Prosecution Insights
Last updated: October 02, 2026
Application No. 17/985,970

METHODS AND COMPOSITIONS FOR THE ADAR-MEDIATED EDITING OF METHYL-CPG BINDING PROTEIN 2 (MECP2)

Non-Final OA §102§103§112
Filed
Nov 14, 2022
Priority
May 15, 2020 — provisional 63/025,361 +1 more
Examiner
LIPPOLIS, ALEXANDRA ROSE
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Korro Bio Inc.
OA Round
1 (Non-Final)
47%
Grant Probability
Moderate
1-2
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 47% of resolved cases
47%
Career Allowance Rate
15 granted / 32 resolved
-13.1% vs TC avg
Strong +59% interview lift
Without
With
+59.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 11m
Avg Prosecution
56 currently pending
Career history
95
Total Applications
across all art units

Statute-Specific Performance

§101
5.7%
-34.3% vs TC avg
§103
42.9%
+2.9% vs TC avg
§102
18.4%
-21.6% vs TC avg
§112
26.4%
-13.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 32 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Acknowledgment is made of applicant’s claim for priority based on a provisional application filed as 63/025,361 on 05/15/2020. All claims are given the priority date of 05/15/2020. Application Status Receipt is acknowledged of amendment, filed 05/18/2023. Claims 1, 3, 10, 11, 14-17, 19, 20, 28, 103, 107, 129, 138, 145 and 147 are currently pending. Election/Restriction Applicant’s election without traverse of SEQ ID NO: 63 as the guide oligonucleotide to induce a premature stop codon within a MECP2 gene at position 255 in the reply filed on 04/13/2026 is acknowledged. However, the election required the election of the sequence of the MECP2 gene which would be targeted by the guide oligonucleotide to comprise the premature stop codon. The instant specification identifies SEQ ID NO: 57 and GenBank Accession number NM_004992 as the MECP2 nucleotide sequence (which corresponds to NCBI Accession number NP_004983 as the amino acid sequence) that would be targeted for the introduction of a stop codon at any one of the positions (Page 17, Line 13 bridging Page 18, Line 9). Claims 1, 3, 10, 11, 14-17, 19, 20, 28, 103, 107, 129, 138, 145 and 147 are currently under examination. Information Disclosure Statement Receipt of acknowledgment of the information disclosure statements filed on 05/18/2023 and 01/23/2024 have been received and all references have been considered. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 16 and 17 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 16 is vague and indefinite in that the metes and bounds of the phrase “a MECP2 protein comprising a pathogenic amino acid comprising a premature stop codon at positions 255, 168, 298 and/or 270, resulting from the SNP” are unclear. The phrase is unclear in that the sequence in which the sequence that the positions of 255, 168, 298 and 270 correspond to is not provided and therefore, unknown. It would be remedial to amend the claims to include the amino acid sequence of the MECP2 gene in which the amino acid positions correspond too. Claim 17 is vague and indefinite in that the metes and bounds of the phrase “the adenosine to inosine alteration substitutes the pathogenic amino acid with a wild-type amino acid, wherein the wild type amino acid at positions 255, 168, 294 and/or 270 is an arginine” are unclear. The phrase is unclear in that the sequence in which the sequence that the positions of 255, 168, 298 and 270 correspond to is not provided and therefore, unknown. It would be remedial to amend the claims to include the amino acid sequence of the MECP2 gene in which the amino acid positions correspond too. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1, 3, 10, 11, 14 and 15 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Sinnamon et al (Proc Natl Acad Sci U S A. 2017 Oct 31;114(44): E9395-E9402) as evidenced by NM_oo4992.3(MECP2):c.316C> T (p.Arg106Trp) AND Rett syndrome (NCBI GenBank Accession Numbers NM_004992.3 and NP_004983.1 www.ncbi.nlm.nih.gov/clinvar/RCV000012585.29/; Pgs. 1/3-3/3 (2018)). Regarding claims 1 and 10, Sinnamon teaches Rett syndrome (RTT) is a debilitating neurological disorder caused by mutations in the gene encoding the transcription factor Methyl CpG Binding Protein 2 (MECP2) and the successful use of site-directed RNA editing to repair an endogenous mRNA and restore protein function in vivo applications to treat RTT (Page E9395, Abstract). Sinnamon teaches using the ADAR2 domain, tagged with a nuclear localization signal, fused to an RNA binding peptide from bacteriophage lambda as well as a guide RNA for targeting a specific SNP within the MECP2 gene as a method of treating Rett Syndrome within N2A neuroblastoma cells (Page E9395, Abstract and Page E9397, Fig. 1). Sinnamon teaches the SNP targeted as R106Q which is confirmed by the NCBI cited as evidence (NCBI GenBank Accession Number NM_004992.3; Pgs. 1/3-3/3). Regarding claim 3, Sinnamon teaches endogenous expression of ADAR1 and ADAR2 of N2A cells (Page E9395, Column 2). Regarding claims 11, 14 and 15, Sinnamon teaches Rett syndrome (RTT) is a debilitating neurological disorder caused by mutations in the gene encoding the transcription factor Methyl CpG Binding Protein 2 (MECP2) and the successful use of site-directed RNA editing to repair an endogenous mRNA and restore protein function in vivo applications to treat RTT (Page E9395, Abstract). Sinnamon teaches using the ADAR2 domain, tagged with a nuclear localization signal, fused to an RNA binding peptide from bacteriophage lambda as well as a guide RNA for targeting a specific SNP within the MECP2 gene as a method of treating Rett Syndrome within N2A neuroblastoma cells (Page E9395, Abstract and Page E9397, Fig. 1). Sinnamon teaches the SNP targeted as R106Q which is confirmed by the NCBI cited as evidence (NCBI GenBank Accession Number NM_004992.3; Pgs. 1/3-3/3). Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1, 3, 10, 11, 14-17, 19, 20, 28, 129, 138 and 145 are rejected under 35 U.S.C. 103 as being unpatentable over Bryson et al (WO 2019/217944 A1) in view of Fry et al (Int. J. Mol. Sci. Jan 21st, 2020, 21(3), 777; Pages 1-20). Regarding claims 1 and 3, Bryson teaches treating Rett Syndrome using an adenosine (A) base editor (ABE) to precisely correct a single nucleotide polymorphism in the endogenous Mecp2 gene to correct a deleterious mutation (e.g., R133C, Tl58M, R255*, R270*, R306C) [0006]. Bryson teaches a method of editing an MECP2 polynucleotide containing a single nucleotide polymorphism (SNP) associated with Rett Syndrome (RTT), the method involving contacting the MECP2 polynucleotide with a base editor in complex with one or more guide polynucleotides, where the base editor includes a polynucleotide programmable DNA binding domain and an adenosine deaminase domain, and where one or more of the guide polynucleotides target the base editor to effect an A•T to G•C alteration of the SNP associated with RTT [0007]. Bryson teaches that the adenosine deaminase of the invention comprises an ADAR (e.g. ADAR1 or ADAR2) [0264]. Bryson teaches the composition is administration to HEK293T cells [0471]. Bryson does not teach that ADAR is the endogenously expressed ADAR from the HEK293T cell. Fry teaches endogenous ADAR recruitment using long LEAPER-arRNAs and G-A mismatches within the guide region to reduce off-target editing (Page 6, Fig. 3 description). Fry teaches the use of endogenous ADAR and guide RNAs of HEK293 cells for the repair of premature stop codons (Page 8, Paragraphs 3-4). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the teachings of Bryson to include the use of the endogenous ADAR of the HEK293 cell as taught by Fry because Bryson teaches it is within the ordinary skill in the art to use treating Rett Syndrome by editing the R255 SNP mutation within the MECP2 gene using a guide RNA Cas9 system as well as an adenosine base editor, specifically comprising an ADAR and Fry teaches the use of endogenous ADAR and guide RNAs of HEK293 cells for the repair of premature stop codons. One would have been motivated to make such a modification in order to receive the expected benefit of using endogenous ADAR to reduce off-target editing and repair of premature stop codons within HEK293 cells as taught by Fry. Regarding claims 10 and 11, Bryson teaches treating Rett Syndrome using an adenosine (A) base editor (ABE) to precisely correct a single nucleotide polymorphism in the endogenous Mecp2 gene to correct a deleterious mutation (e.g., R133C, Tl58M, R255*, R270*, R306C) [0006]. Bryson teaches a method of editing an MECP2 polynucleotide containing a single nucleotide polymorphism (SNP) associated with Rett Syndrome (RTT), the method involving contacting the MECP2 polynucleotide with a base editor in complex with one or more guide polynucleotides, where the base editor includes a polynucleotide programmable DNA binding domain and an adenosine deaminase domain, and where one or more of the guide polynucleotides target the base editor to effect an A•T to G•C alteration of the SNP associated with RTT [0007]. Bryson teaches that the adenosine deaminase of the invention comprises an ADAR (e.g. ADAR1 or ADAR2) [0264]. Bryson teaches the composition is administration to HEK293T cells [0471]. Bryson teaches cells are removed from a subject and contacted ex vivo with a pharmaceutical composition are re-introduced into the subject, optionally after the desired genomic modification has been effected or detected in the cells [0443]. Regarding claims 14 and 15, Bryson teaches R255X was targeted using a gRNA comprising the nucleic acid sequence CUUUUCACUUCCUGCCGGGG, which targets the base editor to the nucleic acid sequence CTTTTCACTTCCTGCCGGGG comprising the RTT mutation 763C>T (R255X) [0452]. Bryson teaches a method of editing an MECP2 polynucleotide containing a single nucleotide polymorphism (SNP) associated with Rett Syndrome (RTT), the method involving contacting the MECP2 polynucleotide with a base editor in complex with one or more guide polynucleotides, where the base editor includes a polynucleotide programmable DNA binding domain and an adenosine deaminase domain, and where one or more of the guide polynucleotides target the base editor to effect an A•T to G•C alteration of the SNP associated with RTT [0007]. Bryson teaches that the adenosine deaminase of the invention comprises an ADAR (e.g. ADAR1 or ADAR2) [0264]. Regarding claims 16 and 17, the claim is interpreted that the pathogenic amino acid at positions 255, 168, 294 and/or 270 as well as the wild type amino acid at those positions is an arginine corresponds to the amino acid sequence found in NCBI GenBank Accession number NP_004983.1 or the sequence of SEQ ID NO: 57 translated to the protein sequence (See Appendices I-II showing the GenBank accession numbers comprising the nucleic acid and translated amino acid sequence for the MECP2 gene). Bryson teaches the A•T to G•C alteration at the SNP associated with RTT changes a cysteine to an arginine, methionine to a threonine, or stop codon to arginine in the methyl CpG binding protein 2 (MeCP2) polypeptide [0012]. Bryson teaches the targeting of an Mecp2 protein (NCBI Accession number NP_004983) associated with RTT comprises one or more mutations selected from Rl06W, Rl68*, Rl33C, Tl58M, R255*, R270*, and R306C [0041]. Regarding claim 19, Bryson teaches R255X was targeted using a gRNA comprising the nucleic acid sequence CUUUUCACUUCCUGCCGGGG, which targets the base editor to the nucleic acid sequence CTTTTCACTTCCTGCCGGGG comprising the RTT mutation 763C>T (R255X) [0452]. Regarding claims 20, 28, 129, 138 and 145, Bryson teaches R255X was targeted using a gRNA comprising the nucleic acid sequence CUUUUCACUUCCUGCCGGGG, which targets the base editor to the nucleic acid sequence CTTTTCACTTCCTGCCGGGG comprising the RTT mutation 763C>T (R255X) [0452]. Bryson teaches the guide RNA is modified as a 2’-O-Methyl RNA [0215]. Therefore, the guide RNA of Bryson would have the same structure as instant formula I. Bryson teaches the guide RNA with a modification of internucleotide linkage using phosphorothioate (PS) bond substitutes that can be more stable towards hydrolysis by cellular degradation [0217]. Bryson teaches phosphorothioate (PS) bonds introduced between the last 3-5 nucleotides at the 5' - or "-end of a gRNA can inhibit exonuclease degradation [0217]. Claims 103, 107, and 147 are rejected under 35 U.S.C. 103 as being unpatentable over Bryson et al (WO 2019/217944 A1) in view of Fry et al (Int. J. Mol. Sci. Jan 21st, 2020, 21(3), 777; Pages 1-20) as applied to claims 1, 3, 10, 11, 14-17, 19, 20, 28, 129, 138 and 145 above, and further in view of Fisher et al (European Journal of Pharmacology 606 (2009) 38–44). The teachings of Bryson and Fry are as described and applied above. Regarding claims 103, 107 and 147, Bryson teaches R255X was targeted using a gRNA comprising the nucleic acid sequence CUUUUCACUUCCUGCCGGGG, which targets the base editor to the nucleic acid sequence CTTTTCACTTCCTGCCGGGG comprising the RTT mutation 763C>T (R255X) [0452]. Bryson teaches the guide RNA is modified as a 2’-O-Methyl RNA [0215]. Therefore, the guide RNA of Bryson would have the same structure as instant formula I. Bryson teaches the guide RNA with a modification of internucleotide linkage using phosphorothioate (PS) bond substitutes that can be more stable towards hydrolysis by cellular degradation [0217]. Bryson teaches phosphorothioate (PS) bonds introduced between the last 3-5 nucleotides at the 5' - or "-end of a gRNA can inhibit exonuclease degradation [0217]. Bryson and Fry do not teach the formula of XIII wherein the backbone comprises hexitol nucleic acids. Fisher teaches replacing the pentose ring of RNA with six carbon moieties forming altritol, cyclohexenyl, or hexitol nucleic acids (Page 38, Column 1). Fisher teaches the hexitol nucleic acid structure (HNA) as a six-carbon ring structure as shown in figure 1A (Page 40), thus the structure of formula XIII. Fisher teaches hexitol modifications of B-Raf siRNAs are well tolerated at 3' sites of sense and antisense strands, as expected, but also at sites adjacent to the position on the antisense strand where mRNA cleavage takes place, showing that the hexitol modifications can be used relatively freely in siRNAs (Page 42, Column 2 and Page 44, Column 1). Fisher teaches provided substantial improvements in effect over unmodified B-Raf siRNAs, such as increased duration, improved thermodynamic stability and protection against nuclease cleavage (Page 42, Column 2 and Page 44, Column 1). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the teachings of Bryson and Fry to include the hexitol nucleic acid structure of a six-carbon ring as taught by Fisher for the natural pentose ring of RNA backbone because Bryson teaches it is within the ordinary skill in the art to use treating Rett Syndrome by editing the R255 SNP mutation within the MECP2 gene using a guide RNA Cas9 system as well as an adenosine base editor, specifically comprising an ADAR, Fry teaches the use of endogenous ADAR and guide RNAs of HEK293 cells for the repair of premature stop codons and Fisher teaches replacing the pentose ring of RNA with six carbon moieties forming a hexitol nucleic acids for use in siRNA to target genes. One would have been motivated to make such a modification in order to receive the expected benefit of improved thermodynamic stability and protection against nuclease cleavage as taught by Fisher. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA ROSE LIPPOLIS whose telephone number is (703)756-5450. The examiner can normally be reached Monday-Friday, 8:00am to 5:00pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ALEXANDRA ROSE LIPPOLIS/Examiner, Art Unit 1637 /CELINE X QIAN/Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Nov 14, 2022
Application Filed
Jun 16, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12746294
AAV DELIVERY OF NUCLEOBASE EDITORS
4y 10m to grant Granted Sep 29, 2026
Patent 12736531
METHOD FOR DETECTING VIRUS USING SSDNA FUNCTIONALIZED SENSOR
4y 4m to grant Granted Sep 15, 2026
Patent 12692500
Aptamers and use thereof
4y 11m to grant Granted Jul 28, 2026
Patent 12599637
A GENETICALLY MODIFIED LACTOBACILLUS AND USES THEREOF
4y 8m to grant Granted Apr 14, 2026
Patent 12600958
METHODS AND COMPOSITIONS FOR MANUFACTURING POLYNUCLEOTIDES
4y 4m to grant Granted Apr 14, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
47%
Grant Probability
99%
With Interview (+59.0%)
3y 11m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 32 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month