Prosecution Insights
Last updated: August 18, 2026
Application No. 18/012,031

METHODS AND COMPOSITIONS FOR EDITING THE B2M LOCUS IN B CELLS

Final Rejection §102§103
Filed
Dec 21, 2022
Priority
Jul 03, 2020 — provisional 63/047,978 +3 more
Examiner
HUDSON, AMY ROSE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Seattle Children's Hospital (dba Seattle Children's Research Institute)
OA Round
2 (Final)
75%
Grant Probability
Favorable
3-4
OA Rounds
0m
Est. Remaining
86%
With Interview

Examiner Intelligence

Grants 75% — above average
75%
Career Allowance Rate
1090 granted / 1454 resolved
+15.0% vs TC avg
Moderate +11% lift
Without
With
+11.4%
Interview Lift
resolved cases with interview
Typical timeline
2y 5m
Avg Prosecution
80 currently pending
Career history
1513
Total Applications
across all art units

Statute-Specific Performance

§101
3.6%
-36.4% vs TC avg
§103
33.8%
-6.2% vs TC avg
§102
13.7%
-26.3% vs TC avg
§112
34.9%
-5.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1454 resolved cases

Office Action

§102 §103
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Drawings The drawings filed on 1/21/26 are objected to because color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification: The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2). Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 78, 79, 87, 89, 90, and 92 is/are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Li et al. (WO 2020/057668). Li et al. teach a system for modifying an endogenous beta-2 microglobulin (B2M) gene comprising a Cas nuclease [0002] and a gRNA comprising a sequence complementary to an endogenous B2M gene, wherein the gRNA is identical to instant SEQ ID NO: 3 (see [0260] sg-B2M-2(SEQ ID NO: 12)GAGTAGCGCGAGCACAGCTA). Li et al. teach that the system can be in a hematopoietic stem cell [0201]. Li et al. teach pharmaceutical compositions comprising the system [0203]. Li et al. teach that the pharmaceutical composition may further include a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" means that when a molecule body and composition are properly administered to an animal or person, they do not produce adverse, allergic, or other adverse reactions [0204]. Li et al. teach that specific examples of some materials that may be pharmaceutically acceptable carriers or components thereof are antioxidants; preservatives; non-hot raw water; isotonic saline solutions; and phosphate buffers, among others [0205]. Li et al. teach [0198]: Typically by systemic administration (e.g. intravenous, intraperitoneal, intramuscular, subcutaneous or intracranial infusion) or topical application, a carrier is delivered within an individual patient, as described below. Alternatively, the vector may be delivered ex vivo to cells, such as cells removed from an individual patient (e.g. lymphocytes, T cells, bone marrow aspirate, tissue biopsy), and then, typically, cells are reimplanted into the patient after selection and incorporation of the cells of the vector. The cells may be amplified either before or after selection. Li et al. teach: [0199] The T cells can be obtained from a number of sources, including PBMC, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, and tissue from infected sites, ascites, pleural effusion, spleen tissue, and tumors. In some cases, any number of techniques known to those skilled in the art, such as Ficoll separation, may be used to obtain T cells from the blood collected by the individual. In one embodiment, cells from circulating blood of an individual are obtained by single blood collection. Single mining products typically contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, red blood cells, and platelets. In one embodiment, cells collected by single collection can be washed to remove plasma fractions and cells are placed in a suitable buffer or medium for subsequent processing steps. Alternatively, cells may be derived from a healthy donor from a patient diagnosed with cancer. Therefore, Li et al. teach a method for preparing a modified cell comprising introducing the nuclease and the gRNA into a cell, wherein the cell can be a B cell. Li et al. teaches: The present invention also provides kits comprising T cells of the present invention. The kit can be used to treat or prevent cancer, pathogen infection, immune disorder, or allogeneic transplantation. In one embodiment, the kit may comprise a therapeutic or prophylactic composition comprising an effective amount of T cells comprising one or more unit dosage forms [0216]. Li et al. teach: [0150] The term "human leukocyte antigen" (HLA) is a coding gene of a major histocompatibility complex of a human, and is located on chromosome 6(6p21.31), including a series of closely linked loci, closely related to human immune system functions. HLA includes Class I, Class II, and Class III gene sections. Antigens expressed by Class I and Class II genes of HLA are located on cell membranes and are MHC-I (HLA-A, HLA-B, HLA-C site coding) and MHC-II (HLA-D region coding), is almost distributed on all cell surfaces of the body, is an heterodimer, consists of a heavy chain (alpha chain) and beta 2 microglobulin (B2M), and class II is mainly glycoprotein located on the surfaces of macrophages and B lymphocytes. Li et al. teach selecting the modified cells by contact with an immune cell that is autologous to the first cell. Since Li et al. teaches a system comprising a Cas nuclease and a method comprising each of the instant method steps, the system and method would necessarily achieve the recited outcomes, absent evidence to the contrary. As stated in the MPEP (see MPEP 2112), something that is old does not become patentable upon the discovery of a new property. Therefore, the claims are anticipated by Li et al. Response to Arguments Applicant argues that in contrast to Li, amended Claim 78 recites "a system for modifying an endogenous beta-2 microglobulin (B2M) gene in a B cell and generating a modified B cell," wherein "the modified B cell exhibits increased survivability relative to an unmodified cell." Therefore, Li does not teach or reasonably suggest all elements of the presently presented claims. Contrary to applicant’s arguments, Li et al. is not required to teach applicant’s intended use of the system or the outcome of the system for the compound claims (claims 78, 79, 87, and 89). As stated in the MPEP (see MPEP 2112), something that is old does not become patentable upon the discovery of a new property. These claims are directed to a system comprising a Cas nuclease that is capable of cleaving a targeted locus in an endogenous B2M gene in a genome of a B cell. The claims do not recite any specific structure required for the Cas nuclease to be capable of cleaving a targeted locus in an endogenous B2M gene in a genome of a B cell and therefore the Cas nuclease of Li is considered to have the structure required to achieve the recited function. The remainder of the structural requirements of claim 78 are optional and therefore are not required. With regards to instant claims 90 and 92 which are method claims, claim 90 requires introducing the system into a B cell. The remainder of the method is optional and therefore is not required. Li et al. teach introducing the Cas nuclease into a B cell and therefore anticipate the claims. Li et al. teach each of the method steps and therefor anticipate the claims. Applicant argues that the Office Action argues that Li discloses "a method for preparing a modified cell comprising introducing the nuclease and the gRNA into a cell, wherein the cell can be a B cell", and points to paragraph [0199]. See Office Action at page 8. Paragraph [0199] corresponds to paragraph [0195] of U.S. 2022/0017926. Applicant submits that Li at paragraph [0195] of U.S. 2022/0017926 relates to obtaining T cells from a number of different sources, such as apheresis products which contain a mixture of cell types. However, Li does not teach a method, which would necessarily and always include a B cell. Therefore, Li does not explicitly or implicitly disclose all elements of the presently presented claims. Contrary to applicant’s argument, Li et al. is permitted to disclose additional embodiments. Li clearly teaches that the cells can be B cells. A genus does not always anticipate a claim to a species within the genus. However, when the species is clearly named, the species claim is anticipated no matter how many other species are additionally named. See Ex parteA, 17 USPQ2d 1716 (Bd. Pat. App. & Inter. 1990). Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 78, 79, and 81-98 is/are rejected under 35 U.S.C. 103 as being unpatentable over Li et al. (WO 2020/057668), in view of Hering et al. (WO 2020/142750 A2), Pan et al. (US 11,820,822 B2), and Alio et al. (WO 2017/059177 A2). Li et al. teach a system for modifying an endogenous beta-2 microglobulin (B2M) gene comprising a Cas nuclease [0002] and a gRNA comprising a sequence complementary to an endogenous B2M gene, wherein the gRNA is identical to instant SEQ ID NO: 3 (see [0260] sg-B2M-2(SEQ ID NO: 12) GAGTAGCGCGAGCACAGCTA). Li et al. teach that the system can be in a hematopoietic stem cell [0201]. Li et al. teach pharmaceutical compositions comprising the system [0203]. Li et al. teach that the pharmaceutical composition may further include a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" means that when a molecule body and composition are properly administered to an animal or person, they do not produce adverse, allergic, or other adverse reactions [0204]. Li et al. teach that specific examples of some materials that may be pharmaceutically acceptable carriers or components thereof are antioxidants; preservatives; non-hot raw water; isotonic saline solutions; and phosphate buffers, among others [0205]. Li et al. teach [0198]: Typically by systemic administration (e.g. intravenous, intraperitoneal, intramuscular, subcutaneous or intracranial infusion) or topical application, a carrier is delivered within an individual patient, as described below. Alternatively, the vector may be delivered ex vivo to cells, such as cells removed from an individual patient (e.g. lymphocytes, T cells, bone marrow aspirate, tissue biopsy), and then, typically, cells are reimplanted into the patient after selection and incorporation of the cells of the vector. The cells may be amplified either before or after selection. Li et al. teach: [0199] The T cells can be obtained from a number of sources, including PBMC, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, and tissue from infected sites, ascites, pleural effusion, spleen tissue, and tumors. In some cases, any number of techniques known to those skilled in the art, such as Ficoll separation, may be used to obtain T cells from the blood collected by the individual. In one embodiment, cells from circulating blood of an individual are obtained by single blood collection. Single mining products typically contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, red blood cells, and platelets. In one embodiment, cells collected by single collection can be washed to remove plasma fractions and cells are placed in a suitable buffer or medium for subsequent processing steps. Alternatively, cells may be derived from a healthy donor from a patient diagnosed with cancer. Therefore, Li et al. teach a method for preparing a modified cell comprising introducing the nuclease and the gRNA into a cell, wherein the cell can be a B cell. Selection of a B cell is considered to be a matter of design choice and within the species taught by Li et al. Li et al. teaches: The present invention also provides kits comprising T cells of the present invention. The kit can be used to treat or prevent cancer, pathogen infection, immune disorder, or allogeneic transplantation. In one embodiment, the kit may comprise a therapeutic or prophylactic composition comprising an effective amount of T cells comprising one or more unit dosage forms [0216]. Li et al. teach: [0150] The term "human leukocyte antigen" (HLA) is a coding gene of a major histocompatibility complex of a human, and is located on chromosome 6(6p21.31), including a series of closely linked loci, closely related to human immune system functions. HLA includes Class I, Class II, and Class III gene sections. Antigens expressed by Class I and Class II genes of HLA are located on cell membranes and are MHC-I (HLA-A, HLA-B, HLA-C site coding) and MHC-II (HLA-D region coding), is almost distributed on all cell surfaces of the body, is an heterodimer, consists of a heavy chain (alpha chain) and beta 2 microglobulin (B2M), and class II is mainly glycoprotein located on the surfaces of macrophages and B lymphocytes. Li et al. teach selecting the modified cells by contact with an immune cell that is autologous to the first cell. Since Li et al. teaches a system comprising a Cas nuclease and a method comprising each of the instant method steps, the system and method would necessarily achieve the recited outcomes, absent evidence to the contrary. As stated in the MPEP (see MPEP 2112), something that is old does not become patentable upon the discovery of a new property. Li et al. teach: [0158] The term "costimulatory ligand" includes a molecule that specifically binds to an antigen presenting cell of a co-stimulatory molecule on a T cell (e.g. aAPC, dendritic cells, B cells, etc.), thereby providing a signal that mediates a T cell response together with a first signal provided by a combination of, for example, a TCR CD3 complex with an MHC molecule loaded with a peptide, including, but not limited to, proliferation, activation, differentiation, and the like. Co-stimulatory ligands may include, but are not limited to, CD7, B7-1 (CD80), B7-2 (CD86), PD-L, PD-L2, 4-1 BBL, OX40L, inducible co-stimulatory ligands (ICOS-L), intercellular adhesion molecules (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICCA, MICB, HVEM, lymphotoxin beta receptor, 3/TR6, ILT 3, ILT 4, HVEM, agonists or antibodies that bind to Toll ligand receptors, and ligands that specifically bind to B7-H3. Costimulatory ligands also particularly include antibodies that specifically bind to co-stimulatory molecules present on T cells, such as, but not limited to, CD27, CD28, 4-1 BB, OX40, CD30, CD40, PD -1, ICOS, lymphocyte function dependent antigen -1 (LFA -1), CD 2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83. It is noted that claim 78 recites the repair template in the alternative and is not a requirement. Li et al. does not teach a repair template comprising first and second arms. However, homology directed repair was routine in the art at the time of filing. For example, Hering et al. teach a repair template comprising first and second arms. It would have been obvious to utilize this method of CRISPR wherein one of the arms have homology to a sequence in the B2M gene because homology directed repair was known in the art and it was known to design gRNAs specific to B2M, as evidenced by Li et al. Hering et al. teach: [00132] Lack of MHC class I expression on transplanted human cells can cause the passive activation of natural killer (NK) cells. Lack of MHC class I expression could be due to NLRC5, TAPI, or B2M gene deletion. NK cell cytotoxicity can be overcome by the expression of the human MHC class 1 gene, HLA-E, can stimulate the inhibitory receptor CD94/NKG2A on NK cells to prevent cell killing. Successful expression of the HLA-E gene can be dependent on co-expression of the human B2M (beta 2 microglobulin) gene and a cognate peptide . A nuclease mediated break in the stem cell DNA can allow for the insertion of one or multiple genes via homology directed repair. The HLA-E and hB2M genes in series can be integrated in the region of the nuclease mediated DNA break thus preventing expression of the target gene (for example, NLRC5) while inserting the transgenes. Therefore, it would have been obvious for the nucleic acid encoding a payload to comprise (i) a first nucleic acid encoding a B2M cDNA; (ii) a second nucleic acid encoding a non-polymeric HLA polypeptide, or a therapeutic polypeptide; and/or (iii) a third nucleic acid encoding a self-peptide to be presented by the non-polymeric HLA polypeptide, wherein the non-polymeric HLA polypeptide is HLA-E. Hering et al. teach: [00137] Gene suppression can also be done in a number of ways. For example, gene expression can be reduced by knock out, altering a promoter of a gene, and/or by administering interfering RNAs (knockdown) Hering et al. teach: The nucleic acid molecule can include or be fused to operably linked control elements such as a promoter [0194]. Hering et al. teach: [00194] In some cases, the nucleic acid construct is inserted into a DNA vector (i.e., DNA expression vector) capable of expressing the MHC complex in a desired cell, typically a eukaryotic or prokaryotic cell. The nucleic acid molecule can include or be fused to operably linked control elements such as a promoter, leader and/or optional enhancer sequences, to augment expression of the MHC complex in the cell. In some embodiments, the nucleic acid molecule is for CRISPR/Cas mediated integration into a specific genomic locus. Homologous recombination can permit site-specific integration of a transgene. Accordingly, in some embodiments, the nucleic acid molecule comprises a first flanking sequence homologous to a genome sequence upstream of a select insertion site, said first flanking sequence located upstream of a transgene. In some embodiments, the nucleic acid molecule comprises a second flanking sequence homologous to a genome sequence downstream of a select insertion site, said second flanking sequence located downstream of a transgene. Vector comprising the isolated nucleic acid construct are also contemplated in the present disclosure. Therefore, it would have been obvious for the first nucleic acid to be operably linked to a promoter of the endogenous B2M gene; wherein the nucleic acid encoding a payload comprises a heterologous promoter operably linked to the first nucleic acid; and wherein a vector comprises the repair template, as these were known HDR design elements. Hering et al. teach: [00340] Modification of a targeted locus of a cell can be produced by introducing DNA into cells, where the DNA has homology to the target locus. DNA can include a marker gene, allowing for selection of cells comprising the integrated construct. Homologous DNA in a target vector can recombine with a chromosomal DNA at a target locus. A marker gene can be flanked on both sides by homologous DNA sequences, a 3' recombination arm, and a 5' recombination arm. Hering et al. teach: [00415] A subsequent round of cloning generated constructs inserted between the ROSA26 homology arms for knock in into a ROSA26 insertion site of a cell (Exemplary sequence is provided in Table 9). The ROSA26 homology arms were designed for homologous recombination of the transgene in exon 1 of ROSA26. The left flanking homologous arm of the HLA-DR transgene cassette was designed to include a 500 base pair (bp) sequence spanning the promoter and exon 1 and a 500 bp sequence located at the 3’ end to exon 1 was selected for design of the right flanking homologous arm. Hering et al. teach: [00429] The cells were electroporated to allow the entry of the ROSA26 targeting CRISPR guides and recombinant Cas9 to cut the DNA in the presence of the dsDNA repair template described above. It would have been obvious to select for the modified B2M locus to comprise an inactivated or active B2M endogenous gene, and express a replacement MHC-I; and/or wherein the repair template comprises a payload encoding a B2M cDNA, a non-polymeric HLA polypeptide, and/or a self-peptide to be presented by the non-polymeric HLA polypeptide; the method further comprising selecting for the modified cell by contacting the modified cell with an immune cell, wherein the immune cell is allogeneic to the first cell, and/or is selected from a T cell or natural killer cell because Hering et al. teaches that lack of MHC class I expression on transplanted human cells can cause the passive activation of natural killer (NK) cells; lack of MHC class I expression could be due to NLRC5, TAPI, or B2M gene deletion; NK cell cytotoxicity can be overcome by the expression of the human MHC class 1 gene, HLA-E, can stimulate the inhibitory receptor CD94/NKG2A on NK cells to prevent cell killing; and successful expression of the HLA-E gene can be dependent on co-expression of the human B2M (beta 2 microglobulin) gene and a cognate peptide. It would have been obvious for the B2M sequence to be instant SEQ ID NO: 2 because Pan et al. teach this exact sequence as a B2M sgRNA (see column 70). It would have been obvious for the B2M sequence to be instant SEQ ID NO: 4 because Alio et al. teach this exact sequence as a B2M sgRNA (see page 6, SEQ ID NO: 11). Selection of any known B2M sgRNA is considered to be a matter of design choice. Response to Arguments Applicant argues that instant claim 78 recites "a system for modifying an endogenous B2M gene in a B cell and generating a modified B cell," wherein the "modified B cell exhibits increased survivability relative to an unmodified cell." Applicant submits that none of the cited references discloses experimental use of B cells, much less the claimed system or methods for modifying B cells to produce modified B cells with the currently claimed technical effect of an increased survivability. Therefore, none of Li, Hering, Pan and Alici, alone or in combination, teach or reasonably suggest all elements of the presently presented claims. Contrary to applicant’s arguments, Li et al. is not required to teach applicant’s intended use of the system or the outcome of the system for the compound claims (claims 78, 79, 87, and 89). As stated in the MPEP (see MPEP 2112), something that is old does not become patentable upon the discovery of a new property. These claims are directed to a system comprising a Cas nuclease that is capable of cleaving a targeted locus in an endogenous B2M gene in a genome of a B cell. The claims do not recite any specific structure required for the Cas nuclease to be capable of cleaving a targeted locus in an endogenous B2M gene in a genome of a B cell and therefore the Cas nuclease of Li is considered to have the structure required to achieve the recited function. The remainder of the structural requirements of claim 78 are optional and therefore are not required. In addition, Applicant submits that one of ordinary skill in the art, reading the cited references, would have had no reasonable expectation that the methods disclosed therein for modifying one cell type could be universally applied to any cell type and/or cell line, such as a B cell. Furthermore, one of skill in the art would have had no motivation to specifically select B cells for modification based upon the limited disclosure in the cited references, let alone an expectation of success to generate modified B cells with the currently claimed properties. Contrary to applicant’s arguments, the references are in the same field of utilizing CRISPR techniques and Li et al. teaches that the cell can be a B cell. Although applicant argues that Li teaches that there are challenges, this does not negate the teachings of Li regarding delivery of a Cas nuclease and gRNA to B cells. Applicant argues that the instant application discloses evidence that knockout of an endogenous B2M gene in modified B cells provides an unexpected and significant increase in survival rates when exposed to CD8+ killer T cells, as compared to an unmodified B cell. See e.g., Example 6; and figure 6. Applicant respectfully submits that such a finding would not have been readily predicted from the cited references. Applicant is arguing results that are not commensurate in scope with the instant claims, which are directed to delivery of a system comprising any Cas nuclease targeting a B2M gene in any B cell. The specification demonstrates CRISPR targeting of B2M with two specific gRNAs and Cas9 as a ribonucleoprotein complex, which is not commensurate in scope with the instant claims that only requires any Cas nuclease. The specification demonstrates using gRNA-1 RNP complex in human B cells to target the human B2M locus with resultant expression of MHC-I complexes eliminated in greater than 90% of edited B cells. The claims are not commensurate in scope with applicant’s unexpected results. It is noted that the instant compound claims do not require a B cell, but rather a Cas nuclease that has the capability of cleaving the targeted locus in a B cell. The method only requires delivery of any Cas nuclease to any B cell. The unexpected results argued by applicants are not required elements (structure or method step) of the claims. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached M-F 8:00am-6:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AMY ROSE HUDSON/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Dec 21, 2022
Application Filed
Jul 22, 2025
Non-Final Rejection mailed — §102, §103
Jan 21, 2026
Response Filed
May 07, 2026
Final Rejection mailed — §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12692496
COMPOSITIONS AND METHODS FOR MODULATING RPGR EXPRESSION
3y 11m to grant Granted Jul 28, 2026
Patent 12691135
INHIBITORS OF MICRO-RNA 22
3y 9m to grant Granted Jul 28, 2026
Patent 12686870
NOVEL TLR9 AGONISTS
4y 1m to grant Granted Jul 21, 2026
Patent 12685745
THERAPEUTIC CIRCULAR DNA FORMS
9m to grant Granted Jul 21, 2026
Patent 12680102
miRNAS FOR REDUCING VENTRICLE ENLARGEMENT
4y 5m to grant Granted Jul 14, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
75%
Grant Probability
86%
With Interview (+11.4%)
2y 5m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 1454 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month