Prosecution Insights
Last updated: April 19, 2026
Application No. 17/995,568

COMPOSITIONS AND METHODS FOR SILENCING MYOC EXPRESSION

Non-Final OA §101§103§112
Filed
Oct 05, 2022
Examiner
MEYERING, SHABANA SHABBEER
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Alnylam Pharmaceuticals, Inc.
OA Round
1 (Non-Final)
70%
Grant Probability
Favorable
1-2
OA Rounds
2y 3m
To Grant
99%
With Interview

Examiner Intelligence

Grants 70% — above average
70%
Career Allow Rate
39 granted / 56 resolved
+9.6% vs TC avg
Strong +40% interview lift
Without
With
+40.5%
Interview Lift
resolved cases with interview
Typical timeline
2y 3m
Avg Prosecution
50 currently pending
Career history
106
Total Applications
across all art units

Statute-Specific Performance

§101
5.8%
-34.2% vs TC avg
§103
34.0%
-6.0% vs TC avg
§102
10.4%
-29.6% vs TC avg
§112
33.1%
-6.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 56 resolved cases

Office Action

§101 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Amendments The Office Action is in response to amendment filed Sept 15, 2025, in which some claims were amended, no claims were cancelled, and new claim 38 was added, is acknowledged and entered. The amendments were entered. Election/Restrictions Applicant’s election without traverse of Group I (claims 1-3, 11-12, 15, 20, 22, and 24-25) drawn to a dsRNA for inhibiting MYOC, wherein each strand comprises at least 15 contiguous nucleobases, wherein at least one nucleotide is modified; wherein at least one strand is conjugated to a lipophilic moiety; at least one strand comprises a 3’ overhang of at least 2 nucleotides; comprising a targeting ligand; and the antisense strand comprises a phosphate or phosphate mimic at the 5’ end; a cell containing the dsRNA; and a pharmaceutical composition comprising the dsRNA composition in the reply filed on Sept 15, 2025 is acknowledged. The elected group has been extended to include new claim 38. Claims 26-31, 33, and 35-37 withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Group, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on Sept 15, 2025. Additionally, Applicant’s election with traverse of the following Species: I. SEQ ID NO: 1617; II. SEQ ID NO: 1482. in the same reply is also acknowledged. Applicants traversal is based on the fact that all species substantially overlap with each other and the target region of the MYOC mRNA transcript. Examiner confirms that all of the species SEQ ID NO: 1616 – 1619 have a major portion that is identical as shown here in bold within SEQ ID NO: 1617: 1 UGCCAAAGUGUCCAAAUUCCACG 23; SEQ ID NO: 1346 – 1349 are modified versions of these recited sequences. Accordingly, SEQ ID NO: 1481 – 1484 and 1211 – 1214 are the corresponding (complementary) sense strands. Therefore, in light of the arguments and Examiners further consideration, the requirement for election of a single species from each species group is withdrawn; Examiner extended the search to include all the sequences recited in the amendment of Sept 15, 2025, as this addition would not present a search burden. The requirement for election of a single species from each species is hereby removed. Accordingly, claims 1-3, 11-12, 15, 20, 22, 24-25, and 38 are under examination. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 3 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 3 recites the limitation "iRNA" in the double-stranded iRNA agent in the last para of 1st page of claims. There is insufficient antecedent basis for this limitation in the claim. Claim 1, from which claim 3 depends does not recite the term iRNA rather only dsRNA agent for inhibiting… Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Section 33(a) of the America Invents Act reads as follows: Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism. Claim 24 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101). Claim 24 recites “ a cell containing the dsRNA agent of claim 1. The claim is interpreted to read on a human organism because “a cell containing…” could be encompassed within a human. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-3, 11-12, 15, 20, 22, 24-25, and 38 are rejected under 35 U.S.C. 103 as being unpatentable over US 20220125823 (of filing date 2019-05-07, hereafter “Manoharan”) in view of Naito et al. (US 20080113351). Claim Interpretation: The claimed product is directed to a dsRNA molecule comprising a sense strand that is the mRNA sequence of myocilin and an antisense strand that is complementary to the sense strand (forming a double stranded region), wherein the strands comprise at least 15 contiguous nucleotides, with 0, 1, 2, or 3 mismatches to sequences SEQ ID NO: 1482, 1484, 1483, or 1481, and SEQ ID NO: 1617, 1619, 1618, or 1616, respectively, and modified equivalents of these sequences. One of skill knows that the sense strand is also the sequence of the DNA target region. Since the sequences are recited in the alternative (recitation of sequences includes “or”) only one antisense sequence and its corresponding sense sequence are being considered for rejections of claims 1-3, 11-12, 15, 20, 22, and 24-25. Manoharan teaches improved siRNAs that target difficult to reach areas such as the retina [0003]. Manoharan further teaches such improved siRNAs are double-stranded iRNA agents comprising an antisense strand complementary to a target gene and an sense strand complementary to the antisense strand [0061]. Regarding claim 1, Manoharan teaches a double-stranded iRNA agent that targets MYOC for glaucoma [0724] wherein the sense strand is 21 nucleotides in length [0354]; the antisense strand has a length of 23 nucleotides [0385], [0034]; mismatches can be included [0209], [0234]. Regarding claim 2, Manoharan teaches lipophilic moieties are conjugated to double-stranded iRNAs (abstract). The lipophilic moiety is an aliphatic, cyclic such as alicyclic, or polycyclic such as polyalicyclic compound [0009]. Regarding claim 3, Manoharan teaches wherein the sense strand or antisense strand can include a lipophilic moiety that can be a saturated or unsaturated hydrocarbon, including a C16 moiety (e.g., see [0080 - 0082], Fig. 10 – 12, etc.). Manahoran teaches that a carrier can be incorporated into an internal position of the backbone to which the lipophilic moiety is conjugated wherein the carrier replaces one or more nucleotide(s) (e.g., abstract, [0006], [0017]). Manoharan teaches the lipophilic moiety may be conjugated to the iRNA agent via a direct attachment to the ribosugar of the iRNA agent (e.g., [0012]). Manoharan teaches that the iRNA can comprise a monomer in which the ribose moiety has been replaced by another moiety other than ribose, and can be used to attach a ligand such as a lipophilic moiety directly or indirectly to the iRNA agent via a tether that includes a cleavable linker (e.g., see [0013], [0015], [0150]). Manoharan teaches that the cleavable linker can be a bio-cleavable linker that can be a disulfide group (e.g., [0139]). Manoharan teaches that the lipophilic moiety can be attached to the double-stranded iRNA agent via a linker a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide linkage, a product of a click reaction (e.g., a triazole from the azide-alkyne cycloaddition), or carbamate. ([0014]). Regarding claims 11 - 12, Manoharan further teaches: wherein the sense strand or antisense strand can include any of the modifications described therein and wherein the antisense strand may include modifications such that less than 12, less than 10…less than 2 are modified (e.g., see paragraph [0055]). Manoharan also teaches that the modifications can be non-natural nucleotides. Examples of non-natural nucleotide include acyclic nucleotides, LNA, HNA, CeNA, 2′-O-methoxyalkyl (e.g., 2′-O-methoxymethyl, 2′-O-methoxyethyl, or 2′-O-2-methoxypropanyl), 2′-O-allyl, 2′-C-allyl, 2′-fluoro, 2′-O—N-methylacetamido (2′-O—NMA), a 2′-O-dimethylaminoethoxyethyl (2′-O-DMAEOE), 2′-O-aminopropyl (2′-O-AP), 2′-ara-F, L-nucleoside modification (such as 2′-modified L-nucleoside, e.g., 2′-deoxy-L-nucleoside), BNA abasic sugar, abasic cyclic and open-chain alkyl (see [0057]). Manoharan teaches that the both the sense and the antisense strands of the iRNA are preferably 19 to 21 nucleotides in length (see [0527]-[0528]). Regarding claim 15, Manoharan teaches the iRNA agent can comprise a single stranded overhang of 1 – 10 nucleotides on at least one of the termini (e.g., [0035]); the sense and antisense strands of the double-stranded iRNA agent are each 15 to 30 nucleotides in length [0032] and 5′-end methylphosphonate internucleotide linkage modification [0297] – [0298]. Regarding claim 20, Manoharan teaches the iRNA agent comprises a targeting ligand [0357] which includes one for the retina (e.g., [0676], [ 0733]) and other areas within the CNS and ocular tissue. Regarding claim 22, Manoharan teaches the iRNA agent also comprises a phosphate mimic such as 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof ([0298], [0306]). Regarding claim 24, Manoharan teaches contacting a cell with the double-stranded iRNA agent of the invention such as an extraheptic cell [0893]. Regarding claim 25, Manoharan teaches pharmaceutical compositions for the iRNA agent of claim 1 (e.g., [0874] – [0877]). Manoharan does not teach the SEQ ID Nos recited in claim 1. However, before the effective filing date of instant invention, Naito teaches MYOC target region comprising SEQ ID NO: 291959 (background and sequence listing). Naito further teaches rules for siRNA double-stranded oligonucleotides which are: dsRNA wherein the oligonucleotides should be between 13-28 nucleobases and specifically directed to a target gene, and further wherein 10 or more bases of guanine or cytosine are not continuously contained in the oligonucleotide, which further comprises a sequence sharing at least 80% homology with the target sequence that is not contained in the base sequences of other gene sequences of a selected target organism from which the target gene is derived (claims 1, 13). Naito teaches 3’-end overhangs at each end of the dsRNA oligo (Fig.1). Naito also discloses the RefSeq gene for MYOC and the positions on it selected for targeting (NM_000261.1,633-651). See select recitation from para [0109]: The number of bases in each strand, including the overhanging portion, is 18 to 24, more preferably 20 to 22, and particularly preferably 21. The number of bases in the overhanging portion is preferably 2. siRNA having 21 bases in total in which the overhanging portion is composed of 2 bases is suitable for causing RNA interference with high probability without causing cytotoxicity even in mammals. See sequence matching instant sequence SEQ Id NO: 1617: CURRENT APPLICATION NUMBER: US/11/598,052B CURRENT FILING DATE: 2006-11-13 PRIOR APPLICATION NUMBER: PCT/IB2005/00164 PRIOR FILING DATE: 2005-05-11 PRIOR APPLICATION NUMBER: JP 2004-232811 PRIOR FILING DATE: 2004-05-11 NUMBER OF SEQ ID NOS: 817670 SEQ ID NO 291959 LENGTH: 19 TYPE: DNA ORGANISM: Homo sapiens FEATURE: OTHER INFORMATION: siRNA target sequence for MYOC (NM_000261.1,633-651). Query Match 82.6%; Score 19; Length 19; Score over Length 100.0%; Best Local Similarity 78.9%; Matches 15; Conservative 4; Mismatches 0; Indels 0; Gaps 0; Qy 5 AAAGUGUCCAAAUUCCACG 23 ||||:|:|||||::||||| Db 19 AAAGTGTCCAAATTCCACG 1 Naito does not teach the complete structure of a dsRNA that targets MYOC from all the disclosed rules. It would have been obvious to make a dsRNA so that it may function in inhibiting expression of myocilin gene, using the guidelines as taught by Manoharan et al. and Naito et al., using the target sequence as taught by Naito and arrive at an antisense and sense pair of oligonucleotides wherein the pair comprises SEQ ID NO: 1616 and 1482 targeted to the myocilin gene. One of ordinary skill in the art would have been motivated to make the combination for the advantage of inhibiting myocilin because it was known that myocilin expression is upregulated in retinal tissue and associated with glaucoma, as evidenced by Manoharan et al., “The combination of familiar elements according to known methods is likely to be obvious when it does no more than yield predictable results.” See KSR v. Teleflex, 550 U.S., 127 S. Ct. 1727 (2007). See MPEP 2143 I A. Finally, one of ordinary skill in the art would have had a reasonable expectation of success at generating a dsRNA comprising SEQ ID NO: 1617 and 1482 because both Manoharan and Naito teach a method of designing a iRNA and in view of the guidelines it would generate the instant dsRNA sequences as preferable sense and antisense to use to target the myocilin target sequence. Thus, Manoharan in view of Naito make obvious instant claims 1-3,11-12,15,20,22,24-25. Regarding claim 38, a dsRNA for inhibiting expression of myocilin is made obvious by Manoharan and Naito as discussed above for SEQ ID NO: 1617 and its complementary sense sequence SEQ ID NO: 1482. The other sequences recited are also within the same target region taught by Naito (bolded below): SEQ ID NO: 1616 u ccaaaguguccaaauucca cgu SEQ ID NO: 1617 ug ccaaaguguccaaauucca cg SEQ ID NO: 1618 ugg ccaaaguguccaaauucca c SEQ ID NO: 1619 uagg ccaaaguguccaaauucca The modified sequences of SEQ ID NO: 1616 – 1619 are 1346 – 1349; wherein the latter are: SEQ ID NO 1346: VPusCfscaa AfgUfGfucca AfaUfuccacs Gsu SEQ ID NO 1347: VPusGfscca AfaGfUfgucc AfaAfuuccas Csg SEQ ID NO 1348: VPusGfsgcc AfaAfGfuguc CfaAfauuccs Asc SEQ ID NO 1349: VPusAfsggc CfaAf Af gugu CfcAfaauucs csa The abbreviations listed on these sequences are modifications as per Table 1 of the specification; e.g., s= phosphorothioate linkage. Neither Manoharan nor Naito teach a dsRNA comprising each of the recited sequences. However, Manoharan’s teaching were discussed supra. These included length and chemical modifications. Following this guidance, the designed sequences are further optimized for efficient delivery of the dsRNA agent to cells in vivo by specific targeting linkers and substantial protection from the extracellular environment by specific modifications at specific nucleotide positions. While the whole patent is of substantial value in providing these teachings, particularly important are: [0041] - [0048], [0055] - [0060], [0260], [0268] ,[0298], [0311], [0313]. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to try to make an antisense sequence sufficiently similar to Applicant' s SEQ ID NO: 1617 as taught by Manoharan and Naito ensuring the target region of MYOC taught by Naito is kept, and further modify as taught by Manoharan. Before the effective filing date of Applicant' s invention, Manoharan provided sufficient guidance and motivation to target MYOC with a modified dsRNA oligomer comprising sense and antisense strands as discussed for claim 1. Specifically, Manoharan taught a design need for nucleic acid sequences which can influence target gene expression inhibition. dsRNA targeting systems rely on a finite number of identified parameters such as target length, limited RNA nucleotides, combinations of nucleotides, and nucleotide length between 15 and 30 nucleotides but ideally, the sense and antisense strands of the dsRNA agent are each 21 to 23 nucleotides in length [0034]. Thus, with these parameters and Naito’s taught target sequence there are only a finite number of identified, predictable sequences and modifications at precise positions that can be obtained. In fact, there are only an extremely small and finite number of possible solutions. It would have been obvious to make sense and antisense sequences with modifications given the target region with a measured and predictable outcome and “test” these sequences for use or to further narrow the choice down to optimal candidates. The skilled artisan would have had a reasonable expectation of success in doing so because the skilled artisan would be operating under conditions thoroughly discussed and vetted by the applied references. See MPEP 2143 I (E). Further, it is a settled principle of law that a mere carrying forward of an original patented conception involving only change of form, proportions, or degree, or the substitution of equivalents doing the same thing as the original invention, by substantially the same means, is not such an invention as will sustain a patent, even though the changes of the kind may produce better results than prior inventions. Thus, Manoharan in view of Naito make obvious instant claim 38. Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art at the time the invention was made. Relevant Prior Art Not relied Upon The closest prior art is applied above. The following art is made note of and not currently relied on, but is relevant to applicant’s invention. Aznarez et al (US 11096956 B2) have taught different antisense oligomers useful for many diseases, for example: Certain diseases affecting eye function are associated with a deficiency in the expression of a gene, and in turn, a deficiency in the gene product. Examples of gene products for which increased expression can provide benefit in eye diseases or conditions include MYOC (10). One such sequence is shown below that corresponds to instant SEQ Id NO: 1617. Modifications to the nucleotides will result in modified sequences that are disclosed in instant application. Aznarez do not specifically teach the antisense oligomer is a dsRNA. NUMBER OF SEQ ID NOS: 150766 SEQ ID NO 36647 LENGTH: 18 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide Query Match 78.3%; Score 18; Length 18; Score over Length 100.0%; Best Local Similarity 100.0%; Matches 18; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 2 GCCAAAGUGUCCAAAUUC 19 |||||||||||||||||| Db 1 GCCAAAGUGUCCAAAUUC 18 Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /SHABANA S MEYERING/Examiner, Art Unit 1635 /RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Oct 05, 2022
Application Filed
Nov 13, 2025
Non-Final Rejection — §101, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12571038
DIGITAL COUNTING OF INDIVIDUAL MOLECULES BY STOCHASTIC ATTACHMENT OF DIVERSE LABELS
2y 5m to grant Granted Mar 10, 2026
Patent 12570979
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Mar 10, 2026
Patent 12565651
OLIGONUCLEOTIDES COMPRISING SEGMENTED GAP STRUCTURES
2y 5m to grant Granted Mar 03, 2026
Patent 12565657
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Mar 03, 2026
Patent 12565655
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Mar 03, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
70%
Grant Probability
99%
With Interview (+40.5%)
2y 3m
Median Time to Grant
Low
PTA Risk
Based on 56 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month