Office Action Predictor
Last updated: April 16, 2026
Application No. 18/001,050

TUMOR NECROSIS FACTOR RECEPTOR ASSOCIATED FACTOR 6 (TRAF6) iRNA COMPOSITIONS AND METHODS OF USE THEREOF

Non-Final OA §101§102§103§112
Filed
Dec 07, 2022
Examiner
POLIAKOVA-GEORGAN, EKATERINA
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Alnylam Pharmaceuticals, INC.
OA Round
1 (Non-Final)
65%
Grant Probability
Favorable
1-2
OA Rounds
2y 6m
To Grant
78%
With Interview

Examiner Intelligence

Grants 65% — above average
65%
Career Allow Rate
434 granted / 668 resolved
+5.0% vs TC avg
Moderate +13% lift
Without
With
+12.6%
Interview Lift
resolved cases with interview
Typical timeline
2y 6m
Avg Prosecution
55 currently pending
Career history
723
Total Applications
across all art units

Statute-Specific Performance

§101
5.4%
-34.6% vs TC avg
§103
28.6%
-11.4% vs TC avg
§102
22.8%
-17.2% vs TC avg
§112
24.2%
-15.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 668 resolved cases

Office Action

§101 §102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of Group I, claims 2-4, 13, 23-24, 27, 78-79, 82-85 in the reply filed on 10/21/2025 is acknowledged. Claims 90-91, 100, 104 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Group, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/21/2025. Election of species is acknowledged. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 4 and 78 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The term “substantially” in claims 4 and 78 is a relative term which renders the claim indefinite. The term “substantially” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The metes and bounds of claims 4 and 78 are not clear, because the term “substantially” is not defined. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Section 33(a) of the America Invents Act reads as follows: Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism. Claim 82 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101). The broadest reasonable interpretation of the term “cell” embraces a human having the cell (see paragraph [0006] of the as-filed specification). It is suggested to amend the claim to recite “An isolated cell” to avoid the claim embracing a human organism. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claim(s) 2-4, 13, 23, 82-84, 115 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Khvorova et al (WO 2004/045543, June 2004, cited from IDS). Concerning claims 2, 13 and 115 Khvorova disclose siRNA targeting TRAF6 with a sense strand of SEQ ID NO: 1840 (see page 136), which is 19 nucleotides long and fully complementary to nucleotides 2-20 of instant SEQ ID NO: 107 and identical to nucleotides 2-20 of instant SEQ ID NO: 17: SEQ ID NO: 107 1 AUAACGCUCAAACUAUGAACAGC 23 ||||||||||||||||||| SEQ ID NO: 1840 19 AUUGCGAGUUUGAUACUUG 1 Further Khvorova disclose that siRNA is a double-stranded RNA and comprises two strands, sense and antisense, complementary to each other (see lines 9-12 on page 48, lines 1-6 on page 14), therefore the second strand complementary to SEQ ID NO: 1840, comprising nucleotides 2-20 of instant SEQ ID NO: 107 is disclosed as well. Concerning claims 3 and 4 Khvorova disclose that nucleotides of siRNA can have 2’-O-methyl modification (see lines 13-23 on page 18). Concerning claim 23 Khvorova disclose that siRNA can be conjugated to a ligand (see lines 7-15 on page 55). Concerning claim 82 Khvorova disclose cells comprising siRNAs of the invention (see lines 20-25 on page 33). Concerning claim 83 Khvorova disclose vectors encoding siRNAs of the invention (see lines 3-7 on page 52). Concerning claim 84 Khvorova disclose that siRNAs targeting TRAF6 are intended for treatment of immune system disorders (see lines 15-20 on page 103), therefore inherently disclosing pharmaceutical compositions comprising such siRNAs. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 2-4, 13, 23-24, 27, 78-79, 82-85, 115-116 is/are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova, above, and in further view of Fitzgerald et al (WO 2014/160129, October 2014, cited from IDS). Teachings of Khvorova are discussed above. Khvorova do not teach conjugation to specific ligand as in claims 24 and 27, specific modification of strands as in claims 78-79, pharmaceutical compositions comprising unbuffered solution or siRNAs comprising instant SEQ ID NOs: 17 and 107. Fitzgerald teach double-stranded nucleic acids such as siRNAs (see Abstract, lines 5-10 on page 36). Fitzgerald teach optimization of such siRNA by conjugation to a carbohydrate ligand (see lines 3-8 on page 67), such ligand can be of structure shown on page 8, identical to ligands of instant claims 24 and 27. Further Fitzgerald teach siRNA modifications wherein substantially all of the nucleotides of the sense strand comprise a modification selected from the group consisting of a 2’-O-methyl modification and a 2’-fluoro modification, wherein the sense strand comprises two phosphorothioate internucleotide linkages at the 5’- terminus, wherein substantially all of the nucleotides of the antisense strand comprise a modification selected from the group consisting of a 2’-O-methyl modification and a 2’-fluoro modification, wherein the antisense strand comprises two phosphorothioate internucleotide linkages at the 5’-terminus and two phosphorothioate internucleotide linkages at the 3’-terminus, and wherein the sense strand is conjugated to one or more GalNAc derivatives attached through a branched bivalent or trivalent linker at the 3 -terminus or all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides. (see lines 13-23 on page 13). Fitzgerald teach pharmaceutical compositions comprising siRNA in unbuffered solution (see first line on page 14). Fitzgerald teach that both strands of siRNA can be 14-30 nucleotides long (see line 7 on page 6). It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to modify siRNA taught by Khvorova by including modifications taught by Fitzgerald, arriving at instant invention. One of the ordinary skill in the art would be motivated to do so, because Fitzgerald teach optimization of siRNAs, which can be applied to siRNA taught by Khvorova to further improve it. Further Fitzgerald teach that the strands of siRNA can be as long as 30 nucleotides, making it obvious to elongate both strands of siRNA taught by Khvorova and arriving at siRNA comprising instant SEQ ID NOs: 17 and 107. Allowable Subject Matter Claim 117 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to EKATERINA POLIAKOVA whose telephone number is (571)270-5257. The examiner can normally be reached Mon-Fri 8-5. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571)272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /EKATERINA POLIAKOVA-GEORGANTAS/Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Dec 07, 2022
Application Filed
Nov 12, 2025
Non-Final Rejection — §101, §102, §103
Mar 26, 2026
Response Filed

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600964
Compound for treatment of heart failure
2y 5m to grant Granted Apr 14, 2026
Patent 12595477
COMPLEMENT FACTOR B-MODULATING COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Apr 07, 2026
Patent 12584130
ANGIOTENSINOGEN (AGT) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Mar 24, 2026
Patent 12576030
COMPOSITIONS FOR DELIVERY OF CODON-OPTIMIZED MRNA
2y 5m to grant Granted Mar 17, 2026
Patent 12570977
NOVEL MRNA COMPOSITION AND PRODUCTION METHOD FOR USE IN ANTI-VIRAL AND ANTI-CANCER VACCINES
2y 5m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
65%
Grant Probability
78%
With Interview (+12.6%)
2y 6m
Median Time to Grant
Low
PTA Risk
Based on 668 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in for Full Analysis

Enter your email to receive a magic link. No password needed.

Free tier: 3 strategy analyses per month