DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant' s correspondence received December 19, 2025. Claims 1, 5-12, 15-16, 20, 26 and 27 are currently pending.
Any rejection or objection not reiterated herein has been overcome by amendment. Applicant' s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 5-7, 9-12, 15-16, 20, 26 and 27 are rejected under 35 U.S.C. 103 as being unpatentable over Maeder, M. and Bumcrot, D., US 20170029850 A1, published Feb. 2, 2017 and Li, Q. et. al., Molecular Vision, Vol. 14, p. 1760-1769, published September 24, 2008.
Regarding Claim 1, Maeder teaches an isolated AAV nucleic acid vector comprising a first expression cassette comprising a first promoter operably linked to an open reading frame for a Cas nuclease and a second expression cassette comprising a second promoter operably linked to a nucleotide sequence comprising a gRNA targeting the MYOC gene, wherein the viral vector comprises a AAV2 genome and AAV2 capsid: “[A] nucleic acid encodes (a) a sequence that encodes a gRNA molecule comprising a targeting domain that is complementary with a target domain in the MYOC gene … and (b) a sequence that encodes a Cas9 molecule … (a) and (b) are present on the same nucleic acid molecule … the same adeno-associated virus (AAV) vector … methods include an AAV2 vector,” (p. 11, [0169]); “… a promoter operably linked to the sequence that encodes the gRNA molecule of (a) … a promoter operably linked to the sequence that encodes the Cas9 molecule of (b ),” (p. 12, [0183-0184]); “the template nucleic acid is encoded on the same vector backbone, e.g.AAV genome” (p. 464, [1266]); “an AAV capsid that can be used … AAV2” (p. 480, [1543]). Maeder teaches a gRNA having instant SEQ ID NO: 1 and SEQ ID NO: 2 as SEQ ID NO: 3201 and SEQ ID NO: 2950 respectively (p. 158, [0832]; p. 156, [0829]). An alignment is provided below.
SEQ ID NO: 1 1 GTCAGTCATCCATAACTTACA 21
|:|||:||:|||:|||::|||
SEQ ID NO: 3201 1 GUCAGUCAUCCAUAACUUACA 21
SEQ ID NO: 2 1 GACCAGCTGGAAACCCAAACCA 22
|||||||:||||||||||||||
ID NO: 2950 1 GACCAGCUGGAAACCCAAACCA 22
Maeder teaches their invention is for treating disorders of the eye (p. 1, [0008]).
Maeder does not expressly spell out the limitations as arranged in the claim such that one skilled in the art would at once envisage the claimed arrangement of gRNA sequences and AAV selection.
Li teaches the administration of an AAV2 vector to eye tissue (p. 1760, Abstract). Li teaches both AAV 2 genome (p. 1761, AAV serotype 2 production and purification) and AAV2 capsid (p. 1761, Enzyme-linked immunosorbent assays). Li teaches an advantage of using AAV2 for gene therapy in eyes in that subretinal administration had no humoral immune response and allowed for subsequent administration (p. 1760, Abstract, Results).
Regarding Claim 1, it would have been obvious to one skilled in the art before the effective filing date to have performed a combination of prior art elements to known methods to yield predictable results with the vector taught by Maeder, gRNA sequences SEQ ID NO: 3201 and SEQ ID NO: 2950 taught by Maeder and AAV2 genome and capsid taught by Li to create the vector of Claim 1 because in combination, each element performs the same function as it does separately. The vector would allow for transmission and expression of the gRNA sequences, the gRNA sequences would guide Cas proteins to the correct gene, and the AAV2 genome and capsid would allow for delivery to eye tissue. One skilled in the art would have a reasonable expectation of success because Maeder and Li teach successful delivery with AAV vectors. Li provides motivation to select AAV2 for eye tissue because of the reduced immune response. Therefore, Claim 1 is obvious over Maeder and Li.
Regarding Claim 5, Maeder teaches the that “any of the targeting domains… can be used with a S. aureus Cas9 molecule that generates a double stranded break” (p. 158, [0832]). Therefore, Claim 5 is obvious over Maeder and Li.
Regarding Claim 6 and 7, Maeder teaches the use of SEQ ID NO: 1 and 2 of the instant application as SEQ ID NO: 3201 and SEQ ID NO: 2950 respectively as shown in Claim 1. Therefore, Claim 6 and 7 are obvious over Maeder and Li.
Regarding Claim 9, Maeder teaches, “In other embodiments, the promoter is recognized by
RNA polymerase III” (p. 479, [1535]). Therefore, Claim 9 is obvious over Maeder and Li.
Regarding Claim 10, Maeder teaches, “In some embodiments, the Cas9- and/or gRNA encoding
DNA is delivered by … nanoparticles” (p. 481, [1551]). Therefore, Claim 10 is obvious over Maeder and Li..
Regarding Claim 11, Maeder teaches, “Exemplary organic nanoparticles include … SNALP liposomes” (p. 481, [1553]). Therefore, Claim 11 is obvious over obvious over Maeder and Li.
Regarding Claim 12, Maeder teaches “methods … to alter the MYOC gene to treat or prevent POAG [primary open angle glaucoma] by targeting the coding sequence of the MYOC gene… to knockout
the gene, e.g., to eliminate expression of the gene” (p. 2, [0018]). Maeder teaches the subjects of the method include human and non-human animals, including mammals (p. 45, [0279]). Maeder further teaches the methods comprise a step in which “[n]ucleic acids encoding Cas9 molecules, , gRNA molecules, … can be administered to subjects” (p. 507, [1531]). With respect to the vector of Claim 1, Claim 1 is obvious over Maeder and Li. Therefore, Claim 12 is obvious over Maeder and Li
Regarding Claim 15, Maeder teaches the mammal is a human. Therefore, Claim 15 is obvious over Maeder and Li
Regarding Claim 16, Maeder teaches, “Local modes of administration include … intravitreal … delivery directly into the trabecular meshwork” (p. 483, [1567]). Therefore, Claim 16 is obvious over Maeder and Li
Regarding Claim 20, Maeder teaches a method to alter MYOC expression by inactivation through both myocilin genes or expression of a truncated myocilin: “[C]oding sequence of the MYOC gene is targeted to knockout both alleles of the MYOC gene” or “by induction of an alteration comprising a deletion or mutation in the MYOC gene” (p. 2, [0018]). Therefore, Claim 20 is obvious over Maeder and Li.
Regarding Claim 26, Maeder teaches the vector of Claim 1 in a liposome nanoparticle: “Exemplary organic nanoparticles include … SNALP liposomes” (p. 481, [1553]). Therefore, Claim 26 is obvious over Maeder and Li
Regarding Claim 27, Maeder teaches their method is for primary open angle glaucoma and may be used in mammals as described above for Claim 12 (p. 2, [0018]; p. 45, [0279]). Therefore, Claim 27 is obvious over Maeder and Li
Claim 8 is rejected under 35 U.S.C. 103 as being unpatentable over Maeder, M. and Bumcrot, D., US 20170029850 A1 and Li, Q. et. al., Molecular Vision, Vol. 14, p. 1760-1769, published September 24, 2008., published Feb. 2, 2017 as applied to Claim 1 above, and further in view of Gao, C., et. al., CA 3053861 A1, published Aug 23, 2018.
Regarding Claim 8, Claim 1 is obvious over Maeder and Li.
Maeder does not teach “wherein the first promoter is a heterologous RNA polymerase I promoter”.
Gao teaches a vector comprising a “nucleotide sequence encoding the Cas9… operably linked to … a promoter” (p. 10, lines 7-9). Gao further teaches the use of a heterogenous RNA pol I promoter: “Examples of promoters … include … polymerase (pol) I… Examples of Pol I promoters include chicken RNA pol I” (p. 10, lines 10 - 12) Together, this reads as teaching a vector comprising a first promoter operably linked to a Cas nuclease, wherein the first promoter is a heterogenous RNA Pol I promoter.
It would be obvious to one skilled in the art before the effective filing date of the invention to perform a simple substitution with the heterogenous RNA pol I promoter into the vector taught by Maeder because both inventions teach a vector encoding a Cas protein with a operably linked promoter. The substitution would be predictable because RNA pol I promoters are well known and characterized in the art. Therefore, Claim 8 is obvious over Maeder and Li in further view of Gao.
RE: Applicant’s Arguments
In the response dated December 19, 2025, Applicant argues, “Maeder provides no reason or guidance on how or why one of skill in the art might select Applicant’s SEQ ID NOs: 1 or 2 from any other of Maeder’s voluminous sequences and then use them in combination with a viral vector comprising the AAV2 genome and capsid.” This argument is not persuasive because Maeder’s invention may be used in a combination of known prior art elements with SEQ ID NOs 1 and 2 and AAV2 genome and capsid as described in the rejection of Claim 1. SEQ ID NO: 1 and 2 are known in the art as described by Maeder, AAV2 genome and capsid are known in the art as described by Maeder and Li, and one skilled in the art would recognize each known element would perform the same function in combination.
Applicant further states, “Applicant discovered the claimed combination of gRNAs having SEQ ID NO: 1 or 2 having high efficiency in inactivating the human myocilin gene in human trabecular meshwork cells and AAV2/2”. If the applicant intends to argue unexpected results, MPEP 716.02(b) recites, “Applicants have burden of explaining proffered data”. The citations provided are insufficient explanations for what unexpected results are provided in the specification and how the results compare to the prior art.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Krishna Nuggehalli Ravindra whose telephone number is (571)272-2758. The examiner can normally be reached M-Th, alternate F, 8a-5p est.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/K.N.R./Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636