Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
1.The Applicant’s response to the office action filed on August 18, 2026 is acknowledged.
Status of the Application
2. Claims 1-23 are pending. The Applicant’s arguments have been fully considered and found unpersuasive for the following reasons.
Claim Rejections - 35 USC § 103-maintained
3. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
A. Claims 1-11, 14-16 and 19-23 are rejected under 35 U.S.C. 103 as being unpatentable over Lloyd et al. (US 2010/0279274) in view of Levin et al. (WO 2020/023630).
Lloyd et al. teach a method of claim 1,4, 14, for extraction-free analysis of nucleic acid comprising: obtaining a sample comprising a bodily fluid and swab sample; contacting the sample with a buffer composition comprising nuclease free water, antimicrobial agents (antifungal and antibiotic) and a RNase inhibitor (para 0012-0022, 0048-0051, 0060-0064);
directly amplifying nucleic acid from the sample in said buffer with primers specific to one or more nucleic acids of one or more sexually transmitted (ST) pathogens without prior extraction of said nucleic acid (para 0066, 0076-0077:
indicating nucleic acid PCR analysis without purification);
analyzing amplicons produced in said amplifying step to detect one or more said pathogens in the subject (0066, 0076-0077).
With reference to claims 2-8, Llody et al. teach mucosal membrane swab comprises one or more one or more vaginal, buccal or nasal swab and bodily fluid comprises saliva, urine, blood plasma or serum (para 0018, 0046, claim 15).
With reference to claims 9-11, Llody et al. teach that the ST pathogen is a virus or bacterium, wherein the pathogens comprise at least one HIV, hepatitis B virus, hepatitis C virus (para 0048).
With reference to claims 15, Llody et al. teach that the nucleic acid is RNA or DNA (para 0048).
With reference to claim 20, Llody et al. teach that buffer composition stabilizes the nucleic acids from the sample (para 0051).
With reference to claims 21, Llody et al. teach that the method further comprises comparing the target nucleic acid quantities in a plurality of samples obtained from the subject at successive time points and determining disease progression based on increases or decreases in the nucleic acid quantities over time (para 0087-0088).
With reference to claims 22-23, Llody et al. teach that the amplicons are derived from an oncogenic virus (HIV) and the nucleic acid comprises a portion of oncogene (para 0087, 0094).
Although Llody et al. teach use of antimicrobial agents, Llody et al. did not specifically
teach composition comprising an antifungal and an antibiotic.
Levin et al. teach a method of claims 1-11, 14-16, 19-23, for collecting and preserving a biological sample for analysis of pathogens in the sample, wherein the method comprises contacting the biological sample with a preservation mixture comprising an antifungal and an antibiotic agent wherein antifungal agent amphotericin and antibiotic comprises penicillin, streptomycin and analyzing nucleic acids by PCR
and sequencing analysis (para 0003-0005, 0007, 00118, 00234).
It would have been prime facie obvious to a person of ordinary skill in the art before the effective filing date of the invention to modify the method as taught by Llody et al. with a buffer comprising an antifungal and an antibiotic as taught by Levin et al. to develop a sensitive method for detecting target nucleic acids in a sample. The ordinary person skilled in the art would have motivated to combine the references to develop a sensitive method for detecting a target nucleic acid because the ordinary
person skilled in the art would have a reasonable expectation of success that the combination of references would result in enhancing the sensitivity of the method because Levin et al. explicitly taught use of a sample buffer comprising amphotericin and penicillin or streptomycin, which prevents microbial growth (para 0003-0005) and such a modification of the method is considered obvious over the cited prior art.
B. Claim 17-18 are rejected under 35 U.S.C. 103 as being unpatentable over Lloyd et al. (US 2010/0279274) in view of Levin et al. (WO 2020/023630) as applied to claims 1-11, 14-16, 19-23 above, and further in view of Mielke et al. ((US 2015/0353919).
Llody et al. and Levin et al. teach a method for extraction-free analysis of nucleic acid as discussed above. However, Llody et al. and Levin et al. did not specifically teach buffer composition comprising reducing agent (TCEP).
Mielke et al. teach method for sample collection, processing and amplification of nucleic acids in the sample, wherein sample buffer comprises reducing agent TCEP (para 0010, 0066, 105-108).
It would have been prime facie obvious to a person of ordinary skill in the art before the effective filing date of the invention to modify the method as taught by Llody et al. and Levin et al. with a buffer comprising reducing agent, amphotericin and penicillin as taught by Mieke et al. to develop a sensitive method for detecting target nucleic acids in a sample. The ordinary person skilled in the art would have motivated to combine the references to develop a sensitive method for detecting a target nucleic acid
because the ordinary person skilled in the art would have a reasonable expectation of success that the combination of references would result in enhancing the sensitivity of the method because Mieke et al. explicitly taught use of a sample buffer comprising TCEP, which would stabilize the nucleic acids in a sample (para 0010, 0066, 105-108) and such a modification of the method is considered obvious over the cited prior art.
C. Claim 12-13 are rejected under 35 U.S.C. 103 as being unpatentable over Lloyd et al. (US 2010/0279274) in view of Levin et al. (WO 2020/023630) as applied to claims 1-11, 14-16, 19-23 above, and further in view of Savelkoul et al. (US 2011/0020796).
Llody et al. and Levin et al. teach a method for extraction-free analysis of nucleic acid as discussed above. However, Llody et al. and Levin et al. did not specifically teach a primer selected from SEQ ID NO. 1, 2, 4 and 5 for amplification.
Savelkoul et al. teach a primer pair for amplifying Chlamydia trachomatis in a sample,
wherein a primer (SEQ ID NO: 2) of the primer pair consists of the sequence of SEQ ID
NO: 4 as claimed (para 0033-0036, see the following sequence alignment).
For SEQ ID NO: 4
Publication No. US20110020796A1
GENERAL INFORMATION
APPLICANT: Vereniging voor christelijk hoger onderwijs,
APPLICANT: wetenschappelijk onderzoek en patientenzorg te Amsterdam
TITLE OF INVENTION: Method for the detection of Chlamidya trachomatis and a kit therefor
FILE REFERENCE: P28659NL00; CURRENT APPLICATION NUMBER:
US/12/525,998; CURRENT FILING DATE:2009-09-01; PRIOR APPLICATION NUMBER: NL1033345; PRIOR FILING DATE: 2007-02-06
SEQ ID NO 2; LENGTH: 23; TYPE: DNA; ORGANISM: Chlamydia trachomatis; Query Match 100.0%; Score 23; Length 23; Best Local Similarity 100.0%; Matches 23; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGATTGACTCCGACAACGTATTC 23
|||||||||||||||||||||||
Db 1 GGATTGACTCCGACAACGTATTC 23
It would have been prime facie obvious to a person of ordinary skill in the art before the effective filing date of the invention to modify the method as taught by Llody et al. and Levin et al. with a primer for amplifying Chlamydia pathogen as taught by Savelkoul et al. to develop a sensitive method for detecting target nucleic acids in a sample. The ordinary person skilled in the art would have motivated to combine the references to develop a sensitive method for detecting a target nucleic acid because the ordinary person skilled in the art would have a reasonable expectation of success that the combination of references would result in enhancing the specificity of the method because Savelkoul et al. explicitly taught use of a primer for amplifying and detecting chlamydia trachomatis (para 0033-0036) and such a modification of the method is considered obvious over the cited prior art.
Response to Arguments:
A. With reference to the rejection of claims 1-11, 14-16 and 19-23 under 35 USC 103 as being obvious over Lloyd et al. in view of Levin et al., the Applicant’s arguments have been fully considered and found unpersuasive. With reference to the Applicant’s arguments drawn to Lloyd et al. teach a dried sample and Lloyd et al. does not teach a buffer as claimed, the arguments have been found unpersuasive. As discussed in the rejection, the Examiner cited portions (para 0012, 0022, 0048-0051, 0061-0062) teach liquid samples in a swab (matrix) not a dried sample as asserted by the Applicant, Further, Lloyd et al. teach applying a buffer comprising nuclease free water, antimicrobial agent and RNase inhibitor to said matrix, wherein the buffered is phosphate buffered saline or nuclease free water (para 0062). With reference to no teaching of direct amplification by Lloyd et al., the arguments have been fully considered and found unpersuasive because the examiner cited portions (para 0066) teaches that the sample is analyzed with or without prior nucleic acid extraction, purification or isolation, wherein the analysis comprises amplification, which is within the scope of the claims as presented. As discussed in the rejection, Lloyd et al. teach use of antimicrobial agent, the broader scope of antimicrobial agent which reads on both antibacterial and antifungal agents. However, as discussed in the rejection it would be obvious to include antibacterial and antifungal agents as taught by Levin et al. to improve the method for nucleic acid analysis. With reference to Applicant’s arguments attacking references individually, as is noted in MPEP 2145-IV One cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., Inc., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). In the instant context, the rejection is based on a combination of references and as discussed in the rejection it would be obvious to modify the antimicrobial agent with a combination of an antibiotic and antifungal agent as taught by Levin would be obvious over the claims as presented. For all the above, the rejection has been maintained.
B. With reference to the rejection of claims 17-18, under 35 USC 103 as being obvious over Lloyd et al. in view of Levine et al., further in view of Mielke et al., the Applicant’s arguments haven been fully considered and found unpersuasive. As discussed above, Lloyd et al. and Levine et al. teach the method of claim 1 and as discussed in the rejection it would be obvious to modify the buffer composition with a reducing agent to improve the method. For all the above, the rejection has been maintained.
C. With reference to the rejection of claims 12-13, the Applicant’s arguments drawn to Savelkoul et al. have been found unpersuasive because Savelkoul et al. teach a primer as claimed in clam 13 and it would be obvious to modify the method of Lloyd et al. and Levine with a primer to amplify CT as taught by Savelkoul et al. For all the above the rejection has been maintained.
Double Patenting-Maintained
4. The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-23 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim of U.S. Patent No. 12,680,130 (hereafter the ‘130) in view of Savelkoul et al. (US 2011/0020796). Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims 1-23 are entirely within the scope of the claims 1-19 of the patent ‘130. Specifically, the method steps for detecting one or more target nucleic acids in an extraction-free sample amplification analysis of the claims 1-23 are within the scope of the claims 1-19 in the patent ‘130. The claims in the patent ‘130 disclose detecting a pathogen. However, the claims in the patent ‘130 do not teach said pathogen as ST pathogen.
Savelkoul et al. teach a method for detecting Chlamydia trachomatis (ST pathogen) using a primer pair for amplifying Chlamydia trachomatis in a sample and detecting said pathogen, wherein a primer of the primer pair comprises a primer sequence comprising the sequence of SEQ ID NO: 4 as claimed (para 0033-0036).
It would have been prime facie obvious to a person of ordinary skill in the art before the effective filing date of the invention to modify the method of the claims in the patent ‘130 with detection of ST pathogens as taught by Savelkoul et al. to develop a sensitive method for detecting target nucleic acids in a sample. The ordinary person skilled in the art would have motivated to combine the references to develop a sensitive method for detecting target nucleic acids because the ordinary person skilled in the art would have a reasonable expectation of success that the combination of references would result in enhancing the sensitivity of the method because Savelkoul et al. explicitly taught detecting one or more ST pathogens (0033- 0036) and such a modification of the method is considered obvious over the cited prior art.
Response to Arguments:
The rejection of claims under obviousness type of double patenting over claims in co-pending application 17/864,160 (now US patent 12,680,130) in view of Savelkoul et al. has been maintained and restated to include the patented claims because the claims remain within the scope of the claims in the patent and no terminal disclaimer has been submitted.
Conclusion
No claims are allowed.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SURYAPRABHA CHUNDURU whose telephone number is (571)272-0783. The examiner can normally be reached 8.00am-4.30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at 571-272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Suryaprabha Chunduru
Primary Examiner
Art Unit 1681
/SURYAPRABHA CHUNDURU/Primary Examiner, Art Unit 1681
