Prosecution Insights
Last updated: April 19, 2026
Application No. 18/001,848

COMPOUNDS AND METHODS FOR MODULATING PMP22

Final Rejection §102§103
Filed
Dec 14, 2022
Examiner
POLIAKOVA-GEORGAN, EKATERINA
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Ionis Pharmaceuticals Inc.
OA Round
2 (Final)
65%
Grant Probability
Favorable
3-4
OA Rounds
2y 8m
To Grant
81%
With Interview

Examiner Intelligence

Grants 65% — above average
65%
Career Allow Rate
434 granted / 668 resolved
+5.0% vs TC avg
Strong +16% interview lift
Without
With
+16.2%
Interview Lift
resolved cases with interview
Typical timeline
2y 8m
Avg Prosecution
55 currently pending
Career history
723
Total Applications
across all art units

Statute-Specific Performance

§101
5.4%
-34.6% vs TC avg
§103
28.6%
-11.4% vs TC avg
§102
22.8%
-17.2% vs TC avg
§112
24.2%
-15.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 668 resolved cases

Office Action

§102 §103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claim(s) 121, 123-127, 129, 131-138, 151-152, 155-156 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Saetrom et al (US 2018/0305689, October 2018, of record). Concerning claims 121, 129, 151-152, 155-156 Saetrom disclose double stranded RNA with one strand of SEQ ID NO: 1495454 (see paragraph [0111], sequence listing), 19 nucleotides long, which are identical to nucleotides 3-21 of instant SEQ ID NO: 352: SEQ ID NO: 352 1 GAGGACGAUGAUACUCAGCAACA 23 ||||||||||||||||||| SEQ ID NO: 1495454 1 GGACGAUGAUACUCAGCAA 19 Further Saetrom disclose that such double stranded RNA comprises a second strand complementary to the first (see paragraph [0075]). Such strand fully complementary to SEQ ID NO: 1495454 is 100% identical to nucleotides 1-19 of instant SEQ ID NO: 663. Saetrom disclose that double stranded RNAs of the invention can include modified nucleotides (see paragraph [0075]), which can include sugar modifications (see paragraph [0116]) and phosphorothioate modifications (see paragraph [0127]). Concerning claims 123-124, 131-132 Saetrom disclose that double stranded RNAs of the invention can include 2'-OMe sugar modifications (see paragraph [0116]). Concerning claims 125-126 and 133-134 Saetrom disclose that double stranded RNAs of the invention can include phosphorothioate modifications (see paragraph [0127]). Concerning claim 127 Saetrom disclose that double stranded RNAs of the invention can include terminal groups (see paragraph [0082]). Concerning claim 135-138 Saetrom disclose that double stranded RNAs of the invention can include a conjugate group such as lipid or C16 alkyl (palmityl) group and conjugation can be accomplished using a linker (see paragraphs [0125, 0135-0136]). Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 121, 123-129, 131-160 is/are rejected under 35 U.S.C. 103 as being unpatentable over Saetrom et al, above, and in further view of Prakash et al (US 2013/0084576, April 2013, of record) and Freier et al (US 2021/0139906, May 2021, of record). Teachings of Saetrom are discussed above. Saetrom further teach that double stranded RNAs can have varied strands length from 14 to 30 nucleotides (see paragraph [0019]). Saetrom do not teach the terminal group comprising a 5'- vinylphosphonate, or attaching conjugate group to the second modified oligonucleotide at the 3'-end, or the internucleoside linkage motif of the first modified oligonucleotide is ssooooooooooooooooooss and the internucleoside linkage motif of the second modified oligonucleotide is ssooooooooooooooooss, or the first modified oligonucleotide consisting of 23 linked nucleosides and the second modified oligonucleotide consisting of 21 linked nucleosides. Prakash teach chemical modifications of double-stranded siRNAs, which improve their potency and efficacy (see paragraphs [0007, 0441]), including 5'- vinylphosphonate modifications (see paragraph [1064]). Freier teach ssooooooooooooooooooss modification of antisense strand of double- stranded siRNA (see paragraph [0229]) and ssooooooooooooooooss modification of sense strand of double-stranded siRNA (see paragraph [0230]). It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to introduce modifications taught by Prakash and Freier into double stranded RNA taught by Saetrom and vary length of the strands, arriving at instant invention. One of the ordinary skill in the art would be motivated to do so because Prakash and Freier teach improvements to double stranded RNAs, which can be introduced into double stranded RNA of Saetrom to improve potency and efficacy. Further Saetrom teach various lengths of double stranded RNA strands, therefore it would be a matter of choice to choose specific lengths as instantly claimed and test them for activity. The matter of attachment of different substituents is also just a matter of choice, because double stranded RNA has only 4 ends, so it would be obvious to try attaching substituents to any of those ends. Response to Arguments Applicant's arguments filed 12/19/2025 have been fully considered but they are not persuasive. Concerning 102 rejection Applicant argues that SEQ ID NO: 1495454 is not disclosed as a duplex. In response in cited paragraph [0111] of Saetrom reference the sequence is disclosed as double stranded duplex. Rejection is maintained. Concerning 103 rejection Applicant argues that Prakash reference teach a variety of conjugate groups and there is no reasoning to do the conjugation. In response the reference teach that conjugation to any described group increases potency and efficiency of the conjugate, providing reason for conjugation to any of the groups described. Rejection is maintained. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to EKATERINA POLIAKOVA whose telephone number is (571)270-5257. The examiner can normally be reached Mon-Fri 8-5. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571)272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /EKATERINA POLIAKOVA-GEORGANTAS/Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Dec 14, 2022
Application Filed
Sep 19, 2025
Non-Final Rejection — §102, §103
Dec 19, 2025
Response Filed
Feb 23, 2026
Final Rejection — §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600964
Compound for treatment of heart failure
2y 5m to grant Granted Apr 14, 2026
Patent 12595477
COMPLEMENT FACTOR B-MODULATING COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Apr 07, 2026
Patent 12584130
ANGIOTENSINOGEN (AGT) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Mar 24, 2026
Patent 12576030
COMPOSITIONS FOR DELIVERY OF CODON-OPTIMIZED MRNA
2y 5m to grant Granted Mar 17, 2026
Patent 12570977
NOVEL MRNA COMPOSITION AND PRODUCTION METHOD FOR USE IN ANTI-VIRAL AND ANTI-CANCER VACCINES
2y 5m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
65%
Grant Probability
81%
With Interview (+16.2%)
2y 8m
Median Time to Grant
Moderate
PTA Risk
Based on 668 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month