DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant's amendment and remarks, filed 3/30/26, are acknowledged.
Claims 1, 7, 21, and 32-33 have been amended.
Claims 34-38 have been added.
Claims 1, 3, 7, 21-23, 25-38 are pending.
Claims 22-23, 25-31 are withdrawn from further consideration by the examiner, 37 CFR 1.142(b), as being drawn to a non-elected invention. Claims 37-38 are withdrawn as being directed to a non-elected species.
Claims 1, 3, 7, 21, 32-36 are under examination.
In view of Applicant’s claim amendments, the previous grounds of rejection are withdrawn. The following are new grounds of rejection necessitated by Applicant’s claim amendments.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 34 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 34 recites that the nucleic acid encodes “an amino acid”. It is unclear how the claimed nucleic acid sequence which encodes a peptide and antigen, can encode “an amino acid”, i.e. a singular amino acid such as cysteine. Amendment to recite that the nucleic acid encodes a polypeptide or encodes an amino acid sequence, for example, would be remedial.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1, 3, 7, 21, 32-33, 35-36 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated US 2017/0202946 (of record).
The ‘946 publication teaches a nucleic acid expression vector encoding an amino acid lumazine synthase peptide, which comprises an amino acid sequence comprising a 15 amino acid peptide from Aquifex aeolicus having the sequence LRFGIVASRFNHALV (see Table 2, SEQ ID NO: 200 in particular, i.e. an adjuvant peptide). Said peptide binds to mouse I-Ab, and also binds to HLA-DRB1*07:01, HLA-DRB1*15:01 and HLA-DRB5*01:01 (see previously attached binding prediction results). The ‘946 publication also teaches said expression vector comprising SEQ ID NO: 392, which comprising a sequence encoding said LRFGIVASRFNHALV epitope that is 91.1% identical to SEQ ID NO: 2 of the instant application, as calculated by dividing the number of matched positions by the total number of positions in the specified region (SEQ ID NO: 2) and dividing by 100 (see attached alignment, and paragraph 41 of the specification which defines the scope of percent identity). Said expression vector further comprises a nucleic acid sequence that encodes an HA influenza antigen (see Table 2, in particular). Said expression vector also encodes a leader and linker sequence. The ‘946 publication teaches a pharmaceutical compositions comprising said nucleic acid sequence and a pharmaceutically acceptable carrier (see paragraph 181).
Claim(s) 1, 3, 21, 32-33, 35 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated WO2019103993.
WO2019103993 teaches a nucleic acid expression vector encoding an lumazine synthase peptide, which comprises an amino acid sequence comprising a 15 amino acid peptide from Aquifex aeolicus having the sequence LRFGIVASRFNHALV (see Table, SEQ ID NO: 190, 87-88, i.e. an adjuvant peptide,). Said peptide inherently binds to HLA-DRB1*07:01, HLA-DRB1*15:01 and HLA-DRB5*01:01. Said nucleic acid comprises a sequence that is 92.9% identical to SEQ ID NO: 2 of the instant application (see attached alignment). Said nucleic acid further comprises a sequence encoding a linker, a leader peptide and a viral antigen. WO2019103993 teaches a pharmaceutical compositions comprising said nucleic acid sequence and a pharmaceutically acceptable carrier.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim 1, 3, 21, 32-35 is/are rejected under 35 U.S.C. 103 as being unpatentable over WO2018176031 (of record), in view of WO2019103993 or US 2017/0202946.
WO2018176031 teaches an expression vector encoding a lumazine synthase peptide of SEQ ID NO: 69, which comprises LRFGIVASRANHALV, which is identical to the peptide encoded by SEQ ID NO: 2 of the instant claims (i.e. an adjuvant peptide, and HLA-DRB1*07:01 binding peptide). WO2018176031 teaches said expression vector further encoding an viral antigen linked via a peptide linker to the C-terminus of the lumazine synthase peptide (i.e. arranged from amino to carboxy terminal orientation as adjuvant peptide, linker, viral antigen, see page 25-26, in particular). WO2018176031 also teaches pharmaceutical compositions (see page 28, in particular).
Although WO2018176031 does not teach the same nucleic acid sequence as SEQ ID NO: 2, choosing from the known codons that could be used to encode a given amino acid sequence would involve would involve choosing among a finite number of predictable options which could be pursued with a reasonable expectation of success. A person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense (see KSR International Co. V. Telefex Inc 82 USPQ2d 1385).
Alternatively, it would be obvious to use the nucleic acids of WO2019103993 or US 2017/0202946 encoding a lumazine synthase, which would also involve would involve choosing among a finite number of predictable options which could be pursued with a reasonable expectation of success (i.e. a nucleic acid sequence comprising at least 90% identity to SEQ ID NO: 2).
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 3, 7, 21, 32-36 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-4, 10-14, 52, 101-103 of copending Application No. 17/417,096 (reference application), in view of WO2018176031, WO2019103993, and US 2017/0202946.
Although the claims at issue are not identical, they are not patentably distinct from each other because the ‘096 application claims a composition comprising an expressible nucleic acid sequence comprising a nucleic acid sequence encoding a self-assembling polypeptide of SEQ ID NO: 7, and a viral antigen, such as an influenza antigen. Said SEQ ID NO: 7 comprise SEQ ID NO: 1 of the instant application, which is a species “adjuvant peptide” comprising an HLA I-Ab epitope from Aquifex aeolicus of 15 amino acids that binds to HLA-DR as recited in the instant claims. The ‘096 application also claims that said nucleic acid sequence comprises SEQ ID NO: 2, which comprises residues CTGAGGTTCGGAATTGTCGCAAGCCGCGCGAATCACGCACTGGTG which are 80% identical to SEQ ID NO: 2 of the instant application (36/45 residues matching). The ‘096 application claims that the sequence further encodes a linker and a pharmaceutical composition. Although not specifically claimed, assembling the elements in the orientation of the instant claims, and using a linker and leader sequence would also be obvious based on the teachings of WO2018176031, which teaches the claimed orientation for self-assemble peptides. Furthermore, choosing from the known codons that could be used to encode a given amino acid sequence or from known nucleic acids encoding a lumazine synthase would be obvious for the same reason set forth above.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 1, 3, 7, 21, 32-36 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 5, 7, 9, 11 of copending Application No. 17/918,321 (reference application), in view of WO2018176031, WO2019103993, and US 2017/0202946.
Although the claims at issue are not identical, they are not patentably distinct from each other because the ‘321 application claims a composition comprising an expressible nucleic acid sequence comprising a nucleic acid sequence encoding a self-assembling polypeptide of SEQ ID NO: 8 and a coronaviridae antigen. Said SEQ ID NO: 8 comprises SEQ ID NO: 1 of the instant application, which is a species of “adjuvant peptide” comprising an HLA I-Ab epitope from Aquifex aeolicus of 15 amino acids that binds to HLA-DR as recited in the instant claims. The ‘321 application also claims that said nucleic acid sequence comprises SEQ ID NO: 68, which comprises residues CTGAGGTTCGGAATTGTCGCAAGCCGCGCGAATCACGCACTGGTG which are at least 80% identical to SEQ ID NO: 2 of the instant application. The ‘321 application further claims that said nucleic acid sequence encodes a leader sequence, and that the construct is arranged in 5’ to 3’ orientation as self-assembling peptide, linker, viral antigen. The ‘321 application claims a pharmaceutical composition. Furthermore, choosing from the known codons that could be used to encode a given amino acid sequence or from known nucleic acids encoding a lumazine synthase would be obvious for the same reason set forth above.
Claims 1, 3, 7, 21, 32-36 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-13 of 18/552,635 (reference application), in view of WO2018176031, WO2019103993, and US 2017/0202946.
The ‘635 application claims a nucleic acid encoding a self-assembling domain and a virus antigen comprising SEQ ID NO: 4, or having SEQ ID NO: 3, which comprise the same sequences of the instant application (i.e. comprises SEQ ID NO; 1 of the instant application and a sequence at least 80% identical to SEQ ID NO: 2). The ‘635 application claims that it encodes a viral antigen, has a linker, leader, and orientation according to the instant claims, or alternatively, these would be obvious optimizations based on the teachings of WO2018176031. Furthermore, choosing from the known codons that could be used to encode a given amino acid sequence or from known nucleic acids encoding a lumazine synthase would be obvious for the same reason set forth above.
Claims 1, 3, 7, 21, 32-36 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-14 of 18/556,414 (reference application), in view of WO2018176031, WO2019103993, and US 2017/0202946.
The ’414 application claims a nucleic acid encoding an immunogen and a CD4 helper epitope LS-3, and LS-3 has SEQ ID NO: 1 of the instant application (i.e. it is a peptide adjuvant epitope having the same HLA binding as recited in the instant claims). The ‘414 application claims that the immunogen is a coronaviral antigen. The ‘635 application claims that the nucleic acid sequence comprises a sequence 89% identical SEQ ID NO: 93, which comprises SEQ ID NO: 2 of the instant application. Assembling the elements in the orientation of the instant claims, and using a linker and leader sequence would also be obvious based on the teachings of WO2018176031, which teaches the claimed orientation for self-assembling peptides. Furthermore, choosing from the known codons that could be used to encode a given amino acid sequence or from known nucleic acids encoding a lumazine synthase would be obvious for the same reason set forth above.
Claims 1, 3, 7, 21, 32-36 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3-4, 6-7, 13 of 17/802,936(reference application).
The ‘936 claims a composition comprising an expressible nucleic acid sequence comprising a nucleic acid sequence encoding a self-assembling polypeptide from Aquifex aeolicus and a viral antigen from influenza, with a linker and leader and orientation within the scope of the instant claims. The ‘936 application claims a pharmaceutical composition, and claims or discloses (i.e. that the claims cover) SEQ ID NO; 1 and 2 of the instant application, i.e. the nucleic acid inherently express an epitope within the scope of the instant claims.
No claim is allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMY E JUEDES whose telephone number is (571)272-4471. The examiner can normally be reached on M-F from 7am to 3pm.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Misook Yu can be reached on 571-272-0839. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from Patent Center. Status information for published applications may be obtained from Patent Center. Status information for unpublished applications is available through Patent Center for authorized users only. Should you have questions about access to Patent Center, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) Form at https://www.uspto.gov/patents/uspto-automated- interview-request-air-form.
Amy E. Juedes
Patent Examiner
Technology Center 1600
/AMY E JUEDES/Primary Examiner, Art Unit 1644