Prosecution Insights
Last updated: October 04, 2026
Application No. 18/015,042

TRANSGENIC MOUSE MODELS SUPPORTING HUMAN INNATE IMMUNE FUNCTION

Final Rejection §103
Filed
Jan 06, 2023
Priority
Jul 08, 2020 — provisional 63/049,175 +2 more
Examiner
BATES, KEENAN ALEXANDER
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Jackson Laboratory
OA Round
2 (Final)
46%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 46% of resolved cases
46%
Career Allowance Rate
35 granted / 77 resolved
-14.5% vs TC avg
Strong +80% interview lift
Without
With
+79.5%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
54 currently pending
Career history
151
Total Applications
across all art units

Statute-Specific Performance

§101
4.2%
-35.8% vs TC avg
§103
38.6%
-1.4% vs TC avg
§102
20.2%
-19.8% vs TC avg
§112
27.4%
-12.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 77 resolved cases

Office Action

§103
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of Group I (Claims 1 and 72-85; drawn to a NOD mouse) in the reply filed on September 9, 2025, is acknowledged. Claim 62 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention (Group VII), there being no allowable generic or linking claim. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). DETAILED ACTION The amended claims filed on March 12, 2026, have been acknowledged. Claims 2-61 and 63-71 were cancelled. Claim 1 was amended. In light of the Applicant’s elected invention, claim 62 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Claims 1 and 72-85 are pending and examined on the merits. Priority The applicant claims domestic priority from U.S. provisional application No. 63/049,175, filed on July 8, 2020. Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Claims 1 and 72-85 receive domestic benefit from U.S. provisional application No. 63/049,175, filed on July 8, 2020. Information Disclosure Statement The information disclosure statement (IDS) filed on March 12, 2025, has been considered. Maintained Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 1, 72-73, and 77-84 are rejected under 35 U.S.C. 103 as being unpatentable over World Intellectual Property Organization Patent Application No. 2020008066 (Di Santo; referenced in IDS) and Yu et al. (Blood 129: 959-969. 2017). This rejection is repeated with regards to the rejection in the Non-final Office action mailed on December 15, 2026. Applicant’s traversal is addressed below. Regarding claim 1, Di Santo teaches a transgenic NOD mouse comprising in its genome a homozygous disruption of Prkdc, a homozygous disruption of IL2rg, and a homozygous disruption of the Flt3 gene (paragraph 0013 and claims 1-8). Di Santo does not teach wherein their transgenic mouse comprises within its genome a human IL6 transgene. However, Yu teaches that they generated immunodeficient mice. They generated immunodeficient Rag-/- Il2rg-/- mice, in which the gene encoding human IL-6 was knocked into its orthologous mouse locus. They found human IL-6 not only improves thymopoiesis and peripheral T-cell engraftment, but also significantly increases the level of total IgG and antigen-specific IgG. Consistent with enhanced antibody production, higher frequencies of memory B cells and IgG1 B cells, and lower frequencies of transitional and immature B cells were also detected. Furthermore, immunization with OVA induced OVA-specific B cells only in human IL-6 knock-in mice. These OVA-specific antibodies displayed the highest frequency of somatic mutation, further suggesting that human IL-6 is important for efficient antigen-specific B-cell activation and selection. To replace the gene encoding mouse IL-6 by its human homolog, they designed a vector to replace the sequence encompassing the ORF of mouse IL-6 with its human counterpart, but to maintain the promoter and other regulatory elements (such as 5’ untranslated region) of mouse origin (page 959, column 2, paragraph 2-page 960, column 1, paragraph 1 and page 961, column 1, paragraph 1-column 2, paragraph 2, and Supplemental Figure 1). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the NOD mouse comprising in its genome a homozygous disruption of Prkdc, a homozygous disruption of IL2rg, and a homozygous disruption of the Flt3 gene of Di Santo by incorporating a human IL6 transgene into the genome of the NOD mouse to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to modify with a reasonable expectation of success because Yu successfully reduces to practice that the human IL-6 can be knocked into its orthologous mouse locus in immunodeficient mice. Furthermore, they found human IL-6 not only improves thymopoiesis and peripheral T-cell engraftment, but also significantly increases the level of total IgG and antigen-specific IgG. Consistent with enhanced antibody production, higher frequencies of memory B cells and IgG1 B cells, and lower frequencies of transitional and immature B cells were also detected. Furthermore, immunization with OVA induced OVA-specific B cells only in human IL-6 knock-in mice. These OVA-specific antibodies displayed the highest frequency of somatic mutation, further suggesting that human IL-6 is important for efficient antigen-specific B-cell activation and selection. As such, it would have been obvious to further modify the NOD mice of Di Santo to incorporate a human IL6 transgene into the genome as this would improve development of mature B cells and generate a more representative human immunization mouse model. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Regarding claim 72, as stated supra, Yu teaches that they knocked in the human IL6 transgene at its orthologous mouse locus (page 959, column 2, paragraph 2-page 960, column 1, paragraph 1 and page 961, column 1, paragraph 1-column 2, paragraph 2, and Supplemental Figure 1). Regarding claim 73, “a nucleotide sequence of SEQ ID NO: 2” is broadly interpreted to include any dinucleotide sequence found in SEQ ID NO: 2. Yu teaches that their human IL6 sequence includes the ATG of exon 1 (Supplemental page 1, paragraph 1) which is 100% identical to multiple ATG sequences within SEQ ID NO: 2 of the instant application. Regarding claim 77, Di Santo teaches that they also provide human immune system mice made from a transgenic mouse of their invention. The HIS mice may be made by engrafting the transgenic mouse of the invention with human primary hematopoietic cells, such as CD34+ cells (paragraph 0067). Regarding claims 78 and 80-84, Di Santo, as stated supra, teaches that they also provide human immune system mice made from a transgenic mouse of their invention. The HIS mice may be made by engrafting the transgenic mouse of the invention with human primary hematopoietic cells, such as CD34+ cells and that the human immune system mouse may generate an immune response consisting of a B-cell, T-cell and/or NK-cell response (paragraphs 0067-0075). Regarding claim 78, Di Santo is silent regarding whether their transgenic NOD mouse comprising in its genome a homozygous disruption of Prkdc, a homozygous disruption of IL2rg, and a homozygous disruption of the Flt3 gene produce CD45+ immune cells while Yu does teach that their immunodeficient Rag-/- Il2rg-/- mice, in which the gene encoding human IL-6 was knocked into its orthologous mouse locus does produce engrafted CD45+ cells after transplantation of human CD34+ cells (page 960, column 1, paragraph 3 and Figure 2). The instant specification discloses that they engrafted CD34+ cord blood hematopoietic progenitor cells into their NSGF6 mouse model and found CD45+ cell engraftment (Examples 1-3). As the combined teachings of Di Santo and Yu teach the mouse of claim 1 and Example 2, the same CD34+ cells are being engrafted in Di Santo and Yu, and Yu shows that in their immunodeficient mice, they developed engrafted CD45+ cells, it would naturally flow that transplanting CD34+ cells into the combined mouse of Di Santo and Yu would also develop CD45+ cells as all the parts are there. Regarding claims 80-81, Di Santo is silent regarding whether their human immune system transgenic NOD mouse model develops CD45+/CD3+ T cells but does teach that the human immune system mouse may generate an immune response consisting of a T-cell response and Yu teaches that their immunodeficient mice encoding human IL-6 does produce engrafted CD45+/CD3+ cells after transplantation of human CD34+ cells but does not compare the level of the CD45+/CD3+ cells to the control mouse of claim 81 (page 960, column 1, paragraph 3 and Supplemental Figure 2). As the combined teachings of Di Santo and Yu teach the mouse of claim 1, the same CD34+ cells are being engrafted in Di Santo and Yu, and Yu shows that in their immunodeficient mice, they developed engrafted CD45+/CD3+ cells, it would naturally flow that transplanting CD34+ cells into the combined mouse of Di Santo and Yu would also develop CD45+/CD3+ cells and with the same increase compared to the control mouse of claim 81 as all the parts are there. Regarding claims 82-83, Di Santo is silent regarding whether their human immune system transgenic NOD mouse model develops CD45+/CD19+ B cells but does teach that the human immune system mouse may generate an immune response consisting of a B-cell response and Yu teaches that their immunodeficient mice encoding human IL-6 does produce engrafted CD45+/CD19+ cells after transplantation of human CD34+ cells but does not compare the level of the CD45+/CD19+ cells to the control mouse of claim 83 (page 960, column 1, paragraph 3, Figures 3-4, and Supplemental Figures 3-4). As the combined teachings of Di Santo and Yu teach the mouse of claim 1, the same CD34+ cells are being engrafted in Di Santo and Yu, and Yu shows that in their immunodeficient mice, they developed engrafted CD45+/CD19+ cells, it would naturally flow that transplanting CD34+ cells into the combined mouse of Di Santo and Yu would also develop CD45+/CD19+ cells and with the same decrease compared to the control mouse of claim 83 as all the parts are there. Regarding claim 83, Di Santo and Yu are silent as to the development of dendritic cells. However, as the combined teachings of Di Santo and Yu teach the mouse of claim 1 and the same CD34+ cells are being engrafted in Di Santo and Yu, it would naturally flow that transplanting CD34+ cells into the combined mouse of Di Santo and Yu would also develop CD11c+ myeloid dendritic cells and/or CD303+ plamscytoid dendritic cells as all the parts are there. Regarding claim 79, Di Santo, as stated supra, teaches that they also provide human immune system mice made from a transgenic mouse of their invention. The HIS mice may be made by engrafting the transgenic mouse of the invention with human primary hematopoietic cells, such as CD34+ cells and that the human immune system mouse may generate an immune response consisting of a B-cell, T-cell and/or NK-cell response (paragraphs 0067-0075). Response to Arguments Applicant's arguments filed March 12, 2026, are acknowledged. Applicant argues a prima facie case of obviousness requires, inter alia, a specific teaching, suggestion, or motivation to combine the prior art references. This showing cannot rest on hindsight reconstruction; rather, the Examiner must identify an articulable reason-grounded in the prior art itself-why a skilled artisan would have been motivated to make the proposed combination. Di Santo discloses a transgenic NOD mouse comprising homozygous disruptions of Prkdc, Il2rg, and Flt3-the triple-knockout background shared with the claimed mouse. Importantly, Di Santo characterizes this model as a Human Immune System (HIS) mouse that spontaneously develops atopic dermatitis (AD), an immune-mediated pathology. Di Santo presents the model specifically as a tool for studying AD and novel AD therapeutics. Di Santo does not disclose or suggest introduction of a human IL-6 transgene. Yu discloses immunodeficient Rag-1- Il2rg-J- mice in which the gene encoding human IL-6 was knocked into its orthologous mouse locus. Yu reports that human IL-6 improved thymopoiesis, peripheral T-cell engraftment, and IgG production in that particular background. Yu does not involve the triple-knockout NOD background of Di Santo, and does not address modeling of the general human immune response in a mouse lacking endogenous IL-6. The rejection fails for two independent reasons. First, Di Santo's spontaneous AD phenotype would have directed the skilled artisan away from using it as a general humanization platform. The entire premise of the rejection is that a skilled artisan would modify the Di Santo mouse to improve engraftment of human immune cells. But Di Santo's mouse spontaneously develops AD-an immune-mediated disease that compromises the model as a general platform for studying the human immune response. A skilled artisan reading Di Santo would not have been motivated to build upon it as a human immune system model for broad use, let alone introduce a human IL-6 transgene; to the contrary, the spontaneous pathology would have rendered it unsuitable for any study beyond AD. Di Santo therefore provides no foundation for the proposed combination. Second, nothing in the prior art would have directed the skilled artisan to select human IL-6 specifically from among thousands of candidate genes. Even setting aside the AD issue, the Examiner's proposed combination requires selecting human IL-6 from a vast landscape of known immunomodulatory genes. It is well established that thousands of genes govern the maintenance and differentiation of human immune cells and their precursors. The Examiner cites Yu's observation that human IL-6 improved certain engraftment parameters in a different mouse background. But an improvement in one genetic context does not constitute a motivation to introduce that gene into a distinct background-particularly where the donor mouse (Di Santo) was developed for an entirely different purpose (AD modeling) and shares no functional overlap with Yu's model. Without some principled basis for selecting IL-6 over the thousands of other candidate genes, the proposed combination is the product of hindsight reasoning derived from Applicant's own disclosure-precisely the type of analysis the Federal Circuit has cautioned against. The Examiner has not identified any teaching, suggestion, or motivation sufficient to support the proposed combination. Di Santo's utility is confined to AD modeling, and its spontaneous immune pathology would have discouraged its use as a general humanization platform. The selection of human IL-6 from the universe of thousands of candidate immunomodulatory genes is supported only by hindsight derived from Applicant's disclosure (page 5, paragraph 2-page 7, paragraph 1). Applicant's arguments have been fully considered but they are not persuasive. In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., a general humanization platform) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997) (The court held that the PTO is not required, in the course of prosecution, to interpret claims in applications in the same manner as a court would interpret claims in an infringement suit. Rather, the “PTO applies to verbiage of the proposed claims the broadest reasonable meaning of the words in their ordinary usage as they would be understood by one of ordinary skill in the art, taking into account whatever enlightenment by way of definitions or otherwise that may be afforded by the written description contained in applicant’s specification.”). See MPEP 2111]. The claims require a NOD mouse comprising in its genome: an inactivated mouse Prkdc allele, an inactivated mouse IL2rg allele, an inactivated mouse Flt3 allele, and a human interleukin 6 (IL6) transgene. None of the claims require the claimed mouse to be a general humanization platform, as suggested by the Applicant. Furthermore, MPEP 2145(I) states that an argument by the applicant is not evidence unless it is an admission, in which case, an examiner may use the admission in making a rejection. See MPEP § 2129 and § 2144.03 for a discussion of admissions as prior art. Arguments presented by applicant cannot take the place of evidence in the record. See In re De Blauwe, 736 F.2d 699, 705, 222 USPQ 191, 196 (Fed. Cir. 1984); In re Schulze, 346 F.2d 600, 602, 145 USPQ 716, 718 (CCPA 1965); In re Geisler, 116 F.3d 1465, 43 USPQ2d 1362 (Fed. Cir. 1997) ("An assertion of what seems to follow from common experience is just attorney argument and not the kind of factual evidence that is required to rebut a prima facie case of obviousness."). See MPEP § 716.01(c) for examples of applicant statements which are not evidence and which must be supported by an appropriate affidavit or declaration. As such, although Applicant argues that the mice of Di Santo comprising in its genome: an inactivated mouse Prkdc allele, an inactivated mouse IL2rg allele, and an inactivated mouse Flt3 allele spontaneously develop atopic dermatitis (AD), they have not provided any evidence that this is the case. On the contrary, Di Santo identifies that the atopic dermatitis phenotype is specific to a combination of genetic modifications associated with the BRGST mice (an immunodeficient Balb/c Rag2-/- Il2rg-/- SirpaNOD TSLP transgene) as BRGS mice did not show atopic dermatitis (AD) (Example 13). Therefore, Applicant’s suggestion that Di Santo's mouse (referenced in the rejection) spontaneously develops AD is not supported by the evidence. Regarding the second argument, in response to Applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). Regarding the instant case, Di Santo teaches a transgenic NOD mouse comprising in its genome a homozygous disruption of Prkdc, a homozygous disruption of IL2rg, and a homozygous disruption of the Flt3 gene (paragraph 0013 and claims 1-8). Di Santo, as stated supra, teaches that they also provide human immune system mice made from a transgenic mouse of their invention. The HIS mice may be made by engrafting the transgenic mouse of the invention with human primary hematopoietic cells, such as CD34+ cells and that the human immune system mouse may generate an immune response consisting of a B-cell, T-cell and/or NK-cell response (paragraphs 0067-0075). Di Santo does not teach wherein their transgenic mouse comprises within its genome a human IL6 transgene. However, Yu teaches that they generated immunodeficient mice. They generated immunodeficient Rag-/- Il2rg-/- mice, in which the gene encoding human IL-6 was knocked into its orthologous mouse locus. They found human IL-6 not only improves thymopoiesis and peripheral T-cell engraftment, but also significantly increases the level of total IgG and antigen-specific IgG. Consistent with enhanced antibody production, higher frequencies of memory B cells and IgG1 B cells, and lower frequencies of transitional and immature B cells were also detected. Furthermore, immunization with OVA induced OVA-specific B cells only in human IL-6 knock-in mice. These OVA-specific antibodies displayed the highest frequency of somatic mutation, further suggesting that human IL-6 is important for efficient antigen-specific B-cell activation and selection (page 959, column 2, paragraph 2-page 960, column 1, paragraph 1 and page 961, column 1, paragraph 1-column 2, paragraph 2, and Supplemental Figure 1). Therefore, there is a clear nexus between Di Santo and Yu as Di Santo wants to use their mouse to generate a human immune system mouse by engrafting the transgenic mouse of the invention with human primary hematopoietic cells to generate an immune response B-cells and Yu identifies that human IL-6 knockin at its orthologous mouse locus improves thymopoiesis and peripheral T-cell engraftment and leads to higher frequencies of memory B cells and IgG1 B cells and lower frequencies of transitional and immature B cells. Furthermore, immunization with OVA induced OVA-specific B cells only in human IL-6 knock-in mice. These OVA-specific antibodies displayed the highest frequency of somatic mutation, further suggesting that human IL-6 is important for efficient antigen-specific B-cell activation and selection. As such, it would have been obvious to further modify the NOD mice of Di Santo to incorporate a human IL6 transgene into the genome as this would improve development of mature B cells and generate a more representative human immunization mouse model. Claims 1 and 74-75 are rejected under 35 U.S.C. 103 as being unpatentable over World Intellectual Property Organization Patent Application No. 2020008066 (Di Santo; referenced in IDS) and Yu et al. (Blood 129: 959-969. 2017) as applied to claim 1 above, and further in view of Savino et al. (Haemotologica 101: 391-393. 2016; referenced in IDS) and Francis et al. (Haemotologica 101: 417-426. 2016; referenced in IDS). This rejection is repeated with regards to the rejection in the Non-final Office action mailed on December 15, 2026. Applicant’s traversal has been addressed above. The teachings of Di Santo and Yu are as discussed above. Di Santo teaches that their transgenic NOD mouse can comprise a transgene encoding TSLP in its genome (claim 1 and paragraph 0013). Di Santo does not specifically state that the transgene is a human TSLP transgene. However, Francis teaches that they developed a xenograft model that can be used to study the role of hTSLP in normal and malignant B lymphopoiesis in immunodeficient NSG mice. Patient-derived xenograft generated from +T mice show functional in vivo hTSLP effects, expanding the production of normal B-cell precursors from hematopoietic stem cells (HSCs) and inducing changes in mTOR-regulated gene expression in primary CRLF2 B-ALL cells (page 418, column 2, paragraph 3-page 424, column 2, paragraph 1). Savino identifies two major limitations of the mouse model used by Francis. First, it is laborious, requiring weekly injections of a large number of genetically modified stromal cells secreting human TSLP. Second, and more importantly, it does not recapitulate the normal sites of production of TSLP and its normal regulation. Savino specifically identifies that this could be achieved by either creating an NSG transgenic mouse with human BAC of TSLP or by a “knock-in” of the human TSLP into the mouse TSLP locus. It is important to create such a mouse model, especially in the light of the possibility that TSLP is made by some BM stromal cells. Recent studies underline the importance of the human BM niche in providing signals of survival and proliferation of normal and malignant hematopoietic cells. Furthermore, it has already been demonstrated in transgenic mice that the local increase in TSLP production induced systemic alterations in B-cell development. It might, therefore, be reasonable to hypothesize that, in addition to the systemic levels of TSLP, local production of TSLP in the bone marrow may protect residual leukemic cells from chemotherapy. A more physiological humanized TSLP mouse model will be required to test this hypothesis (page 392, column 1, paragraph 3-page 393, column 1, paragraph 2). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the transgenic NOD mouse of the combined teachings of Di Santo and Yu by Knock-in of a human TSLP gene at the mouse TSLP locus to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to modify with a reasonable expectation of success because Francis reduces to practice that human TSLP can be produced in immunodeficient NSG mice and improve expansion of normal B-cell precursors from hematopoietic stem cells. Furthermore, Savino directly identifies that there are major limitations with the transgenic mice of Francis that could be overcome by “knock-in” of the human TSLP into the mouse TSLP locus to generate a more physiological humanized TSLP mouse model for mimicking human disease and potential therapeutics. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Claims 1 and 74-76 are rejected under 35 U.S.C. 103 as being unpatentable over World Intellectual Property Organization Patent Application No. 2020008066 (Di Santo; referenced in IDS), Yu et al. (Blood 129: 959-969. 2017), Savino et al. (Haemotologica 101: 391-393. 2016), and Francis et al. (Haemotologica 101: 417-426. 2016) as applied to claims 1 and 74-75 above, and further in view of GenBank (AY037115.1). This rejection is repeated with regards to the rejection in the Non-final Office action mailed on December 15, 2026. Applicant’s traversal has been addressed above. Regarding claim 76, “a nucleotide sequence of SEQ ID NO: 3” is broadly interpreted to include any dinucleotide sequence found in SEQ ID NO: 3. The teachings of Di Santo, Yu, Francis, and Savino are as discussed above. Di Santo does not specifically state that the transgene is a human TSLP transgene. As stated supra, Francis and Savino teach inserting human TSLP into the genome, but do not identify a specific sequence. However, it would have been obvious to one of ordinary skill in the art that the wildtype human DNA could be used. GenBank (AY037115.1) teaches the wildtype human TSLP gene and this sequence (bottom row) comprises a multitude of dinucleotides with 100% sequence identity to dinucleotide sequence in SEQ ID NO: 3 of the instant application (top row) as shown below. 3916 GCAGCCAGAAAGCTCTGGAGCATCAGGGAGACTCCAACTTAAGGCAACAGCATGGGTGAA 3975 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1 GCAGCCAGAAAGCTCTGGAGCATCAGGGAGACTCCAACTTAAGGCAACAGCATGGGTGAA 60 3976 TAAGGGCTTCCTGTGGACTGGCAATGAGAGGCAAAACCTGGTGCTTGAGCACTGGCCCCT 4035 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 61 TAAGGGCTTCCTGTGGACTGGCAATGAGAGGCAAAACCTGGTGCTTGAGCACTGGCCCCT 120 Claims 1 and 85 are rejected under 35 U.S.C. 103 as being unpatentable over World Intellectual Property Organization Patent Application No. 2020008066 (Di Santo; referenced in IDS) and Yu et al. (Blood 129: 959-969. 2017) as applied to claim 1 above, and further in view of Yacoub-Youssef et al. (Transplant Immunology 15: 157-164. 2005). The limitation “engrafted with an allogeneic tissue” is broadly interpreted to include transplantation of an allogeneic tissue as Applicant does not define this term but does recite that “In still further embodiments, a mouse model (e.g., the NSGF, NSGF6, NSGFT, NSGFL, or SGM3F mouse model, or any combination thereof) is used to evaluate a human immune response to tissue transplantation. Thus, provided herein are methods that comprise transplanting tissue (e.g., allogeneic tissue) to a mouse model and evaluating an effect of the transplanted tissue on the human innate immune response. Effects of a transplanted tissue may be evaluated by measuring a human innate immune cell (e.g., T cell and/or dendritic cell) response (e.g., cell death, cell signaling, cell proliferation, etc.) and human adaptive immune response (e.g., antibody production) to the transplanted tissue” (Specification page 25, lines 9-16). The teachings of Di Santo and Yu are as discussed above. As stated supra, Di Santo teaches that they also provide human immune system mice made from a transgenic mouse of their invention. The HIS mice may be made by engrafting the transgenic mouse of the invention with human primary hematopoietic cells, such as CD34+ cells (paragraph 0067). The combined teachings of Di Santo and Yu do not teach engrafting an allogenic tissue. However, Yacoub-Youssef teaches that they reconstituted a human immune system in immunodeficient mice and transplanted human allogenic tissue to assess whether the reconstitution was functional (abstract) It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combined the transgenic NOD mouse of the combined teachings of Di Santo and Yu with the transplantation of allogeneic human tissue to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to combine with a reasonable expectation of success because Yacoub-Youssef teaches that transplanting allogeneic human tissue into human immune system mice is a known procedure for assessing whether reconstitution of the human immune system was functional. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success. Conclusion THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEENAN A BATES whose telephone number is (571)270-0727. The examiner can normally be reached M-F 7:30-5:00. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Doug Schultz can be reached at (571) 272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /KEENAN A BATES/Examiner, Art Unit 1631 /PETER PARAS JR/Supervisory Patent Examiner, Art Unit 1632
Read full office action

Prosecution Timeline

Jan 06, 2023
Application Filed
Sep 09, 2025
Response after Non-Final Action
Dec 15, 2025
Non-Final Rejection mailed — §103
Mar 12, 2026
Response Filed
May 28, 2026
Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12723061
METHOD FOR PREVENTING OR TREATING CANCER BY BLOCKING EXCESSIVE PRODUCTION OF PHOSPHORYLATED VIMENTIN
3y 4m to grant Granted Sep 01, 2026
Patent 12674150
TARGET-SPECIFIC CRISPR MUTANT
1y 1m to grant Granted Jul 07, 2026
Patent 12655380
FLUIDIC DEVICE
4y 9m to grant Granted Jun 16, 2026
Patent 12617828
GENETICALLY MODIFIED IMMUNE CELL, PREPARATION METHOD THEREFOR, AND APPLICATION
4y 7m to grant Granted May 05, 2026
Patent 12605467
RECOMBINANT AAV VECTORS FOR TREATING NEURODEGENERATIVE DISORDERS
1y 6m to grant Granted Apr 21, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
46%
Grant Probability
99%
With Interview (+79.5%)
3y 6m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 77 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month