Prosecution Insights
Last updated: April 19, 2026
Application No. 18/006,900

CANINE AND FELINE INDUCIBLE EXPRESSION CONSTRUCTS FOR GENE THERAPY APPLICATIONS

Non-Final OA §103§112
Filed
Jan 26, 2023
Examiner
O'NEILL, MARISOL ANN
Art Unit
1633
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Trustees of the University of Pennsylvania
OA Round
1 (Non-Final)
47%
Grant Probability
Moderate
1-2
OA Rounds
3y 7m
To Grant
99%
With Interview

Examiner Intelligence

Grants 47% of resolved cases
47%
Career Allow Rate
8 granted / 17 resolved
-12.9% vs TC avg
Strong +75% interview lift
Without
With
+75.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
31 currently pending
Career history
48
Total Applications
across all art units

Statute-Specific Performance

§101
3.6%
-36.4% vs TC avg
§103
42.0%
+2.0% vs TC avg
§102
23.8%
-16.2% vs TC avg
§112
24.8%
-15.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 17 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Acknowledgement is made that the instant application is a National Stage of International application No. PCT/US2021043219 (files 07/26/2021), which claims the benefits of US Provisional Application No. 63/056985 (filed 07/27/2020). Claim Objections Claim 29 is objected to because of the following informalities: the term 8XFCD. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 3: Claim 3 recites the limitation of “the FKBP subunit gene sequences share less than about 85% identity with each other. However, claim 3 depends from claim 1 which permits for just a single FKBP subunit gene. For the embodiments wherein only one FKBP subunit gene is present, it is not clear if/how claim 3 is to further limit parent claim 1. Regarding claim 29: Claim 29 recites the limitation "the 8XZFHD" in line 1. There is insufficient antecedent basis for this limitation in the claim. For the purpose of compact prosecution, claim 29 will be interpreted as depending from claim 12 and the term 8XZFHD will be interpreted as referring to the 8 copies of the binding site for ZFHD. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-8, 10-18, and 27-29 are rejected under 35 U.S.C. 103 as being unpatentable over Wilson et al 1 (US9315825B2). Wilson et al 1, teaches a recombinant AAV vector, having an 8379 bp nucleic acid sequence, expressing from 5’ to 3’ an ITR, a CMV promoter, an FRB-TA fusion domain, an IRES, a ZFHD-FKBP fusion domain , a Z8I domain , a Cre, and an ITR (See Fig. 1). The ITRs of Wilson et al 1 are AAV ITRs and the transcription units can be packaged with any AAV capsid protein known in the art (See Col. 20 lns 39-43 and col 45, lns 30-32). The FRB-TA fusion is a fusion of the FRB fragment of FRAP and a portion of human NF-kB p65 (See Col. 20 lns 48-58). The ZFHD-FKBP fusion comprises a fusion of a zinc finger homeodomain (ZFHD) and two or three copies of drug binding domain FKBP (See Col 20, lns 59-66). The Z8I contains eight copies of ZFHD followed by minimal promoter from the human interleukin-1 (IL-2) gene having SEQ ID NO: 32 (See Col. 21, lns 4-6). The AAV of Wilson et al 1 is a rapamycin-regulatable system (See claim 21). Wilson et al 1 further discloses a human FRAP with a nucleic acid sequence of SEQ ID NO: 29, a wild-type FKBP sequence having SEQ ID NO: 53, a modified FKBPs having SEQ ID NOs: 56 and 57, and a ZFHD having SEQ ID NO: 45. Wilson et al 1 further teaches using the AAV in an in vivo model for a dimerizer inducible system (See Col 76, Example 5). In example 5, mice were injected with the disclosed AAV vectors. The mice were further injected with rapamycin which acts as the dimerizer for the inducible system (See Col 76, ln 25 - Col 77, ln 43). Additionally, Wilson et al 1 discloses the AAV can be formulated in one or more physiologically acceptable carriers or excipients administration by injection (See Col. 50, lns 50-54). Regarding claims 1, 3, 6, 7, and 13: Wilson et al 1 teaches an AAV vector expressing a FRB-TA fusion domain (reads on an activation domain comprising a FRB domain and a transactivation domain), a ZFHD-FKBP domain comprising two or three copies of FKBP (reads on (c)), eight copies of the binding site for ZFHD followed by a minimal IL-2 promoter (reads on (d)), and a Cre operably linked to a IL-2 minimal promoter and under control of a CMV promoter (reads on (a) and a therapeutic product). The AAV vector of Wilson et al 1 has a nucleic acid sequence of 8379 bp and is regulated by rapamycin. Therefore, Wilson et al 1 discloses a nucleic acid molecule comprising an inducible gene expression system wherein the presence of an effective amount of rapamycin induces express of the transgene in a host cell. Wilson et al 1 does not teach a canine or feline transactivation domain and an FRB domain of a canine or feline. Although Wilson et al 1 does not teach a nucleic acid molecule comprising a canine or feline transactivation domain or FRB domain, it would have been prima facie obvious to substitute the human FRB-TA fusion protein with a canine or feline FRB and p65 (reads on transactivation domain) in the vector of Wilson et al 1 in order to use the vector to express Cre in a canine or feline. One would have expected the canine or feline FRB and p65 to work equivocally with the human FRB-TA because the FRB-TA fusion protein comprises an FRB and a p65 transactivation domain. Substitution of one element for another known in the field, wherein the result of the substitution would have been predictable is considered to be obvious. See KSR International Co. V Teleflex Inc 82 USPQ2d 1385 (US2007) at page 1395. Regarding claim 2: following the discussion of claim 1 above, Wilson et al 1 teaches the vector comprises 5’ and 3’ AAV ITRs. Regarding claim 4: Following the discussion of claim 1 above, Wilson et al 1 teaches an AAV comprising two or three FKBP sequences. Wilson et al further discloses five FKBP sequences one of which is a wild-type sequence (reads on a native sequence) Wilson et al 1 does not disclose one of the FKBP sequences it a native FKBP gene sequence. Given that Wilson et al teaches an AAV which can comprise three FKBP sequences, and Wilson et al further teaches FKBP sequences, it would have been prima facie obvious to include any three of the disclosed sequences in in embodiments where the vector comprises three FKBP sequences. Regarding claim 5: Following the discussion of claim 1 above, Wilson et al 1 teaches an FRB-TA transactivation domain which comprises an FRB fused to a portion of NF-kB p65. Regarding claims 8 and 10: Following the discussion of claim 1 above, the AAV of Wilson et al 1 comprises a CMV promoter which reads on a constitutive promoter. Regarding claim 11: Following the discussion of claim 1 above, the AAV of Wilson et al 1 comprises an IRES sequence. Regarding claim 12: following the discussion of claim 1 above, the AAV of Wilson et al 1 comprises a Z8I domain which comprise 8 copies of the binding site for ZFHD. Regarding claim 14: Following the discussion of claim 1 above, Wilson et al 1 teaches an FRB domain of SEQ ID NO: 29 which is 98.9% similarity to SEQ ID NO: 2 of the instant application which reads on sharing at least 90% similarity with SEQ ID NO: 1 or SEQ ID NO: 2. See sequence alignment at end of office action. Regarding claims 15 and 28: Following the discussion of claim 1 above, Wilson et al 1 discloses embodiments in which the AAV comprises three FKBP sequences. Wilson et al 1 further discloses FKBP sequences having SEQ ID NOs: 53, 56, and 57. It would have been prima facie obvious to use any of the disclosed sequences of FBKP in the vector of Wilson et al 1 (See rejection of claim 4 above). Wilson et al 1 does not disclose a vector (reads on nucleic acid molecule) comprising sequences of SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9 of the instant application. However, SEQ ID NO: 53 of Wilson et al 1 is 99.4% similar to SEQ ID NO: 7, SEQ ID NO: 57 of Wilson et al 1 is 99.7% similar to SEQ ID NO: 8 and SEQ ID NO: 56 of Wilson et al 1 is 99.4% similar to SEQ ID NO: 9. Given the close structural similarity of the sequences which all encode FBKP and thus have the same utility, the FKBP sequences of Wilson et al 1 are obvious variants of SEQ ID NOs: 7-9. See MPEP 2144.09(I) and sequence alignments below. Regarding claim 16: Following the discussion of claim 1 above, Wilson et al 1 discloses the transcriptional units can be packaged into the AAV using any AAV capsid which reads on a recombinant AAV having an AAV capsid and said capsid having packaged the nucleic acid molecule. Regarding claim 17: Following the discussion of claims 1 and 16 above, Wilson et al 1 discloses the AAV can be in a formulation with a physiologically acceptable carrier which reads on a pharmaceutically acceptable carrier. Regarding claim 18: Following the discussion of claims 1, 16, and 17 above, Wilson et al 1 injects the AAV of claim 17 into mice which reads on administering the composition of claim 17 to a subject in need thereof. Wilson et al further injects an effective amount of rapamycin into the mice to act as a dimerizer which reads on delivering an effective amount of rapamycin to induce expression of the therapeutic product in a host cell of the subject. Thus, Wilson 1 et al teaches a therapeutic regimen for regulating the dose of a therapeutic product. Regarding claim 27: Following the discussion of claim 1 above, Wilson et al 1 discloses an AAV comprising a ZFHD sequence of SEQ ID NO: 45 which is 98.5% similar to SEQ ID NO: 30 of the instant application. Wilson et al 1 does not disclose a ZFHD sequence which is identical to SEQ ID NO: 30. However, given close structural similarity of the SEQ ID NO: 45 of Wilson et al with SEQ ID NO: 30 both of which encode a ZFHD and thus have the same utility, SEQ ID NO: 45 of Wilson et al 1 is an obvious variant of SEQ ID NO: 30. See MPEP 214409(I) and sequence alignments below. Regarding claim 29: Following the discussion of claims 1 and 12 above, Wilson et al 1 discloses an AAV having a Z8I domain (reads on 8XZFHD) comprising a sequence of SEQ ID NO: 32 which is 100% similar to SEQ ID NO: 31 of the instant application. See sequence alignment at end of office action. Claims 1-8, 10-18, and 27-30 are rejected under 35 U.S.C. 103 as being unpatentable over Wilson et al 1 (US9315825B2) in view of Wilson et al 2 (WO2017106244A1). The teachings of Wilson et al 1 are set forth above. Wilson et al 1 renders claims 1-8, 10-18, and 27-29 obvious. Regarding claim 3: Wilson et al 1 renders claim 3 obvious. Additionally, Wilson et al 2 teaches including FKBP sequences that are at least 15% divergent from one another minimizes recombination (See pg. 9, lns 11-18). Therefore, it would have been prima facie obvious to include FKBP sequences which are at least 15% divergent in the vector of Wilson et al 1. One would have been motivated to include FKBP sequences which are at least 15% divergent in the vector of Wilson et al 1 because Wilson et al 2 teaches this minimizes recombination. There is a reasonable expectation of success because both Wilson et al 1 and Wilson et al 2 teach vectors comprising FKBP sequences used to regulate expression. Regarding claim 30: Following the discussion of claim 1 above, Wilson et al 1 discloses an AAV comprising an IL-2 minimal promoter sequence. Wilson et al 1 does not disclose the IL-2 minimal promoter sequence is SEQ ID NO: 11 or SEQ ID NO: 12 of the instant application. Wilson et al 2 discloses an AAV comprising an IL-2 minimal promoter with a sequence of SEQ ID NO: 7 which is 100% identical to SEQ ID NO: 11 of the instant application (See pg. 31 lns 4-6 and sequence alignment at end of office action). Given that both Wilson et al 1 and Wilson et al 2 teach AAVs comprising an IL-2 minimal promoter sequence, it would have been prima facie obvious to substitute the IL-2 minimal promoter sequence of Wilson et al 1 with SEQ ID NO: 7 of Wilson et al 2 which encodes an IL-2 minimal promoter region. One would have expected SEQ ID NO: 7 of Wilson et al 2 to work equivocally with the IL-2 minimal promoter sequence of Wilson et al 1 in the vector of Wilson et al 1 because SEQ ID NO: 7 of Wilson et al 2 encodes an IL-2 minimal promoter sequence. Substitution of one element for another known in the field, wherein the result of the substitution would have been predictable is considered to be obvious. See KSR International Co. V Teleflex Inc 82 USPQ2d 1385 (US2007) at page 1395. Claims 1-3, 5-7, 9, 11-13, and 16-18 are rejected under 35 U.S.C. 103 as being unpatentable over Wilson et al 3 (WO2018204626A1). Wilson et al 3 discloses an all-in-one vector comprising a nucleic acid molecule encoding from 5’ to 3’ an ITR, a liver specific promoter, an activation domain comprising an FRB and a p65, an IRES, a DNA binding domain fusion comprising a ZFHD1 and two copies of FKBP, 8 copies of ZFHD1 binding sites, an IL-2 minimal promoter, a meganuclease, and an ITR (See Fig. 2). Expression of the nuclease in the vector of Wilson et al 3 is under control of a regulatable promoter that is activated by rapamycin or a rapalog (See claims 1 and 5). The vectors can be AAV vectors and the AAV vectors can be formulated with a physiologically acceptably carrier for use in gene therapy (See pg. 2 lns 1-3 and pg. 24, lns 22-34). Regarding claim 1, 3, 6, 7, and 13: Wilson et al 3 discloses a nucleic acid molecule encoding an inducible gene expression system comprising a meganuclease with is operably linked to an IL-2 promoter (reads on part (a), an activation domain comprising an FRB and a p65, a DNA binding domain comprising 2 copies of FKBP (reads on part (c)), and eight copies of ZFHD1 binding sites followed by an IL-2 minimal promoter and under control of a liver specific promoter (reads on part (d)). The ITR sequences can be AAV2 sequences or from other AAV sources (See pg. 17, lns2-4).Wilson et al further discloses expression of the nuclease is induced by rapamycin or a rapalog. Wilson et al 3 does not disclose the activation domain comprises a canine or feline FRB or a canine or feline transactivation domain. Although Wilson et al 3 does not teach a nucleic acid molecule comprising a canine or feline transactivation domain or FRB domain, it would have been prima facie obvious to substitute the human FRB-TA fusion protein with a canine or feline FRB and p65 (reads on transactivation domain) in the vector of Wilson et al 3 in order to use the vector to express Cre in a canine or feline. One would have expected the canine or feline FRB and p65 to work equivocally with the human FRB-TA because the FRB-TA fusion protein comprises an FRB and a p65 transactivation domain. Substitution of one element for another known in the field, wherein the result of the substitution would have been predictable is considered to be obvious. See KSR International Co. V Teleflex Inc 82 USPQ2d 1385 (US2007) at page 1395. Regarding claim 2: Following the discussion of claim 1 above Wilson et al 3 discloses a 5’ and a 3’ ITR. Wilson et al 3 further discloses the ITR sequences are from AAV2 or other AAV sources which reads on comprising a 5’ AAV ITR and a 3’ AAV ITR. Regarding claim 5: Following the discussion of claim 1 above, Wilson et al 3 discloses the FRB-P65 activation domain fusion protein comprises an FKBP fused to a portion of human NF-kB p65 as a transcription activator which reads on the transactivation domain comprises a portion of NF-kB p65. Regarding claim 9: Following the discussion of claim 1 above, the vector of Wilson et al 3 comprises a liver specific promoter which reads on the promoter is a tissue specific promoter. Regarding claim 11: Following the discussion of claim 1 above, the vector of Wilson et al 3 comprises an IRES. Regarding claim 12: following the discussion of claim 1 above, the vector of Wilson et al comprises 8 copies of the binding site for ZFHD1 which reads on 8 copies of the binding site for ZFHD. Regarding claim 16: Following the discussion of claim 1 above, Wilson et al 3 discloses in some embodiments the vector is an AAV vector. Wilson et al 3 further discloses AAV vectors comprise an AAV capsid which packages the expression cassettes (See pg. 16 lns25-27). Thus, Wilson et al 3 discloses a recombinant AAV having an AAV capsid having packaged therein the nucleic acid molecule of claim 1. Regarding claim 17: Following the discussion of claims 1 and 16 above, Wilson et al 3 teaches in some embodiments the vector is an AAV. Wilson et al 3 further discloses the vector can be formulated with a physiologically acceptable carrier which reads on a pharmaceutically acceptable carrier. Regarding claim 18: Wilson et al 3 discloses in some embodiments, the vector (reads on composition of claim 17) is co-administered to a subject along with an effective dose of rapamycin or a rapalog, to treat a disorder (See pg. 23, lns 16-21 and pg. 9, lns 20-22). Therefore, Wilson et al 3 discloses a therapeutic regimen for regulating the dose of a therapeutic product. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to MARISOL A O'NEILL whose telephone number is (571)272-2490. The examiner can normally be reached Monday - Friday 7:30 - 5:00 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at (571) 272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /MARISOL ANN O'NEILL/Examiner, Art Unit 1633 /ALLISON M FOX/Primary Examiner, Art Unit 1633 Sequence Alignments Qy (SEQ ID NO: 2) vs. Db (Wilson et al 1, SEQ ID NO: 29) Query Match 98.3%; Score 274.2; Length 900; Best Local Similarity 98.9%; Matches 276; Conservative 0; Mismatches 3; Indels 0; Gaps 0; Qy 1 ATGGACTATCCTGCTGCCAAGAGGGTCAAGTTGGACTCTAGAATCCTCTGGCATGAGATG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGGACTATCCTGCTGCCAAGAGGGTCAAGTTGGACTCTAGAATCCTCTGGCATGAGATG 60 Qy 61 TGGCATGAAGGCCTGGAAGAGGCATCTCGTTTGTACTTTGGGGAAAGGAACGTGAAAGGC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 TGGCATGAAGGCCTGGAAGAGGCATCTCGTTTGTACTTTGGGGAAAGGAACGTGAAAGGC 120 Qy 121 ATGTTTGAGGTGCTGGAGCCCTTGCATGCTATGATGGAACGGGGCCCCCAGACTCTGAAG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 ATGTTTGAGGTGCTGGAGCCCTTGCATGCTATGATGGAACGGGGCCCCCAGACTCTGAAG 180 Qy 181 GAAACATCCTTTAATCAGGCCTATGGTCGAGATTTAATGGAGGCCCAAGAGTGGTGCAGG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GAAACATCCTTTAATCAGGCCTATGGTCGAGATTTAATGGAGGCCCAAGAGTGGTGCAGG 240 Qy 241 AAGTACATGAAATCAGGGAACGTCAAGGACCTCACCCAA 279 |||||||||||||||||||| |||||||||||| |||| Db 241 AAGTACATGAAATCAGGGAATGTCAAGGACCTCCTCCAA 279 Qy (SEQ ID NO: 7) vs. Db (Wilson et al 1, SEQ ID NO: 53) Query Match 99.0%; Score 317.8; Length 324; Best Local Similarity 99.4%; Matches 319; Conservative 0; Mismatches 2; Indels 0; Gaps 0; Qy 1 GGAGTGCAGGTGGAAACCATCTCCCCAGGAGACGGGCGCACCTTCCCCAAGCGCGGCCAG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4 GGAGTGCAGGTGGAAACCATCTCCCCAGGAGACGGGCGCACCTTCCCCAAGCGCGGCCAG 63 Qy 61 ACCTGCGTGGTGCACTACACCGGGATGCTTGAAGATGGAAAGAAATTTGATTCCTCCCGG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 64 ACCTGCGTGGTGCACTACACCGGGATGCTTGAAGATGGAAAGAAATTTGATTCCTCCCGG 123 Qy 121 GACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 124 GACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAA 183 Qy 181 GAAGGGGTTGCCCAGATGAGTGTGGGTCAGAGAGCCAAACTGACTATATCTCCAGATTAT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 184 GAAGGGGTTGCCCAGATGAGTGTGGGTCAGAGAGCCAAACTGACTATATCTCCAGATTAT 243 Qy 241 GCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCAAACGCCACTCTCGTCTTCGAT 300 ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| Db 244 GCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTCGTCTTCGAT 303 Qy 301 GTGGAGCTTCTAAAACTGGAA 321 ||||||||||||||||||||| Db 304 GTGGAGCTTCTAAAACTGGAA 324 Qy (SEQ ID NO: 8) vs. Db (Wilson et al 1, SEQ ID NO: 57) Query Match 99.5%; Score 319.4; Length 321; Best Local Similarity 99.7%; Matches 320; Conservative 0; Mismatches 1; Indels 0; Gaps 0; Qy 1 GGCGTTCAGGTGGAAACCATCAGTCCAGGGGATGGCCGAACTTTTCCAAAGAGAGGGCAG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GGCGTTCAGGTGGAAACCATCAGTCCAGGGGATGGCCGAACTTTTCCAAAGAGAGGGCAG 60 Qy 61 ACTTGCGTCGTGCATTATACTGGTATGCTGGAGGATGGGAAAAAGTTCGACTCTTCCAGA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 ACTTGCGTCGTGCATTATACTGGTATGCTGGAGGATGGGAAAAAGTTCGACTCTTCCAGA 120 Qy 121 GATCGGAACAAACCATTCAAATTCATGCTCGGGAAACAGGAAGTTATCCGCGGATGGGAG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GATCGGAACAAACCATTCAAATTCATGCTCGGGAAACAGGAAGTTATCCGCGGATGGGAG 180 Qy 181 GAGGGCGTGGCCCAGATGTCCGTGGGCCAGCGCGCCAAGCTAACCATCTCCCCAGACTAC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GAGGGCGTGGCCCAGATGTCCGTGGGCCAGCGCGCCAAGCTAACCATCTCCCCAGACTAC 240 Qy 241 GCCTACGGAGCCACCGGACACCCCGGTATCATACCCCCAAACGCCACCCTTGTGTTTGAC 300 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Db 241 GCCTACGGAGCCACCGGACACCCCGGTATCATACCCCCACACGCCACCCTTGTGTTTGAC 300 Qy 301 GTGGAACTGCTTAAGCTAGAG 321 ||||||||||||||||||||| Db 301 GTGGAACTGCTTAAGCTAGAG 321 Qy (SEQ ID NO: 9) vs. Db (Wilson et al 1, SEQ ID NO: 56) Query Match 99.0%; Score 320.8; Length 324; Best Local Similarity 99.4%; Matches 322; Conservative 0; Mismatches 2; Indels 0; Gaps 0; Qy 1 GGCGTGCAGGTCGAGACCATCAGCCCCGGCGACGGCCGCACCTTTCCCAAGAGAGGCCAG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GGCGTGCAGGTCGAGACCATCAGCCCCGGCGACGGCCGCACCTTTCCCAAGAGAGGCCAG 60 Qy 61 ACTTGCGTGGTCCACTACACCGGCATGCTGGAGGACGGCAAGAAGTTCGACAGCAGCCGC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 ACTTGCGTGGTCCACTACACCGGCATGCTGGAGGACGGCAAGAAGTTCGACAGCAGCCGC 120 Qy 121 GACCGCAACAAGCCCTTCAAGTTCATGCTGGGCAAACAGGAAGTGATCCGCGGCTGGGAG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GACCGCAACAAGCCCTTCAAGTTCATGCTGGGCAAACAGGAAGTGATCCGCGGCTGGGAG 180 Qy 181 GAAGGCGTGGCTCAGATGAGCGTGGGGCAGCGGGCCAAGCTGACCATCAGCCCCGACTAT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GAAGGCGTGGCTCAGATGAGCGTGGGGCAGCGGGCCAAGCTGACCATCAGCCCCGACTAT 240 Qy 241 GCCTACGGCGCCACCGGCCACCCCGGCATCATCCCCCCCAACGCCACCCTCGTGTTCGAC 300 ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| Db 241 GCCTACGGCGCCACCGGCCACCCCGGCATCATCCCCCCCCACGCCACCCTGGTGTTCGAC 300 Qy 301 GTGGAGCTGCTGAAGCTGGAGTGA 324 |||||||||||||||||||||||| Db 301 GTGGAGCTGCTGAAGCTGGAGTGA 324 Qy (SEQ ID NO: 30) vs. Db (Wilson et al 1, SEQ ID NO: 45) Query Match 97.6%; Score 395.4; Length 411; Best Local Similarity 98.5%; Matches 399; Conservative 0; Mismatches 6; Indels 0; Gaps 0; Qy 1 ATGGACTATCCTGCTGCCAAGAGGGCCAGATTGGACTCTAGAGAACGCCCATATGCTTGC 60 ||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| Db 1 ATGGACTATCCTGCTGCCAAGAGGGTCAAGTTGGACTCTAGAGAACGCCCATATGCTTGC 60 Qy 61 CCTGTCGAGTCCTGCGATCGCCGCTTTTCTCGCTCGGATGAGCTTACCCGCCATATCCGC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CCTGTCGAGTCCTGCGATCGCCGCTTTTCTCGCTCGGATGAGCTTACCCGCCATATCCGC 120 Qy 121 ATCCACACAGGCCAGAAGCCCTTCCAGTGTCGAATCTGCATGCGTAACTTCAGTCGTAGT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 ATCCACACAGGCCAGAAGCCCTTCCAGTGTCGAATCTGCATGCGTAACTTCAGTCGTAGT 180 Qy 181 GACCACCTTACCACCCACATCCGCACCCACACAGGCGGCGGCCGCAGGAGGAAGAAACGC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GACCACCTTACCACCCACATCCGCACCCACACAGGCGGCGGCCGCAGGAGGAAGAAACGC 240 Qy 241 ACCAGCATAGAGACCAACATCCGTGTGGCCTTAGAGAAGAGTTTCTTGGAGAATCAAAAG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 ACCAGCATAGAGACCAACATCCGTGTGGCCTTAGAGAAGAGTTTCTTGGAGAATCAAAAG 300 Qy 301 CCTACCTCGGAAGAGATCACTATGATTGCTGATCAGCTCTCCATGGAAAAAGAGGTGATT 360 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Db 301 CCTACCTCGGAAGAGATCACTATGATTGCTGATCAGCTCAATATGGAAAAAGAGGTGATT 360 Qy 361 CGTGTTTGGTTCTGTAACCGCCGCCAGAAAGAAAAAAGAATCAAC 405 ||||||||||||||||||||||||||||||||||||||||||||| Db 361 CGTGTTTGGTTCTGTAACCGCCGCCAGAAAGAAAAAAGAATCAAC 405 Qy (SEQ ID NO: 31) vs. Db (Wilson et al 1, SEQ ID NO: 32) Query Match 100.0%; Score 145; Length 145; Best Local Similarity 100.0%; Matches 145; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AATGATGGGCGCTCGAGTAATGATGGGCGGTCGACTAATGATGGGCGCTCGAGTAATGAT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 AATGATGGGCGCTCGAGTAATGATGGGCGGTCGACTAATGATGGGCGCTCGAGTAATGAT 60 Qy 61 GGGCGTCTAGCTAATGATGGGCGCTCGAGTAATGATGGGCGGTCGACTAATGATGGGCGC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGGCGTCTAGCTAATGATGGGCGCTCGAGTAATGATGGGCGGTCGACTAATGATGGGCGC 120 Qy 121 TCGAGTAATGATGGGCGTCTAGAAC 145 ||||||||||||||||||||||||| Db 121 TCGAGTAATGATGGGCGTCTAGAAC 145 Qy (SEQ ID NO: 11) vs. Db (Wilson et al 2, SEQ ID NO: 7) Query Match 100.0%; Score 121; Length 121; Best Local Similarity 100.0%; Matches 121; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AACATTTTGACACCCCCATAATATTTTTCCAGAATTAACAGTATAAATTGCATCTCTTGT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 AACATTTTGACACCCCCATAATATTTTTCCAGAATTAACAGTATAAATTGCATCTCTTGT 60 Qy 61 TCAAGAGTTCCCTATCACTCTCTTTAATCACTACTCACAGTAACCTCAACTCCTGCCACA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 TCAAGAGTTCCCTATCACTCTCTTTAATCACTACTCACAGTAACCTCAACTCCTGCCACA 120 Qy 121 A 121 | Db 121 A 121
Read full office action

Prosecution Timeline

Jan 26, 2023
Application Filed
Aug 27, 2025
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600987
COMPOSITIONS AND METHODS FOR CIRCULAR RNA EXPRESSION
2y 5m to grant Granted Apr 14, 2026
Patent 12582678
METHOD FOR TREATING PLEURAL EFFUSION
2y 5m to grant Granted Mar 24, 2026
Study what changed to get past this examiner. Based on 2 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
47%
Grant Probability
99%
With Interview (+75.0%)
3y 7m
Median Time to Grant
Low
PTA Risk
Based on 17 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month