DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Amendments and Arguments
The Office Action is in response to amendment filed Apr 20, 2026, in which some claims were amended, no claims were cancelled, and no new claims were added, is acknowledged and entered.
The amendments were entered.
Any rejection or objection not reiterated herein has been overcome by amendment. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Election/Restrictions
Applicant’s election without traverse of Group I (claims 1-3, 11-12, 15, 20, 22, and 24-25) drawn to a dsRNA for inhibiting MYOC, wherein each strand comprises at least 15 contiguous nucleobases, wherein at least one nucleotide is modified; wherein at least one strand is conjugated to a lipophilic moiety; at least one strand comprises a 3’ overhang of at least 2 nucleotides; comprising a targeting ligand; and the antisense strand comprises a phosphate or phosphate mimic at the 5’ end; a cell containing the dsRNA; and a pharmaceutical composition comprising the dsRNA composition in the reply filed on Sept 15, 2025 was previously acknowledged. The elected group was extended to include new claim 38.
Claims 26-31, 33, and 35-37 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Group, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on Sept 15, 2025.
The requirement for election of a single species from each species was previously removed.
Accordingly, claims 1-3, 11-12, 15, 20, 22, 24-25, and 38 are under examination.
Withdrawn Claim Rejections - 35 USC § 112
Claim 3 was amended to replace the limitation "iRNA" with dsRNA in the last para of 1st page of claims.
The 112 b rejection is withdrawn.
Withdrawn Claim Rejections - 35 USC § 101
Claim 24 was amended to replace the limitation “ a cell” with “an isolated cell”.
The 101 rejection is withdrawn.
Maintained Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim Interpretation: The claimed product is directed to a dsRNA molecule comprising a sense strand that is the mRNA sequence of myocilin and an antisense strand that is complementary to the sense strand (forming a double stranded region), wherein the strands comprise, to… antisense sequences SEQ ID NO: 1617, 1619, 1618, or 1616 with 0, 1, 2, or 3 mismatches and … the sense sequence SEQ ID NO: 1482, 1484, 1483, or 1481, with 0, 1, 2, or 3 mismatches... One of skill knows that the sense strand is also the sequence of the DNA target region. Since the sequences are recited in the alternative (recitation of sequences includes “or”) only one antisense sequence and its corresponding sense sequence are being considered for rejections of claims 1-3, 11-12, 15, 20, 22, and 24-25.
Claims 1-3, 11-12, 15, 20, 22, 24-25, and 38 remain rejected under 35 U.S.C. 103 as being unpatentable over US 20220125823 (of filing date 2019-05-07, hereafter “Manoharan”) in view of Naito et al. (US 20080113351). This rejection is unchanged from the rejection presented in the Non-Final Office Action dated 11/19/2025.
Manoharan teaches improved siRNAs that target difficult to reach areas such as the retina [0003]. Manoharan further teaches such improved siRNAs are double-stranded iRNA agents comprising an antisense strand complementary to a target gene and an sense strand complementary to the antisense strand [0061].
Regarding claim 1, Manoharan teaches a double-stranded iRNA agent that targets MYOC for glaucoma [0724] wherein the sense strand is 21 nucleotides in length [0354]; the antisense strand has a length of 23 nucleotides [0385], [0034]; mismatches can be included [0209], [0234].
Regarding claim 2, Manoharan teaches lipophilic moieties are conjugated to double-stranded iRNAs (abstract). The lipophilic moiety is an aliphatic, cyclic such as alicyclic, or polycyclic such as polyalicyclic compound [0009].
Regarding claim 3, Manoharan teaches wherein the sense strand or antisense strand can include a lipophilic moiety that can be a saturated or unsaturated hydrocarbon, including a C16 moiety (e.g., see [0080 - 0082], Fig. 10 – 12, etc.). Manahoran teaches that a carrier can be incorporated into an internal position of the backbone to which the lipophilic moiety is conjugated wherein the carrier replaces one or more nucleotide(s) (e.g., abstract, [0006], [0017]). Manoharan teaches the lipophilic moiety may be conjugated to the iRNA agent via a direct attachment to the ribosugar of the iRNA agent (e.g., [0012]). Manoharan teaches that the iRNA can comprise a monomer in which the ribose moiety has been replaced by another moiety other than ribose, and can be used to attach a ligand such as a lipophilic moiety directly or indirectly to the iRNA agent via a tether that includes a cleavable linker (e.g., see [0013], [0015], [0150]). Manoharan teaches that the cleavable linker can be a bio-cleavable linker that can be a disulfide group (e.g., [0139]). Manoharan teaches that the lipophilic moiety can be attached to the double-stranded iRNA agent via a linker a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide linkage, a product of a click reaction (e.g., a triazole from the azide-alkyne cycloaddition), or carbamate. ([0014]).
Regarding claims 11 - 12, Manoharan further teaches: wherein the sense strand or antisense strand can include any of the modifications described therein and wherein the antisense strand may include modifications such that less than 12, less than 10…less than 2 are modified (e.g., see paragraph [0055]). Manoharan also teaches that the modifications can be non-natural nucleotides. Examples of non-natural nucleotide include acyclic nucleotides, LNA, HNA, CeNA, 2′-O-methoxyalkyl (e.g., 2′-O-methoxymethyl, 2′-O-methoxyethyl, or 2′-O-2-methoxypropanyl), 2′-O-allyl, 2′-C-allyl, 2′-fluoro, 2′-O—N-methylacetamido (2′-O—NMA), a 2′-O-dimethylaminoethoxyethyl (2′-O-DMAEOE), 2′-O-aminopropyl (2′-O-AP), 2′-ara-F, L-nucleoside modification (such as 2′-modified L-nucleoside, e.g., 2′-deoxy-L-nucleoside), BNA abasic sugar, abasic cyclic and open-chain alkyl (see [0057]). Manoharan teaches that the both the sense and the antisense strands of the iRNA are preferably 19 to 21 nucleotides in length (see [0527]-[0528]).
Regarding claim 15, Manoharan teaches the iRNA agent can comprise a single stranded overhang of 1 – 10 nucleotides on at least one of the termini (e.g., [0035]); the sense and antisense strands of the double-stranded iRNA agent are each 15 to 30 nucleotides in length [0032] and 5′-end methylphosphonate internucleotide linkage modification [0297] – [0298].
Regarding claim 20, Manoharan teaches the iRNA agent comprises a targeting ligand [0357] which includes one for the retina (e.g., [0676], [ 0733]) and other areas within the CNS and ocular tissue.
Regarding claim 22, Manoharan teaches the iRNA agent also comprises a phosphate mimic such as 5′-VP. The 5′-VP may be 5′-E-VP, 5′-Z-VP, or combination thereof ([0298], [0306]).
Regarding claim 24, Manoharan teaches contacting a cell with the double-stranded iRNA agent of the invention such as an extraheptic cell [0893].
Regarding claim 25, Manoharan teaches pharmaceutical compositions for the iRNA agent of claim 1 (e.g., [0874] – [0877]).
Manoharan does not teach the SEQ ID Nos recited in claim 1.
However, before the effective filing date of instant invention, Naito teaches MYOC target region comprising SEQ ID NO: 291959 (background and sequence listing). Naito further teaches rules for siRNA double-stranded oligonucleotides which are: dsRNA wherein the oligonucleotides should be between 13-28 nucleobases and specifically directed to a target gene, and further wherein 10 or more bases of guanine or cytosine are not continuously contained in the oligonucleotide, which further comprises a sequence sharing at least 80% homology with the target sequence that is not contained in the base sequences of other gene sequences of a selected target organism from which the target gene is derived (claims 1, 13). Naito teaches 3’-end overhangs at each end of the dsRNA oligo (Fig.1). Naito also discloses the RefSeq gene for MYOC and the positions on it selected for targeting (NM_000261.1,633-651).
See select recitation from para [0109]:
The number of bases in each strand, including the overhanging portion, is 18 to 24, more preferably 20 to 22, and particularly preferably 21. The number of bases in the overhanging portion is preferably 2. siRNA having 21 bases in total in which the overhanging portion is composed of 2 bases is suitable for causing RNA interference with high probability without causing cytotoxicity even in mammals.
See sequence matching instant sequence SEQ Id NO: 1617:
CURRENT APPLICATION NUMBER: US/11/598,052B
CURRENT FILING DATE: 2006-11-13
PRIOR APPLICATION NUMBER: PCT/IB2005/00164
PRIOR FILING DATE: 2005-05-11
PRIOR APPLICATION NUMBER: JP 2004-232811
PRIOR FILING DATE: 2004-05-11
NUMBER OF SEQ ID NOS: 817670
SEQ ID NO 291959
LENGTH: 19
TYPE: DNA
ORGANISM: Homo sapiens
FEATURE:
OTHER INFORMATION: siRNA target sequence for MYOC (NM_000261.1,633-651).
Query Match 82.6%; Score 19; Length 19;
Score over Length 100.0%;
Best Local Similarity 78.9%;
Matches 15; Conservative 4; Mismatches 0; Indels 0; Gaps 0;
Qy 5 AAAGUGUCCAAAUUCCACG 23
||||:|:|||||::|||||
Db 19 AAAGTGTCCAAATTCCACG 1
Naito does not teach the complete structure of a dsRNA that targets MYOC from all the disclosed rules.
It would have been obvious to make a dsRNA so that it may function in inhibiting expression of myocilin gene, using the guidelines as taught by Manoharan et al. and Naito et al., using the target sequence as taught by Naito and arrive at an antisense and sense pair of oligonucleotides wherein the pair comprises SEQ ID NO: 1616 and 1482 targeted to the myocilin gene.
One of ordinary skill in the art would have been motivated to make the combination for the advantage of inhibiting myocilin because it was known that myocilin expression is upregulated in retinal tissue and associated with glaucoma, as evidenced by Manoharan et al.,
“The combination of familiar elements according to known methods is likely to be obvious when it does no more than yield predictable results.” See KSR v. Teleflex, 550 U.S., 127 S. Ct. 1727 (2007). See MPEP 2143 I A.
Finally, one of ordinary skill in the art would have had a reasonable expectation of success at generating a dsRNA comprising SEQ ID NO: 1617 and 1482 because both Manoharan and Naito teach a method of designing a iRNA and in view of the guidelines it would generate the instant dsRNA sequences as preferable sense and antisense to use to target the myocilin target sequence.
Thus, Manoharan in view of Naito make obvious instant claims 1-3,11-12,15,20,22,24-25.
Regarding claim 38, a dsRNA for inhibiting expression of myocilin is made obvious by Manoharan and Naito as discussed above for SEQ ID NO: 1617 and its complementary sense sequence SEQ ID NO: 1482. The other sequences recited are also within the same target region taught by Naito (bolded below):
SEQ ID NO: 1616 u ccaaaguguccaaauucca cgu
SEQ ID NO: 1617 ug ccaaaguguccaaauucca cg
SEQ ID NO: 1618 ugg ccaaaguguccaaauucca c
SEQ ID NO: 1619 uagg ccaaaguguccaaauucca
The modified sequences of SEQ ID NO: 1616 – 1619 are 1346 – 1349; wherein the latter are:
SEQ ID NO 1346: VPusCfscaa AfgUfGfucca AfaUfuccacs Gsu
SEQ ID NO 1347: VPusGfscca AfaGfUfgucc AfaAfuuccas Csg
SEQ ID NO 1348: VPusGfsgcc AfaAfGfuguc CfaAfauuccs Asc
SEQ ID NO 1349: VPusAfsggc CfaAf Af gugu CfcAfaauucs csa
The abbreviations listed on these sequences are modifications as per Table 1 of the specification; e.g., s= phosphorothioate linkage.
Neither Manoharan nor Naito teach a dsRNA comprising each of the recited sequences.
However, Manoharan’s teaching were discussed supra. These included length and chemical modifications. Following this guidance, the designed sequences are further optimized for efficient delivery of the dsRNA agent to cells in vivo by specific targeting linkers and substantial protection from the extracellular environment by specific modifications at specific nucleotide positions. While the whole patent is of substantial value in providing these teachings, particularly important are: [0041] - [0048], [0055] - [0060], [0260], [0268] ,[0298], [0311], [0313].
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to try to make an antisense sequence sufficiently similar to Applicant' s SEQ ID NO: 1617 as taught by Manoharan and Naito ensuring the target region of MYOC taught by Naito is kept, and further modify as taught by Manoharan. Before the effective filing date of Applicant' s invention, Manoharan provided sufficient guidance and motivation to target MYOC with a modified dsRNA oligomer comprising sense and antisense strands as discussed for claim 1. Specifically, Manoharan taught a design need for nucleic acid sequences which can influence target gene expression inhibition. dsRNA targeting systems rely on a finite number of identified parameters such as target length, limited RNA nucleotides, combinations of nucleotides, and nucleotide length between 15 and 30 nucleotides but ideally, the sense and antisense strands of the dsRNA agent are each 21 to 23 nucleotides in length [0034]. Thus, with these parameters and Naito’s taught target sequence there are only a finite number of identified, predictable sequences and modifications at precise positions that can be obtained. In fact, there are only an extremely small and finite number of possible solutions. It would have been obvious to make sense and antisense sequences with modifications given the target region with a measured and predictable outcome and “test” these sequences for use or to further narrow the choice down to optimal candidates. The skilled artisan would have had a reasonable expectation of success in doing so because the skilled artisan would be operating under conditions thoroughly discussed and vetted by the applied references. See MPEP 2143 I (E).
Further, it is a settled principle of law that a mere carrying forward of an original patented conception involving only change of form, proportions, or degree, or the substitution of equivalents doing the same thing as the original invention, by substantially the same means, is not such an invention as will sustain a patent, even though the changes of the kind may produce better results than prior inventions.
Thus, Manoharan in view of Naito make obvious instant claim 38.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art at the time the invention was made.
Response to Arguments
Applicant's arguments filed 04/20/2026 have been fully considered. The amendments have overcome the 112b and 101 rejections. However, the amendments/arguments regarding the 103 rejections are not persuasive.
I. Applicant addresses the 112b and 101 rejection at page 9 of the response.
Applicant asserts:
amendments cancelling the limitation “iRNA” and amending “a cell” to “An isolated cell” overcome the rejections respectively.
This is persuasive.
The amendment has overcome the rejections; the rejections are withdrawn.
II. Applicant addresses the 103 rejection over Manoharan in view of Naito at pages 9- 12 of the response. At pg. 9, Applicant summarizes the rejection.
Then at pg. 10, Applicant asserts that a prima facie case of obviousness has not been made and cites KSR, Graham v. Deere, and Unigene Laboratories, Inc. v. Apotex, Inc., 655 F.3d 1352 (Fed. Cir. 2011). The latter is cited to support that obviousness requires the additional showing that a person of ordinary skill at the time of the invention would have selected and combined those prior art elements to yield the claimed invention.
Then at pg. 11, Applicant asserts:
Manoharan fails to disclose, suggest, or predict the specific dsRNA agents.
Naito's disclosure is
limited to a generalized method for selecting target sequences from mRNA for RNA interference.
merely identifies SEQ ID NO: 291959 as corresponding to nucleotides 633-651 of MYOC mRNA, as a potential target satisfying its general siRNA design rules.
Naito does not disclose, suggest, or predict presently claimed nucleotides 687-712 of MYOC mRNA as a targeting region for a dsRNA agent, and by expressly identifying a different region of MYOC as contemplated by its strategy.
This, Applicants state results in Naito actually teaches away from the notion that SEQ ID NO: 291959 would cause RNA silencing by targeting nucleotides 687-712 of MYOC mRNA.
Moreover, Naito identifies over 817,000 potential target sequences, providing no suggestion that would direct one ordinarily skilled in the art to the specific claimed targeting region of MYOC.
This Applicants assert, means no motivation to select nucleotides 687-712 of MYOC mRNA from among the numerous possible sequences that could theoretically target the approximately 2,000 nucleotides of MYOC mRNA and to design a dsRNA agent as presently claimed. Nor would one ordinarily skilled in the art have had any reasonable expectation of success to arrive at the dsRNA agent as presently claimed, as neither reference provides any efficacy data for any MYOC-targeting dsRNA agent, or any disclosure or guidance for producing a dsRNA agent.
Finally Applicants close by reproducing a data table from the specification that shows results of an in vitro multi-dose screen with one set of exemplary human MYOC siRNAs.
This is unpersuasive because:
In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
Naito provides the motivation to pursue exactly what is in instant application.
As stated on pg. 8 of the rejection above, Naito further teaches rules for siRNA double-stranded oligonucleotides for e.g., length of the oligonucleotide, base at 3’-end, base at 5’-end, % homology to target and non-target etc.,. See also Naito: paras [0058]-[0061]. These are the features of instant dsRNA. Naito then follows up the design rules with in vitro testing methodology. See Naito para [0313]: … 0.01, 0.1, 1, 10 or 100 nM of siRNA were introduced. Instant application is also tested within this dose range. Naito’s Example 4 on pg. 27, compares activity of dsRNA designed by following their rule (<20% target gene remains) vs. activity of dsRNA designed by NOT following their rules (50%-100% target gene remains). After results are obtained, Naito analyze their rules of design and confirm:
[0318] As is evident from the results, in the base sequences of polynucleotides for causing RNA interference, it is highly probable that the 3' end is adenine or uracil and that the 5' end is guanine or cytosine. Furthermore, it has become clear that the 7-base sequence from the 3' end is rich in adenine or uracil.
In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., 687-712 of MYOC mRNA) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993).
In the instant case, there had been ample suggestion in the prior art that the claimed antisense would have worked. See discussion in #2 above. Further, note that Naito follow-up testing of their designed siRNA to luciferase with testing of designed siRNA to various other targets. See [0329], Examples 3 and 5-8. [0377]:…showing that all the 294 tested siRNA sequences falling within the present invention were found to produce an RNAi effect, it was indicated that the polynucleotides (siRNA) of the present invention effectively produced an RNAi effect against their target genes in mammalian cells and caused a 50% or more inhibition of gene expression. See PharmaStem Therapeutics, Inc. v. Viacell, Inc., 491 F.3d 1342, 83 USPQ2d 1289 (Fed. Cir. 2007), in which, the Federal Circuit pointed out that the patentee, PharmaStem, had not invented an entirely new procedure or new composition with a showing of experimental proof that umbilical cord and placental blood could be used to effect hematopoietic reconstitution in mice, because the prior art had already shown that umbilical cord and placental blood-based compositions contained hematopoietic stem cells, and that hematopoietic stem cells were useful for the purpose of hematopoietic reconstitution. The Fed. Circuit stated that by extrapolation, one of ordinary skill in the art would have expected this reconstitution method to work in humans as well. In the instant case, Applicants have not highlighted any additional effort or skill needed to practice the claimed invention other than that already suggested by the references cited.
Naito’s MYOC Ref Seq is NM_000261.1, instant application, having a later effectively filed date, use NM_000261.2. So the position (nucleotide number) of nucleotides will differ. See appendix aligning the two ref seqs. Importantly, unlike what Applicants say, Naito’s sequence and instant sequence align with the same nucleotides on the Ref Seq used by Naito. See below:
RESULT 1
US-17-995-568-1617/c
Instant >1617
Query Match 1.1%; Score 22; DB 1; Length 23;
Best Local Similarity 100.0%;
Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Ref SEq 633 CGTGGAATTTGGACACTTTGGC 654
||||||||||||||||||||||
Db 23 CGTGGAATTTGGACACTTTGGC 2
RESULT 1
Naito >291959
Query Match 0.9%; Score 19; DB 1; Length 19;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Ref SEq 633 CGTGGAATTTGGACACTTT 651
|||||||||||||||||||
Db 1 CGTGGAATTTGGACACTTT 19
Thus, Naito does not teach away. See recitation of MPEP 2143.01 I: The court stated that "the prior art’s mere disclosure of more than one alternative does not constitute a teaching away from any of these alternatives because such disclosure does not criticize, discredit, or otherwise discourage the solution claimed…." for considerations of prior art in determining obviousness.
Naito does teach a number of target, sense and antisense oligos. However, the number of MYOC antisense oligos are SEQ ID Nos: from 291956 to 291977; i.e., 21 sequences (see Naito’s sequence listing), thus suggesting easy testing. One of skill looking to silence MYOC would be motivated to test all 21 sequences to target ~2,000 nucleotides of MYOC mRNA, especially since Naito test antisense oligos against their test luciferase gene and determine that all the oligos designed following their rules of design, to this gene, results in >er than 80% inhibition of the test gene (Naito, Fig. 34). Given this background, one would have had a reasonable expectation of success to arrive at the dsRNA agent as presently claimed.
Applicant assertion that the instant application demonstrates unexpected results as shown in the reproduced Table is unpersuasive because:
The demonstrated results are expected when interpreted in view of the prior art. Naito shows that the given oligos are likely to results in >er than 80% inhibition of the target gene, when results are extrapolated from results of a test sequence (Fig 34). Instant application shows similar results.
"To be particularly probative, evidence of unexpected results must establish that there is a difference between the results obtained and those of the closest prior art, and that the difference would not have been expected by one of ordinary skill in the art at the time of the invention." Bristol-Myers Squibb Co. v. Teva Pharm. USA, Inc., 752 F.3d 967, 977 (Fed. Cir. 2014).
A showing of unexpected results must be "commensurate in scope with the degree of protection sought by the claimed subject matter." In re Harris, 409 F.3d 1339, 1344 (Fed. Cir. 2005). "Any differences between the claimed invention and the prior art may be expected to result in some differences in properties. The issue is whether the properties differ to such an extent that the difference is really unexpected." (emphasis added). See MPEP §716.02. "It is not enough to show that results are obtained which differ from those obtained in the prior art: that difference must be shown to be an unexpected difference". ( original emphasis). In re Klosak, 455 F.2d 1077, 1080 (CCPA 1972).
None of Applicant’s four reasons listed above is dispositive; the rejection is maintained.
Relevant Prior Art Not relied Upon
The closest prior art is applied above. The following art is made note of and not currently relied on, but is relevant to applicant’s invention, especially if method claims were to be rejoined. Aznarez et al (US 11096956 B2) have taught different antisense oligomers useful for many diseases, for example: Certain diseases affecting eye function are associated with a deficiency in the expression of a gene, and in turn, a deficiency in the gene product. Examples of gene products for which increased expression can provide benefit in eye diseases or conditions include MYOC (10). One such sequence is shown below that corresponds to instant SEQ Id NO: 1617. Modifications to the nucleotides will result in modified sequences that are disclosed in instant application. Aznarez do not specifically teach the antisense oligomer is a dsRNA.
NUMBER OF SEQ ID NOS: 150766
SEQ ID NO 36647
LENGTH: 18
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
oligonucleotide
Query Match 78.3%; Score 18; Length 18;
Score over Length 100.0%;
Best Local Similarity 100.0%;
Matches 18; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 2 GCCAAAGUGUCCAAAUUC 19
||||||||||||||||||
Db 1 GCCAAAGUGUCCAAAUUC 18
Conclusion
No claims are allowed.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
SHABANA S. MEYERING, Ph.D.
Examiner
Art Unit 1635
/SHABANA S MEYERING/ Examiner, Art Unit 1635
/CATHERINE KONOPKA/ Primary Examiner, Art Unit 1635