DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 121, 123-127, 129, 131-138, 151-152, 155-156 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Saetrom et al (US 2018/0305689, October 2018, of record).
Concerning claims 121, 129, 151-152, 155-156 Saetrom disclose double stranded RNA with one strand of SEQ ID NO: 1495454 (see paragraph [0111], sequence listing), 19 nucleotides long, which are identical to nucleotides 3-21 of instant SEQ ID NO: 352:
SEQ ID NO: 352 1 GAGGACGAUGAUACUCAGCAACA 23
|||||||||||||||||||
SEQ ID NO: 1495454 1 GGACGAUGAUACUCAGCAA 19
Further Saetrom disclose that such double stranded RNA comprises a second strand complementary to the first (see paragraph [0075]). Such strand fully complementary to SEQ ID NO: 1495454 is 100% identical to nucleotides 1-19 of instant SEQ ID NO: 663.
Saetrom disclose that double stranded RNAs of the invention can include modified nucleotides (see paragraph [0075]), which can include sugar modifications (see paragraph [0116]) and phosphorothioate modifications (see paragraph [0127]).
Concerning claims 123-124, 131-132 Saetrom disclose that double stranded RNAs of the invention can include 2'-OMe sugar modifications (see paragraph [0116]).
Concerning claims 125-126 and 133-134 Saetrom disclose that double stranded RNAs of the invention can include phosphorothioate modifications (see paragraph [0127]).
Concerning claim 127 Saetrom disclose that double stranded RNAs of the invention can include terminal groups (see paragraph [0082]).
Concerning claim 135-138 Saetrom disclose that double stranded RNAs of the invention can include a conjugate group such as lipid or C16 alkyl (palmityl) group and conjugation can be accomplished using a linker (see paragraphs [0125, 0135-0136]).
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 121, 123-129, 131-160 is/are rejected under 35 U.S.C. 103 as being unpatentable over Saetrom et al, above, and in further view of Prakash et al (US 2013/0084576, April 2013, of record) and Freier et al (US 2021/0139906, May 2021, of record).
Teachings of Saetrom are discussed above. Saetrom further teach that double stranded RNAs can have varied strands length from 14 to 30 nucleotides (see paragraph [0019]).
Saetrom do not teach the terminal group comprising a 5'- vinylphosphonate, or attaching conjugate group to the second modified oligonucleotide at the 3'-end, or the internucleoside linkage motif of the first modified oligonucleotide is ssooooooooooooooooooss and the internucleoside linkage motif of the second modified oligonucleotide is ssooooooooooooooooss, or the first modified oligonucleotide consisting of 23 linked nucleosides and the second modified oligonucleotide consisting of 21 linked nucleosides.
Prakash teach chemical modifications of double-stranded siRNAs, which improve their potency and efficacy (see paragraphs [0007, 0441]), including 5'- vinylphosphonate modifications (see paragraph [1064]).
Freier teach ssooooooooooooooooooss modification of antisense strand of double- stranded siRNA (see paragraph [0229]) and ssooooooooooooooooss modification of sense strand of double-stranded siRNA (see paragraph [0230]).
It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to introduce modifications taught by Prakash and Freier into double stranded RNA taught by Saetrom and vary length of the strands, arriving at instant invention. One of the ordinary skill in the art would be motivated to do so because Prakash and Freier teach improvements to double stranded RNAs, which can be introduced into double stranded RNA of Saetrom to improve potency and efficacy. Further Saetrom teach various lengths of double stranded RNA strands, therefore it would be a matter of choice to choose specific lengths as instantly claimed and test them for activity. The matter of attachment of different substituents is also just a matter of choice, because double stranded RNA has only 4 ends, so it would be obvious to try attaching substituents to any of those ends.
Response to Arguments
Applicant's arguments filed 12/19/2025 have been fully considered but they are not persuasive.
Concerning 102 rejection Applicant argues that SEQ ID NO: 1495454 is not disclosed as a duplex. In response in cited paragraph [0111] of Saetrom reference the sequence is disclosed as double stranded duplex. Rejection is maintained.
Concerning 103 rejection Applicant argues that Prakash reference teach a variety of conjugate groups and there is no reasoning to do the conjugation. In response the reference teach that conjugation to any described group increases potency and efficiency of the conjugate, providing reason for conjugation to any of the groups described. Rejection is maintained.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to EKATERINA POLIAKOVA whose telephone number is (571)270-5257. The examiner can normally be reached Mon-Fri 8-5.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571)272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/EKATERINA POLIAKOVA-GEORGANTAS/Primary Examiner, Art Unit 1637