
/SURYAPRABHA CHUNDURU/Primary Examiner, Art Unit 1681