Prosecution Insights
Last updated: April 19, 2026
Application No. 18/007,007

ATXN2 IRNA COMPOSITIONS AND METHODS OF USE THEREOF FOR TREATING OR PREVENTING ATXN2-ASSOCIATED NEURODEGENERATIVE DISEASES

Non-Final OA §102§103§112
Filed
Jan 26, 2023
Examiner
WHITEMAN, BRIAN A
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Alnylam Pharmaceuticals, Inc.
OA Round
1 (Non-Final)
68%
Grant Probability
Favorable
1-2
OA Rounds
2y 10m
To Grant
85%
With Interview

Examiner Intelligence

Grants 68% — above average
68%
Career Allow Rate
775 granted / 1138 resolved
+8.1% vs TC avg
Strong +17% interview lift
Without
With
+17.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 10m
Avg Prosecution
50 currently pending
Career history
1188
Total Applications
across all art units

Statute-Specific Performance

§101
5.9%
-34.1% vs TC avg
§103
29.7%
-10.3% vs TC avg
§102
20.7%
-19.3% vs TC avg
§112
24.6%
-15.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1138 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of group I (claims 1-9, 12, 14, and 76) in the reply filed on 11/6/25 is acknowledged. Claims 79, 80, 86, 87, 91 and 93 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 11/6/25. Applicant's election with traverse of species (SEQ ID NO: 1615 and 1558) in the reply filed on 11/6/25 is acknowledged. The traversal is on the ground(s) that the elected species are the unmodified sequences of duplex AD-104730 in table 6 and SEQ ID NO: 1444 and 1387 are chemically modified sequences for the same duplex and the antisense strand of duplex AD-1044730 shared 22 contiguous nucleotides with duplex AD-1044729 (SEQ ID NO: 1614 and 1557) and corresponding chemically modified sequence for AD-1044729 (SEQ ID NO: 1386 and SEQ ID NOL 1443). This is found partially persuasive and duplex AD-10447219 and the chemically modified version of this duplex are rejoined with the elected species and searched. However, not all of the species are rejoined with the elected species because applicant only argues searching one additional species and does not provide arguments for why any other species should be searched with the elected species. The requirement is still deemed proper and is therefore made FINAL. The non-elected sequences in tables 2, 3, 5, 6, 9 and 10 in Claims 2 and 7 now cancelled are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected species, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 11/6/25. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 2-4, 8-9, 12, 14, and 76 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The claimed invention is directed to a double stranded ribonucleic acid (dsRNA. also known as siRNA) for inhibiting ATXN2 gene expression, wherein the dsRNA comprises a sense and an antisense strand, wherein the antisense strand comprises a region of complementarity comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the antisense sequence set forth as SEQ ID NO: 1615 or 1614. SEQ ID NOs: 1614 and 1615 are 23 nucleotides in length. The broadest reasonable interpretation of the limitation ‘the antisense strand comprises a region of complementarity comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the antisense strand set forth as SEQ ID NO: 1615 or 1614” reads on a sequence that has at least 15 nucleotides and can have 3 or less nucleotides that are different from SEQ ID NO: 1615 or 1614. For example, a dsRNA that has an antisense strand that has at least 15 nucleotides in length and has at least 12 nucleotides of SEQ ID NO: 1614 or 1615 would be embraced by the claimed product. The instant disclosure does not appear to provide written support for the genus dsRNA agents having at least 12 nucleotides of SEQ ID NO: 1614 or 1615 and at least 15 contiguous nucleotides. The state of the art (e.g., He et al. Scientific Reports 7:44836, pages 1-13, 2017 and Xu et al. Gene 910, 148330, pages 1-9, 2024) shows that siRNA are usually 19-21 nucleotides in length (with at least 19 nucleotides complementary to a target region of a gene or a mRNA). There are several methods (algorithms) to design siRNA known in the art, but the function of each siRNA has to be empirically determine. The specification provides hundreds of dsRNA having the desired biological activity, wherein the dsRNA are at least 19 contiguous nucleotides of a target region of an ATXN2 gene (see pages 182-295). The specification further indicates that ATXN2 gene (e.g., human) is well known in the prior art (page 182). However, the specification does not appear to describe what nucleotides of SEQ ID NO: 1614 or 1615 are considered essential for inhibiting expression of a ATXN2 gene. While one of skill in the art can make a dsRNA agent having the structural limitations of the instant claims, the skilled artisan would have to further experiment with each dsRNA to determine if it has the desired biological activity (inhibiting expression of ATXN2). See MPEP 2163(II)(3)(a). "For example, disclosure of an antigen fully characterized by its structure, formula, chemical name, physical properties, or deposit in a public depository does not, without more, provide an adequate written description of an antibody claimed by its binding affinity to that antigen, even when preparation of such an antibody is routine and conventional." See Amgen Inc. V. Sanofi, 872 F.3d 1367, 1378, 124 USPQ2d 1354, 1361 (Fed. Cir. 2017)("knowledge of the chemical structure of an antigen [does not give] the required kind of structure- identifying information about the corresponding antibodies"); see also Centocor Ortho Biotech, Inc. V. Abbott Labs., 636 F.3d 1341, 1351-52, 97 USPQ2d 1870, 1877 (Fed. Cir. 2011) (patent disclosed the antigen the claimed antibody was supposed to bind, but did not disclose any antibodies with the specific claimed properties). While the specification and instant claims contemplated the dsRNA agents having the functional limitation, the specification does not appear to describe any agents that are less than 19 contiguous nucleotides of SEQ ID NO: 1614 or 1615 and actually inhibit ATXN2 gene expression. The specification of the instant disclosure provides written support for the dsRNA agent having a sense and antisense strand having at least 19 contiguous nucleotides with 0 or 1 mismatch from the sequence set forth in SEQ ID NOs: 1558 or 1557 and/or SEQ ID NOs: 1614 or 1615. In view of the reasons set forth above, the only description of the function of the genus of dsRNA in the claims or specification is a contemplation of the structure of the dsRNA having the desired biological activity. There is no description in the specification of any specific nucleotides of the dsRNA comprising the instant SEQ ID NOs: that must be conserved to observe the functional limitation. There is no identification of specific portions of the dsRNA that can be changed while still possessing structure and desired function. The description of dsRNA having at least 19 contiguous nucleotides of a region of an ATXN2 gene is not considered to be a representative number of species for the encompassed genus. In view of the foregoing, it is clear that the specification of the instant disclosure fails to convey to the skilled artisan that the applicant had possession of the claimed genus of dsRNA in claims 2, 3, 4, 8, 9, 12, 14, and 76 as of the effective filing date. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 14 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 14 recites the limitation "the base pair at the I position of the 5’ end of the antisense strand" in (mm). There is insufficient antecedent basis for this limitation in the claim. This could be a typographical error and “I” should be 1. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 2, 4-5, 12, 14, and 76 are rejected under 35 U.S.C. 102(a)(1) and (2) as being anticipated by Ionis Pharmaceuticals (WO 2020/023737 A, published on 1/30/20 and EFD to 7/25/18) cited on an IDS. Claims 34-36 on page 207 disclose a pharmaceutical composition comprising an oligomeric compound of any of claims 1-33 or an oligomeric duplex of claim 34 and a pharmaceutically acceptable carrier or diluent. Claim 2 recited an oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12-20 contiguous nucleobase of SEQ ID NO: 30-3319. SEQ ID NO: 2248 reads on a strand of instant SEQ ID NO: 1614. SEQ ID NO: 504 reads on an antisense strand of instant SEQ ID NO: 1558. Qy is instant SEQ ID NO: 1614 and SEQ ID NO: 2248 is Db: Qy 4 CUUAAAAGUUGAACCACUGU 23 Db 1 CTTAAAAGTTGAACCACTGT 20 Qy is SEQ ID NO: 1558 and SEQ ID NO: 504 is Db: Qy 3 GGUUCAACUUUUAAGUUAA 21 Db 20 GGTTCAACTTTTAAGTTAA 2 Thus, when one of skill in the art makes the products in claims 34-36, they would make a pharmaceutical composition comprising a dsRNA comprising one strand having SEQ ID NO: 504 or 2248 and the other strand being the complement of either SEQ ID NO:; and a pharmaceutical acceptable carrier. This would read on the product in instant claim 1. See MPEP 2131.02(II). A REFERENCE THAT CLEARLY NAMES THE CLAIMED SPECIES ANTICIPATES THE CLAIM NO MATTER HOW MANY OTHER SPECIES ARE NAMED. Although ‘737 is silent with respect to the limitation in the preamble (agent for inhibiting expression of an ATXN2 gene) of the instant claims, ‘737 anticipates all of the claimed structural limitations, so the functional effects of the claimed product are considered to be inherent in the product taught by ‘737. Where, as here, the claimed and prior art products are identical or substantially identical, or are produced by identical or substantially identical processes, the PTO can require an applicant to prove that the prior art products do not necessarily or inherently possess the characteristics of his claimed product. See In re Ludtke 441 F.2d 660, 169 USPQ 563 (CCPA 1971). Whether the rejection is based on "inherency" under 35 USC 102, or "prima facie obviousness" under 35 USC 103, jointly or alternatively, the burden of proof is the same, and its fairness is evidenced by the PTO's inability to manufacture products or to obtain and compare prior art products. In re Best, Bolton, and Shaw, 195 USPQ 430, 433 (CCPA 1977) citing In re Brown, 59 CCPA 1036, 459 F.2d 531, 173 USPQ 685(1972). With respect to the limitation of at least one modified nucleotide as set forth in instant claim 14; claims 2 and 5-14 of ‘737 recites a modified oligonucleotide. When a skilled artisan makes the duplex comprising claims 2 or 5-14, the duplex would have at least one chemical modification as set forth in the instant claims. With respect to the ‘wherein’ clause in claim 12 is directed to an intended use or a functional limitation of the dsRNA when measures in a plasma binding assay. See MPEP 2111.04(I). Claim 12 does not add any structural limitations to the claim to limit the dsRNA and distinguish it from reading on the duplex taught by ‘737. Thus, the product taught by ‘737 would have the properties set forth in instant claim 12. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 2-5, 8, 9, 12, 14, and 76 are rejected under 35 U.S.C. 103 as being unpatentable over Rossomando et al. (US 20140004565). ‘565 discloses: In some embodiments, the invention provides at least one siRNA directed to any one of the CHO cell transcriptome transcript set forth in any of the tables presented herein, see e.g., Tables 1-16, 21-25, 27-30, 52-61, 65 or 66. In some embodiments, the siRNA is selected from the group of siRNAs set forth in Tables 1-16, 21-31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 50, 51-61, 63-65 or 66. In some embodiments, not all transcript SEQ ID NOs are present in the tables described herein. In some embodiments, the RNA effector molecule comprises an antisense strand comprising at least 16 contiguous nucleotides (e.g., at least 17, at least 18, at least 19 nucleotides) of the nucleotide sequence selected from the group consisting of SEQ ID NOs:9772-3152399 and SEQ ID NOs:3161121-3176783. Additional targets that can be modulated for improved quality/quantity of expression are set forth herein. One can readily determine functional groups to classify a transcript to by homology to sequences known to have a particular function. In one embodiment one uses a known functional domain and looks for homology of at least 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%. See for example Tables 10-16, which correlate the SEQ ID NO transcript with a description of encoded protein and function. For the transcripts disclosed herein whose function is not specifically recited herein, one of skill in the art can easily compare (using known algorithms and programs). See paragraphs 434-5. Qy is instant SEQ ID NO: 1614 and Db is SEQ ID NO: 175955. Qy 3 ACUUAAAAGUUGAACCACU 21 Db 1 ACUUAAAAGUUGAACCACU 19 Qy is SEQ ID NO: 1614 and Db is SEQ ID NO: 176086. Qy 1 UAACUUAAAAGUUGAA 16 Db 4 UAACUUAAAAGUUGAA 19 In addition, ‘565 teaches attaching a chemically modifying the siRNA to decrease degradation of the siRNA in a cell (paragraphs 468- 483). Modifications include, for example, (a) end modifications, e.g., 5' end modifications (phosphorylation, conjugation, inverted linkages, etc.), or 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); (b) base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; (c) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar; as well as (d) internucleoside linkage modifications, including modification or replacement of the phosphodiester linkages. RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone (paragraph 469). Paragraphs 485 discloses attaching a lipid moiety, such as a cholesterol moiety to the RNA effector. ‘565 teaches an RNA effector molecule comprises an antisense strand comprising at least 16 contiguous nucleotides (e.g., at least 17, at least 18, at least 19 nucleotides) of the nucleotide sequence selected from the group consisting of SEQ ID NOs:9772-3152399 and SEQ ID NOs:3161121-3176783. However, ’565 does not specifically teach that the effector molecule is a siRNA comprising a sense and antisense strand, wherein the antisense strand has at least 16 contiguous nucleotides of SEQ ID NO: 175955. It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to use a siRNA comprising SEQ ID NO: 175955 as the RNA effector, namely to arrive at the claimed invention. ‘565 makes obvious that siRNA having SEQ ID NO: 175955 is an additional target that can be modulated for improved quality/quantity of expression. See also MPEP 2143(I)(G) Some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Although ‘565 is silent with respect to the limitation in the preamble (agent for inhibiting expression of an ATXN2 gene) of the instant claims, ‘565 makes obvious all of the claimed structural limitations, so the functional effects of the claimed product are considered to be inherent in the product made obvious by ‘565. In addition, one of ordinary skill in the art would have been motivated to conjugate a lipid to the 5’ and/or 3’ end of a strand of the siRNA molecule to assist in delivery to the siRNA to a cell. Furthermore, the siRNA made obvious by ‘565 has an antisense and a sense strand which are 19 nucleotides and one of ordinary skill in the art would reasonably determine that siRNA reads on a limitation in instant claim 14. A person of ordinary skill in the art would have been motivated to make a pharmaceutical composition the siRNA and a pharmaceutical carrier to store or delivery the siRNA to a cell. With respect to the ‘wherein’ clause in claim 12 is directed to an intended use or a functional limitation of the dsRNA when measures in a plasma binding assay. See MPEP 2111.04(I). Instant Claim 12 does not add any structural limitations to the claim to limit the dsRNA and distinguish it from reading on the duplex taught by ‘565. Thus, the product made obvious by ‘565 would have the properties set forth in instant claim 12. Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Allowable Subject Matter Claims 6-7 and 98-100 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. With respect to claim 6, the prior art does not teach or suggest making a dsRNA comprising a sense strand having at least 21 contiguous nucleotides with 0 or 1 mismatches with the sense strand set forth in SEQ ID NO: 1558 or 1557 or the antisense strand set forth in SEQ ID NO: 1614 or 1615, wherein the sense strand is complementary to at least 21 contiguous nucleotides of the antisense strand. The closest prior art is SEQ ID NO: 2248 in ‘737. ‘737 teaches that the sequence is a 20-mer that reads on 20/23 nucleotides of the antisense strand of the claimed dsRNA. Antisense oligomers have a different function compared to dsRNA (siRNA) when used to reduce gene (mRNA) expression. Furthermore, table 31 of ‘737 teaches that the antisense oligomer had one of the highest ATXN2 expression in a cell line. In other words, it was not a leading candidate for reducing ATXN2 expression. Pages 186-187 of the as-filed specification disclose that dsRNA having the instant sequence significantly reduced ATNX2 expression in a cell line and mice. There is no teaching or suggestion in the prior art to pick an antisense oligomer from the thousands of oligomers taught in ‘737 and make 21 contiguous nucleotide comprising the 20mer antisense oligonucleotide or add 3 specific nucleotides to the 5’ end of an antisense oligomer and then make a dsRNA comprising the oligomer to arrive at the claimed product. Thus, there is no motivation to pick this antisense oligomer and try to make the claimed dsRNA. With respect to claims 7 and 98-100, the strand comprising SEQ ID NOs: 1614 or 1615 in instant dsRNA are 23 nucleotides in length. The prior art does not teach a dsRNA having these sequence or the chemically modified dsRNA comprising or consisting of SEQ ID NOs: 1386 and 1443 or 1386 and 1443 and all of the modifications of these sequences. Conclusion See attached PTO-326 for disposition of claims. The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. SEQ ID NO: 16781 (Qy) in WO2018154462 (page 8) is directed to a 20 bp spacer for targeting ATXN2 with Cas 9 endonuclease (gRNA uses a different mechanism for gene regulation than siRNA), which has 20 nucleotides of the claimed dsRNA (SEQ ID NO: 1614 (Db). Qy 2 AACUUAAAAGUUGAACCACU 21 Db 20 AACTTAAAAGTTGAACCACT 1 However, there is no teaching or suggestion in ‘462 or in the prior art to pick this spacer from thousands of sequences in ‘462 and arrive at the claimed dsRNA. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Jan 26, 2023
Application Filed
Jan 16, 2026
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12595478
CRISPR-CAS SYSTEMS HAVING DESTABILIZATION DOMAIN
2y 5m to grant Granted Apr 07, 2026
Patent 12577568
METHODS FOR CONTROLLING EXTRACORPOREAL MEMBRANE OXYGENATION (ECMO) COAGULATION
2y 5m to grant Granted Mar 17, 2026
Patent 12577562
Treatment Of Glaucoma With Rho Guanine Nucleotide Exchange Factor 12 (ARHGEF12) Inhibitors
2y 5m to grant Granted Mar 17, 2026
Patent 12570984
DNA APTAMER SPECIFICALLY BINDING TO GLUTATHIONE AND USE THEREOF
2y 5m to grant Granted Mar 10, 2026
Patent 12571004
EXOSOMAL LOADING USING HYDROPHOBICALLY MODIFIED OLIGONUCLEOTIDES
2y 5m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
68%
Grant Probability
85%
With Interview (+17.0%)
2y 10m
Median Time to Grant
Low
PTA Risk
Based on 1138 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month