DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims 1, 15, 28-40 are pending.
Election/Restrictions
Applicant’s election without traverse of Invention Group III, Claims 28-40, in the reply filed on 13 July 2026 is acknowledged.
Claims 1 and 15 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected invention groups, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 13 July 2026.
Applicant’s election of the species: PDE9 inhibitors, cardiac disease, amyloid accumulation in the myocardium (including transthyretin cardiac amyloidosis), and chaperoneopathies in the reply filed on 13 July 2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Note that Applicant is entitled to examination of a single disease. As explained in the Requirement for Restriction/Election of Species (see p. 4), there is a serious examination burden for the patentably distinct species (kinds of diseases) because 35 U.S.C. 112(a) are relevant to one species or grouping of patentably indistinct species that are not relevant to the other species or grouping(s) of patentably indistinct species. For example, the Spec. has not demonstrated enablement for each species of disease recited in the claims.
Amyloid accumulation in the myocardium was searched and was found to not be a chaperoneopathy. However, John (2018. Arrhythmias in Cardiac Amyloidosis. J. Innov. Cardiac Rhythm Manage. 9[3]:3051, “John”) teaches (§Abstract) cardiac arrhythmia is a result of transthyretin cardiac amyloidosis so Claim 40 will be examined to the extent it reads on cardiac arrhythmia as a result of transthyretin cardiac amyloidosis.
Claims 35 and 38 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 13 July 2026.
Claims 28-34, 36-37, and 39-40 are examined.
Information Disclosure Statement
The Spec. cites references.
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
The IDS(es) has been considered.
Drawings
The drawings are objected to because of the following informalities and because the Spec. indicates that some Figs. should show color. Color Drawings are allowed only with a granted petition. If color Drawings are desired, see instructions related to that below.
Minor informalities:
All the figures are blurry and should be replaced with clearer versions.
Figs. 1-6 and 13, 15, 17 are so unclear the text is not legible.
Fig. 5A: it looks like a partial figure; the entire structure isn’t shown.
Fig. 11: details of micrographs are not discernable.
Fig. 18 purports to show color but the Fig. is black/white. Also, like all the other Figs., the images should be replaced with clearer versions.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Instructions related to color drawings
Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification:
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2).
Specification
The disclosure is objected to because of the following informalities:
¶11, ¶18, ¶103 describe color that isn’t shown.
¶8 refers to stimulated ischemia but other ¶ refer to (e.g., ¶14) simulated ischemia. Please confirm that intended terminology is used.
¶63 is missing “in” in knock-mouse and should read knock-in mouse.
Appropriate correction is required.
The use of the following term(s), which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
¶66: Novex®, Bio-rad®
¶71: Trizol®, TaqMan®,
¶72: Cyclex®
¶73: Qiagen®
¶77: Clariostar®
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. This list may not be exhaustive. Applicant is responsible for identifying and fixing all instances of tradenames unaccompanied by proper marks.
Claim Interpretation
Claim 28 recites carboxy terminus of heat shock cognate 70 interacting protein (CHIP). That entire recitation (carboxy terminus of heat shock cognate 70 interacting protein) is the name of the protein CHIP. The protein CHIP is encoded by the STUB1 gene.
The claim also recites “proteotoxicity” which the Spec. defines (¶31): The term "proteotoxicity,'' as used herein, refers to any impairment of cellular function as a result of protein misfolding or aggregation.
Claim 33 recites PDE9 inhibitors that increase NP-dependent cGMP stimulation. McMurray (and Docherty. 2019. Phosphodiesterase-9 Inhibition in Heart Failure A Further Opportunity to Augment the Effects of Natriuretic Peptides? J. A. Coll. Cardiol. 74[7], “McMurray”) teaches (¶3) increasing transduction of the NP/cGMP pathway is an outcome of PDE9 inhibition. Therefore any PDE9 inhibitor is interpreted to increase NP-dependent cGMP stimulation.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 28, 31-34, 36-37, and 39-40 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a written description rejection.
There is a written description problem with the claims because they encompass molecules whose structure cannot be envisioned because the claims are directed to generic classes of molecules defined solely by their functions.
Claim 28 recites a method of treating a disease caused by proteotoxicity in a cell, said method comprising increasing or inducing the activity of carboxy terminus of heat shock cognate 70 interacting protein (CHIP) in a subject in need thereof.
That broad claim encompasses the large genus of ways to increase or induce activity of CHIP in a subject. It is understood that increasing or inducing CHIP activity in a subject requires administering some kind of substance to the subject. Any kind of substance that increases or induces activity of CHIP would be encompassed by the claims as instantly presented.
There is a written description problem with the claims because they encompass a broad genus of molecules whose structure cannot be envisioned because the claims are directed to generic classes of molecules defined solely by their functions of increasing or inducing CHIP activity.
Claims 31-33 recite wherein increasing or inducing activity of CHIP comprises increasing or inducing PKG activity in the subject (Claim 31) including by using an agent that stimulates PKG activity (Claim 32) and wherein the agent can be a PDE9 inhibitor that increases NP-dependent cGMP stimulation (Claim 33).
Those broad claims encompass the large genus of ways to increase or induce PKG activity in a subject. It is understood that increasing or inducing PKG activity in a subject requires administering some kind of substance to the subject. Any kind of substance that increases or induces activity of PKG, any kind of agent that stimulates PKG activity, and any kind of PDE9 inhibitor would be encompassed by the claims as instantly presented.
There is a written description problem with the claims because they encompass broad genera of molecules whose structure cannot be envisioned because the claims are directed to generic classes of molecules defined solely by their functions of increasing or inducing PKG activity, stimulating PKG activity, and inhibiting PDE9.
An original claim may lack written description support when a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. See MPEP 2163.
The Spec. describes that (¶29, ¶39-45) their disclosure is based on a finding that the phosphorylation status of a serine residue of CHIP, specifically wherein phosphorylating human CHIP at serine 19 (S19), increases its binding to HSC70 which results in clearance of stress-induced ubiquitinated insoluble proteins. The Spec. teaches increasing/inducing CHIP activity by (¶40) administering to a cell a nucleic acid sequence encoding CHIP wherein the encoded CHIP protein comprises a S[Wingdings font/0xE0]E substitution at position 19. The Spec. further teaches other ways to increase or induce CHIP activity: (¶46-49) increasing or inducing phosphorylation of human and mouse CHIP may be accomplished by, for example, increasing or inducing the activity of kinase(s) that are directly or indirectly involved in CHIP phosphorylation and increasing or inducing the activity of protein kinase G (PKG) in the cell. The Spec. discloses in general terms other ways of increasing or inducing CHIP that include altering a gene or DNA sequence using various gene editing technologies.
Regarding increasing or inducing PKG activity, the Spec. teaches that can be accomplished by (¶48-49) contacting a cell with an agent that stimulates PKG activity which includes a variety of agents and compounds… that include, but are not limited to, nitric oxide donors, organic nitrates, soluble guanylate cyclase stimulators, PDES inhibitors that enhance NO-dependent cGMP synthesis, natriuretic peptides (NP), neprilysin inhibitors, and PDE9 inhibitors. The Spec. refers to exemplary PDE9 inhibitors.
In addition that what the Spec. discloses, an artisan would readily understand that there are many ways to “increase or induce” activity of a protein: small molecules, agonizing antibodies, activating nucleotides that act on CHIP or PKG; as well as increasing or inducing upstream activators or inhibiting or repressing upstream inhibitors. Similarly, an artisan would readily understand that there are many ways to inhibit PDE9 activity. The Spec. hasn’t disclosed what physical structure amongst those various agents is responsible for the function(s).
Regarding what structure is encompassed by the agent(s) used to increase or induce CHIP activity or PKG activity, stimulate PKG activity, or inhibit PDE9, the Spec. does not provide information describing its features. The Spec. does not disclose what physical structure(s) is responsible for each claimed function.
What Applicant’s examples show is described in the following ¶. Note that, as explained in §Drawings, the text of the figures is illegible and it is not possible to discern details of the data shown in these figures. Therefore this summary of what’s shown in the Examples relies on Applicant’s interpretation of their data and is subject to change upon presentation of clear, legible figures.
Example 1 (¶79-82, Figs. 1, 8) discloses that (1) cells wherein PDE5 is inhibited with PDE5-inhibitor sildenafil (SIL) and (2) cells transduced with CHIP-S20E are more resistant to simulated ischemia (SI) than cells not administered SIL or cells expressing CHIP-SA (a null version of CHIP). That indicates that administering the PKG activator SIL or expressing CHIP-S20E in cells can treat ischemia.
Example 2 (starts at ¶83, Fig. 2) discloses that administering cGMP or PDE5-inhibitor SIL phosphorylates CHIP’s serine at position 20 (CHIP-S20E), which indicates that administering cGMP or SIL activates CHIP.
Example 3 (starts at ¶86, Figs. 3, 8) discloses expressing CHIP-S20E reduces ubiquitinated proteins in SI myocytes vs. WT or CHIP-S20A. That indicates administering CHIP-S20E can improve SI-induced cytotoxicity.
Example 4 (starts at ¶89, Figs. 4, 9, 11-12) discloses that overexpressing PDE5A increases bad outcomes after myocardial infarction (MI). That example doesn’t have bearing on the claims because they recite activating PKG and activating PKG by inhibiting PDE9.
Example 5 (starts at ¶92, Fig. 5) CHIP-S20E has increased affinity for HSP70 (vs. CHIP-WT or CHIP-S20A affinity for HSP70) and increased half-life vs. CHIP-S20A.
Example 6 (starts at ¶98; Fig. 6) mice expressing from embryonic stage CHIP-S20E have (vs. WT) lower mortality after myocardial infarction (MI), reduced infarction size, improved heart function, and increased clearance of ubiquitinated proteins after MI. That example shows that expressing CHIP-S20E from embryonic development improves MI-related outcomes. However, the example doesn’t have bearing on the claims because it doesn’t comprise a method step that could be taken in a subject.
Example 7 (starts at ¶102; Figs. 18-19) discloses that mouse and human cardiomyocytes were transfected with CHIP-SE or a null version (CHIP-SA) and cultured with mutant transthyretin (TTR) (which is presumably insoluble and causes aggregates) and PKG was activated (or not) with cGMP. That § teaches the cardiomyocytes in the CHIP-SE cells less accumulated TTR. That example also shows that stimulating PKG activity with cGMP reduced TTR accumulation in CHIP-WT cells. The example describes that (¶104) contents of cell lysates were analyzed (i.e., cells were lysed and TTR abundance was determined…), indicating that what was analyzed was intracellular proteins. Those data show that expressing CHIP-SE or administering PKG activator cGMP can clear TTR aggregates.
Example 8 (starts at ¶105; Fig. 20) discloses that clearance of TTR relies on Lamp2A expression because when Lamp2A is targeted with siRNA, CHIP-SE no longer clears TTR. Example 9 (starts at ¶107, Fig. 21) discloses that expressing CHIP-SE reduces TTR accumulation in cardiac fibroblasts. The example describes that (¶108) TTR accumulated in the CHIP WT fibroblasts, indicating that TTR accumulated intracellularly. Those data show that expressing CHIP-SE can clear TTR aggregates.
Altogether, the Examples show that expressing CHIP-S20E from embryonic stage improves MI-related outcomes and that exogenous expression of CHIP-SE improves clearance of TTR. Regarding activating PKG, the examples merely show administering cGMP to increase clearance of TTR. Those examples do not demonstrate possession of a method comprising administering any agent that increases or induces CHIP activity or PKG activity, or any agent that stimulates PKG activity. Furthermore, none of the examples demonstrates possession of any method comprising administering any PDE9 inhibitor because no examples show any PDE9 inhibitors.
However, those examples are not sufficient to provide written description support for any agent that increases or induces CHIP activity or PKG activity, any agent that stimulates PKG activity, or any PDE9 inhibitor. Although the claims claim the functional characteristics (i.e., increasing or inducing CHIP activity or PKG activity, stimulating PKG activity, or inhibiting PDE9), the functional characteristic is not coupled with any known structure.
Although the Specification teaches the examples discussed above, it does not identify a core structure necessary for performing the claimed function(s) of increasing or inducing CHIP activity or PKG activity, stimulating PKG activity, or inhibiting PDE9. The Spec. does not disclose any core structure, partial structure, physical or chemical property, or functional characteristic coupled with a known or disclosed structure/function relationship responsible for increasing or inducing CHIP activity or PKG activity, stimulating PKG activity, or inhibiting PDE9 in such a way to demonstrate possession of the full invention as claimed at time of filing. Any of the plethora of ways or agents used to increase or induce CHIP activity or PKG activity, stimulate PKG activity, or inhibit PDE9 do not share a core structure.
The specification teaches only these species within the claimed genus/genera: increasing or inducing CHIP activity by administering an adenovirus encoding CHIP-SE and administering the PKG activators cGMP or SIL. But those are only a paltry number compared with the breadth of what is claimed. Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genera and subgenera that are encompassed by the claims.
While none of these elements is specifically required to demonstrate possession, in combination their absence means that one skilled in the art at the time of filing would conclude that the inventors lacked possession of the full breadth of the invention claimed. Claims 28 and 31-34 are is rejected for failing to demonstrate possession of the claimed invention. Claims 31-34, 36-37, and 39-40 are rejected because they depend from Claims 28 and 31-34 and do not remedy the issues. Note that there is a 112(b) rejection over Claims 29-30. This should be resolved or else Claims 29-30 will be included in this WD rejection.
Claims 28-35, 36-37, and 39-40 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for:
A method for treating:
ischemia or
transthyretin cardiac amyloidosis (ATTR-CA) by clearing transthyretin in a subject,
said method comprising:
administering to the subject a composition comprising a nucleic sequence encoding SEQ ID NO 1 wherein SEQ ID NO 1 comprises a glutamic acid substitution at position 19 (S19E), and/or
administering to the subject a composition comprising sildenafil, and/or
administering to the subject a composition comprising a PDE9 inhibitor selected from the group consisting of PF-04447943 and BI-409306;
does not reasonably provide enablement for the full scope of the claims as written. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims. This is a scope of enablement rejection.
The factors to be considered in determining whether a disclosure would require undue experimentation include: (A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the specification; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. In re Wands, 8 USPQ2d, 1400 (CAFC 1988) and MPEP 2164.01.
The breadth of the claims and the nature of the invention: With respect to claim breadth, the standard under 35 U.S.C. §112(a) entails determining what the claims recite and what the claims mean as a whole.
Methods of Claim 28 have been interpreted as methods of administering an agent that increases or induces activity of CHIP in a subject because that is what is disclosed in the Spec.: The Spec. teaches (¶40) administering to a cell a nucleic acid sequence encoding CHIP wherein the encoded CHIP protein comprises a S[Wingdings font/0xE0]E substitution at position 19 and (¶46-49) other ways to increase or induce CHIP activity: increasing or inducing phosphorylation of human and mouse CHIP may be accomplished by, for example, increasing or inducing the activity of kinase(s) that are directly or indirectly involved in CHIP phosphorylation and increasing or inducing the activity of protein kinase G (PKG) in the cell. The Spec. discloses other ways of increasing or inducing CHIP that include altering a gene or DNA sequence using various gene editing technologies. In addition, the Spec. teaches that increasing or inducing PKG activity can be accomplished by (¶48-49) contacting a cell with an agent that stimulates PKG activity which includes a variety of agents and compounds… that include, but are not limited to, nitric oxide donors, organic nitrates, soluble guanylate cyclase stimulators, PDES inhibitors that enhance NO-dependent cGMP synthesis, natriuretic peptides (NP), neprilysin inhibitors, and PDE9 inhibitors.
The broadest reasonable interpretation (BRI) of Claim 28 is increasing or inducing CHIP activity can treat any disease caused by a proteotoxicity. The BRI of Claim 34 is that increasing or inducing CHIP activity can treat any cardiac disease caused by a proteotoxicity. The BRI of Claim 36 is that increasing or inducing CHIP activity can treat any amyloid accumulation in the myocardium. The BRI of Claim 39 is that increasing or inducing CHIP activity can treat any proteinopathy. The BRI of Claim 40 is that increasing or inducing CHIP activity can treat any cardiac arrhythmia caused by proteotoxicity or by a proteinopathy.
The BRI of Claim 29 is that CHIP activity is increased or induced by administering a composition comprising a nucleic acid sequence encoding human CHIP wherein the human CHIP sequence is SEQ ID NO 1 that comprises any phosphomimetic AA substitution at position 19. Note that Claim 29 is interpreted as requiring the nucleic acid sequence encoding a human CHIP comprises SEQ ID NO 1 (see §112b). The BRI of Claim 30 is that the phosphomimetic AA substitution can be glutamic acid (S19E) or aspartic acid (S19D) and either of those will induce/increase CHIP activity (and will treat any disease caused by a proteotoxicity).
The BRI of Claim 31 is that increasing or inducing CHIP activity by increasing or inducing PKG activity will treat any disease caused by a proteotoxicity. The BRI of Claim 32 is that increasing or inducing CHIP activity by stimulating PKG activity will treat any disease caused by a proteotoxicity. The BRI of Claim 33 is that increasing or inducing CHIP activity by administering any PDE9 inhibitor will treat any disease caused by a proteotoxicity.
The nature of the invention is methods of treating any disease caused by any proteotoxicity, any cardiac disease, any amyloid accumulation in the myocardium, any proteinopathy, and any cardiac arrhythmia by increasing or inducing CHIP activity; methods of treating any disease caused by any proteotoxicity by increasing or inducing CHIP activity by administering a composition comprising a nucleic acid sequence encoding SEQ ID NO 1 comprising any phosphomimetic AA substitution at position 19 or wherein that substitution is S19E or S19D; and methods of treating any disease caused by any proteotoxicity by increasing or inducing CHIP activity by increasing or inducing activity of PKG, including using any agent that stimulates PKG, or using any PDE9 inhibitor.
A skilled artisan would not be able to use the method as claimed with a reasonable expectation of success based solely on what is disclosed in the specification for at least the following reasons:
It would not be possible to treat any disease caused by proteotoxicity because Applicant hasn’t demonstrated successfully treating any disease caused by proteotoxicity, any cardiac disease caused by proteotoxicity, any amyloid accumulation, any proteinopathy, or any cardiac arrythmia.
Applicant hasn’t shown any evidence that using SEQ ID NO 1 comprising any phosphomimetic at position 19 or an S19D substitution successfully results in any of their claimed outcomes.
The state of the art and prior art, the level of one of ordinary skill, and the level of predictability in the art: Regarding (1): The art indicates that a person of ordinary skill would determine that using the full breadth of the claimed method to successfully treat any proteotoxicity is unpredictable.
The art of Wilson (2023. Extracellular protein homeostasis: The dawning of a new age for human disease therapies?. Clin. Transl. Med. 13:e1305, “Wilson”) teaches (§Main text ¶1) maintenance of protein homeostasis is especially important in extracellular spaces. Wilson teaches (Table 1) a list of human diseases associated with extracellular protein misfolding and aggregation. Wilson teaches (final ¶) therapeutic compounds for manipulating extracellular protein homeostasis and treating such diseases should promote cellular uptake for intracellular degradation, which indicates that if these extracellular aggregates are to be degraded, they need to be taken up by the cell. Kim (et al. 2019. Pathologic Findings of Amyloidosis: Recent Advances. From the Edited Volume: Amyloid Diseases, D. Kurouski, ed. “Kim 2019”) teaches (§Abstract) amyloids are aggregations of misfolded proteins that are insoluble and deposited extracellularly or intracellularly but, (§2. Molecular pathogenesis ¶7) e.g., islet amyloid polypeptide (IAPP) is secreted and forms deposits in type 2 diabetes. Casas (et al. 2007. Abstract only: Impairment of the Ubiquitin-Proteasome Pathway Is a Downstream Endoplasmic Reticulum Stress Response Induced by Extracellular Human Islet Amyloid Polypeptide and Contributes to Pancreatic β-Cell Apoptosis. Diabetes 56[9]:2284, “Casas”) teaches (§Abstract-Conclusions) extracellular IAPP aggregation causes islet amyloidosis in type 2 diabetes and mediates β-cell apoptosis. Applicant hasn’t presented any evidence that their methods can treat any disease caused by proteotoxicity, including islet amyloidosis.
In addition, Casas indicates that disease occurs in the extracellular space and Wilson also teaches some diseases caused by proteotoxicity occur in the extracellular space. The art of Protein Atlas (2026. “STUB1”. Available online at proteinatlas.org. Accessed on 04 August 2026. “Atlas”) teaches (§Protein expression and localization) CHIP is an intracellular protein. Joshi (et al. 2016. A Decade of Boon or Burden: What Has the CHIP Ever Done for Cellular Protein Quality Control Mechanism Implicated in Neurodegeneration and Aging? Frontiers Molec. Neurosci. 9:93, “Joshi”) indicates that (§Abstract) any of CHIP’s known functions occur inside cells, not extracellularly.
In contrast, Wilson discussed that many diseases caused by proteotoxicity are characterized by extracellular deposits. In addition, Macario (and Macario. 2007. Minireview: Chaperonopathies and chaperonotherapy. FEBS Lett. 581:3681, “Macario”) teaches (§6. Direct demonstration at the molecular level of the chaperoning effect in misfolding-protein pathology-6.1. Alzheimer’s disease and -6.2 Parkinson’s disease, entire §) a characteristic feature of protein misfolding pathologies, among which are neurodegenerative diseases such as Parkinson’s, Alzheimer’s and Huntington’s, is the presence in brain tissue of intra- and extracellular accumulation of protein oligomers, amorphous aggregates, fibrils, and plaques and that (§6.1. Alzheimer’s disease ¶1-2) a landmark of Alzheimer’s disease is the presence of extracellular amyloid plaques in the brain.
Together, Wilson, Kim 2019, Casas, and Macario teach that pathology of many diseases caused by proteotoxicity and many proteinopathies occur in the extracellular space. Applicant has not demonstrated or provided any evidence that CHIP acts in the extracellular space or that inducing/increasing CHIP activity is able to clear toxic proteins from the extracellular space. Applicant’s experiments (described next in §The amount of direction provided by the specification and the existence of working examples) do not shown any treatment that affects the extracellular space. Therefore, although the skill set of a person of ordinary skill is quite high, they would determine that using the claimed methods to successfully treat any disease caused by proteotoxicity or to treat any proteinopathies or any cardiac arrhythmia is unpredictable.
Furthermore, the art of Kim (et al. 2016. Phosphorylation of CHIP at Ser20 by Cdk5 promotes tAIF-mediated neuronal death. Cell Death Differentiation 23:333, “Kim”, of record on IDS) teaches (§Main text ¶1) CDK5 can be hyperactivated by conversion of its activator p35[Wingdings font/0xE0]p25 via calpain. Kim teaches (Title, §Abstract, Fig. 1) CDK5-mediated phosphorylation of CHIP at mouse Serine 20 (S20) negatively regulates CHIP’s neuroprotective function, thereby contributing to neuronal cell death progression following neurotoxic stimuli. Kim cites Patrick (et al. 1999 Conversion of p35 to p25 deregulates Cdk5 activity and promotes neurodegeneration. Nature 402[9]:615, “Patrick) which teaches that (§Abstract, §Main text ¶1-2) p25 is a truncated version of the protein, p25/CDK5… reduces the ability of tau to bind microtubules, and the conversion of p35 to p25 is involved in the pathogenesis of AD. Therefore the p25/CDK5 phenomenon described by Kim and Patrick can be characterized as a proteotoxicity (i.e., impairs cellular function as a result of protein aggregation) that causes the disease neurodegeneration. Since Kim teaches CDK5-mediated phosphorylation of CHIP at mouse S20 negatively regulates (i.e., reduces) CHIP’s neuroprotective function, a person of ordinary skill would reasonably determine that the full breadth of the claimed method could not be used to successfully treat any disease caused by a proteotoxicity.
Finally related to (1): Yoshida (et al. 2022. Necessity of integrated genomic analysis to establish a designed knock‑in mouse from CRISPR‑Cas9‑induced mutants. Sci. Rep. 12:20390, “Yoshida”) teaches (§Abstract, §Main text ¶1-3):
(¶3) [while it is] critical to obtain the designed and precise knock-in rodents in order to reproduce these human pathological conditions and to elucidate the molecular mechanisms underlying diseases and physiological functions (¶2) some obstacles remain in producing an accurate and rapid knock-in rodent model using these techniques… [and] conventional PCR analysis, which is frequently used for genotype confirmation, failed to identify such multiple integration events in most cases, leading to a high rate of erroneous identification of mutants as correct single copy recombination events.
That indicates that knock-in mutants are unpredictable models for elucidating molecular mechanisms underlying diseases and physiological functions.
In addition, Mattar (et al. 2024. Embryo and fetal gene editing: Technical challenges and progress toward clinical applications. Mol. Ther. Methods Clin. Dev. 32[2]:101229, “Mattar”) teaches (§Prenatal genetic diagnosis) early interventions—treating a fetus or embryo—have increased therapeutic efficacy compared with the same treatment applied to infants. Without evidence demonstrating otherwise (i.e., evidence pertinent to Applicant’s claimed methods), Mattar’s teachings indicate that a knock-in mutant mouse, expressing a mutant gene from the embryonic stage, is not a suitable model for treating a disease by administering a treatment to any subject who isn’t an embryo or fetus. As discussed below, some of Applicant’s examples use knock-in mice to substantiate some of their findings.
The teachings of Yoshida and Mattar indicate that knock-in model mice are only an unpredictable model for elucidating molecular mechanisms underlying diseases and physiological functions.
Regarding (2): The art of Kozelekova (et al. 2022. Phosphorylated and Phosphomimicking Variants May Differ—A Case Study of 14-3-3 Protein. Frontiers Chem. 10: 835733, “Kozelekova”) teaches all phosphomimetic substitutions do not have equivalent effects. Kozelekova teaches:
(§Abstract) in the present study, we describe the full and specific phosphorylation of 14-3-3ζ protein at Ser58 and we compare its characteristics with phosphomimicking mutants that have been used in the past (S58E/D). Our results show that in case of the 14-3-3 proteins, phosphomimicking mutations are not a sufficient replacement for phosphorylation.
Kozelekova teaches (same §) phosphomimicking mutations may not faithfully represent the effects of phosphorylation on the protein structure and function and teaches their use should be justified by comparing to the genuinely phosphorylated counterpart. Applicant has shown phosphorylation of CHIP and CHIP-S20E cause similar—not identical (e.g., Fig. 3B)—outcomes in the circumstances they tested. However, Applicant has not shown what happens when CHIP comprises any phosphomimetic substitution or phosphomimetic S20D. Kozelekova shows (entire §: §Selected 14-3-3ζ Mutants for Comparison With pζ; § Phosphorylation and Phosphomimicking Mutations Have Different Impact on 14-3-3ζ Oligomeric State; Table 1; Fig. 3) the ζS58E and ζS58D have different properties.
Although Kozelekova’s experiments applied different phosphomimetic substitutions to the protein 14-3-3 and not to CHIP, a person of ordinary skill would understand that their findings are widely applicable to any phosphomimetic substitution on any protein. For example, Kozelekova teaches (§§, Table, and Fig. cited above, also Fig. 4) phosphorylated ζ (pζ), ζS58D, and ζS58E have different molecular weights (MW) and other different characteristics—characteristics which result from their different structure(s) and therefore function(s)—including different dimerization KD, and a person of ordinary skill would determine that those different characteristics would affect function in vivo. Therefore an artisan would determine that the outcome of using methods comprising CHIP comprising any phosphomimetic AA substitution or an S19D substitution at position 19 would be unpredictable because any of those variations hasn’t been demonstrated efficacious.
Altogether, the state-of-the-art indicates successfully using the full breadth of the claimed methods is unpredictable.
The amount of direction provided by the specification and the existence of working examples: What is enabled by the working examples is narrow compared to the breadth of the claims.
What Applicant’s examples show is described in the following ¶. Note that, as explained in §Drawings, the text of the figures is illegible and it is not possible to discern details of the data shown in these figures. Therefore this summary of what’s shown in the Examples relies on Applicant’s interpretation of the and is subject to change upon presentation of clear, legible figures.
Example 1 (¶79-82, Figs. 1, 8) discloses that cells wherein PDE5 is inhibited with PDE5-inhibitor sildenafil (SIL) and cells transduced with CHIP-S20E are more resistant to simulated ischemia than cells not administered SIL or cells expressing CHIP-SA. That indicates that administering the PKG activator SIL or expressing CHIP-S20E in cells can treat ischemia.
Example 2 (starts at ¶83, Fig. 2) discloses that administering cGMP or PDE5-inhibitor SIL phosphorylates CHIP’s serine at position 20 (CHIP-S20E), which indicates that administering cGMP or SIL activates CHIP.
Example 3 (starts at ¶86, Figs. 3, 8) discloses expressing CHIP-S20E reduces ubiquitinated proteins in SI myocytes vs. WT or CHIP-S20A (a null version of CHIP). That indicates administering CHIP-S20E can improve SI-induced cytotoxicity.
Example 4 (starts at ¶89, Figs. 4, 9, 11-12) discloses that overexpressing PDE5A increases bad outcomes after myocardial infarction (MI). That example doesn’t have bearing on the claims because they recite activating PKG and activating PKG by inhibiting PDE9.
Example 5 (starts at ¶92, Fig. 5) CHIP-S20E has increased affinity for HSP70 (vs. CHIP-WT or CHIP-S20A affinity for HSP70) and increased half-life vs. CHIP-S20A.
Example 6 (starts at ¶98; Fig. 6) mice expressing from embryonic stage CHIP comprising S20E have (vs. WT) lower mortality after myocardial infarction (MI), reduced infarction size, improved heart function, and increased clearance of ubiquitinated proteins after MI. That example shows that expressing CHIP-S20E from embryonic development improves MI-related outcomes. However, the example doesn’t have bearing on the claims because it doesn’t comprise a method step that could be taken in a subject.
Example 7 (starts at ¶102; Figs. 18-19) discloses that mouse and human cardiomyocytes were transfected with CHIP-S20E or a null version (CHIP-SA) and cultured with mutant transthyretin (TTR) (which is presumably insoluble and causes aggregates) and PKG was activated (or not) with cGMP. That § teaches the cardiomyocytes in the CHIP-SE cells less accumulated TTR. That example also shows that stimulating PKG activity with cGMP reduced TTR accumulation in CHIP-WT cells. The example describes that (¶104) contents of cell lysates were analyzed (i.e., cells were lysed and TTR abundance was determined…), indicating that what was analyzed was intracellular proteins. Those data show that expressing CHIP-SE or administering PKG activator cGMP can clear TTR aggregates. Note that the part of the example that discusses human cells doesn’t specify that they used CHIP-S19E rather than CHIP-S20E (mouse gene) but a person of ordinary skill would understand that they need to express the human protein in a human.
Example 8 (starts at ¶105; Fig. 20) discloses that clearance of TTR relies on Lamp2A expression because when Lamp2A is targeted with siRNA, CHIP-SE no longer clears TTR. Example 9 (starts at ¶107, Fig. 21) discloses that expressing CHIP-S20E reduces TTR accumulation in cardiac fibroblasts. The example describes that (¶108) TTR accumulated in the CHIP WT fibroblasts, indicating that TTR accumulated intracellularly. Those data show that expressing CHIP-SE can clear TTR aggregates.
Altogether, the Examples show that expressing CHIP-SE from embryonic stage improves MI-related outcomes; as explained that isn’t relevant to the claims because of the teachings of Yoshida and Mattar and because it doesn’t encompass a method step. The Examples also show that exogenous expression of CHIP-S20E improves clearance of intracellular TTR and improves ischemia-induced cytoxicity. They show activating PKG using SIL improves ischemia-induced cytoxicity and activating PKG using cGMP can clear intracellular TTR aggregates. Those examples demonstrate treatment of ATTR-CA but not any amyloid accumulation in the myocardium. As discussed above, Wilson, Kim, and Casas indicate that many kinds of diseases caused by proteotoxicity are characterized by extracellular deposition of amyloid. Since Applicant’ hasn’t demonstrated treating those proteotoxicity diseases characterized by extracellular depositions, a person of ordinary skill would reasonably determine that successfully using the claimed method to treat any disease or any cardiac disease caused by any proteotoxcity, any amyloid accumulation in the myocardium, any proteinopathy, and/or any cardiac arrhythmia is unpredictable.
Applicant’s examples do not demonstrate successfully treating any disease caused by proteotoxicity by increasing or inducing CHIP activity in a subject using any means. They do not show a method of successfully treating any cardiac disease or any amyloid accumulation in the myocardium. They do not show successfully treating any proteinopathy or any cardiac arrhythmia. They do not show treating any disease by administering a nucleic acid comprising SEQ ID NO 1 wherein S19 is substituted with aspartic acid.
Although the level of an artisan is high, the art of treating disorders is unpredictable. The art indicates there are numerous diseases caused by proteotoxicity or proteinopathy. The art indicates there are numerous conditions that cause cardiac arrhythmia. The art indicates that phosphomimetic substitutions do not result in predictable outcomes. Therefore, a person of ordinary skill in the art would reasonably determine that successfully using the full scope of the invention as claimed to treat any proteotoxicity or proteinopathy or cardiac arrhythmia is unpredictable. A person of ordinary skill in the art would reasonably determine that, in view of a lack of evidence demonstrating otherwise, successfully using SEQ ID NO 1 comprising an S19D mutation is unpredictable.
Regarding using a PDE9 inhibitor (the elected species), McMurray (and Docherty. 2019. Phosphodiesterase-9 Inhibition in Heart Failure A Further Opportunity to Augment the Effects of Natriuretic Peptides? J. A. Coll. Cardiol. 74[7], “McMurray”) teaches (¶3) increasing transduction of the NP/cGMP pathway is an outcome of PDE9 inhibition. Applicant’s examples describe activating PKG by administering cGMP. McMurray indicates that any PDE9 inhibitor should increase NP-dependent cGMP stimulation. In addition, the art of Charnigo (et al. 2017. Safety and Tolerability of PF-04447943 across a Clinical Trial Program Including 277 Patients. Blood 130 [Suppl. 1]):3558, “Charnigo”) and Moschetti (et al. 2016. First‐in‐human study assessing safety, tolerability and pharmacokinetics of BI 409306, a selective phosphodiesterase 9A inhibitor, in healthy males. Br. J. Clin. Pharmacol 82[5]:1315, “Moschetti”) indicate the PDE9 inhibitors (Charnigo §Abstract-Conclusion) PF-04447943 and (Moschetti §Abstract-Conclusion) BI 409306 are safe and well-tolerated. Since the Spec. teaches increasing cGMP activates PKG (which, they show, clears intracellular TTR or treats ischemia) and the art teaches that PDE9 inhibitors increase cGMP, a person of ordinary skill would determine that PDE9 inhibitors may be used to increase cGMP, which would increase PKG which would activate CHIP. That is why those two PDE9 inhibitors are included in the scope of what is considered enabled.
The quantity of experimentation needed to make or use the invention: The standard of an enabling disclosure is not the ability to make and test if the invention works but one of the ability to make and use with a reasonable expectation of success. A patent is granted for a completed invention, not the general suggestion of an idea (MPEP 2164.03 and Chiron Corp. v. Genentech Inc., 363 F.3d 1247, 1254, 70 USPQ2d 1321, 1325-26 (Fed. Cir. 2004). The instant specification is not enabling because one cannot follow the guidance presented therein or within the art at the time of filing, and practice the claimed method without first making a substantial inventive contribution. Given the above discussion of the state-of-the-art and an absence of experimental evidence, an artisan of ordinary skill would not be able to use the full invention as claimed with a reasonable expectation of success. The amount of experimentation required for enabling guidance commensurate in scope with what is claimed goes beyond what is considered “routine” within the art and constitutes undue further experimentation in order to successfully use the full scope of the methods recited by the claims with any reasonable expectation of success.
Claims 28-34 and 39-40 are rejected for those reasons. Claims 29-34, 36-37, and 39-40 are rejected because they depend from Claim 28-34, 36, and/or 39 and don’t remedy the issues.
In conclusion, the specification provides enablement for:
A method for treating:
ischemia or
transthyretin cardiac amyloidosis (ATTR-CA) by clearing transthyretin in a subject,
said method comprising:
administering to the subject a composition comprising a nucleic sequence encoding SEQ ID NO 1 wherein SEQ ID NO 1 comprises a glutamic acid substitution at position 19 (S19E), and/or
administering to the subject a composition comprising sildenafil, and/or
administering to the subject a composition comprising a PDE9 inhibitor selected from the group consisting of PF-04447943 and BI-409306.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 29-30 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
A claim may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173. In the present instance, Claim 29 recites the method of claim 28, wherein increasing or inducing the activity of CHIP comprises administering to the subject a composition comprising a nucleic acid sequence encoding a human CHIP and a pharmaceutically acceptable carrier, wherein the human CHIP comprises at least one phospho-mimetic amino acid substitution at position 19 of SEQ ID NO: 1, whereby the nucleic acid sequence is expressed in subject and the disease is treated. The claim(s) are considered indefinite because there is a question or doubt as to what are the metes and bounds of the claim. The metes and bounds are unclear because it’s not clear it's not clear (1) if SEQ ID NO: 1 is required and (2) how it is possible to have more than one substitution at a particular position (i.e., at least one phosphomimetic AA substitution at position 19).
Claim 29 is rejected for those reasons. Claim 30 is rejected because it depends from Claim 29 and does not remedy the issues. In the interest of compact prosecution, Claim 29 is interpreted as the method requires administering a composition comprising a nucleic acid sequence encoding a human CHIP wherein the nucleic acid sequence encoding a human CHIP comprises SEQ ID NO 1 and wherein there is a phosphomimetic substitution at position 19 of SEQ ID NO 1.
NOTE: If the claim or an amended version of it does not require SEQ ID NO 1, it will be subject to a WD rejection for failing to disclose the structure of the nucleic acid required by the claim. Specifically, the Spec. hasn’t disclosed where the phosphomimetic is required within the broad genus of human CHIP-encoding nucleic acids encompassed by the claim. That will not be considered a new grounds of rejection.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 28 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Campanella (et al. 2018. Heat Shock Proteins in Alzheimer’s Disease: Role and Targeting. Int. J. Mol. Sci. 19:2603, “Campanella”).
Campanella teaches (§1. Introduction ¶1) Alzheimer’s disease [AD] is mainly characterized by the anomalous processing of two proteins, amyloid-peptides (A) and Tau, leading to the pathological formation of extracellular senile plaques and intracellular neurofibrillary tangles (NFTs). Campanella teaches (same §¶) intra-cellular NFT lesion results from the pathological hyperphosphorylation of protein Tau and its subsequent misfolding, aggregation and accumulation within the cytoplasm.
Campanella teaches (§2. Molecular Chaperones and Neurodegenerative Diseases ¶1) heat shock protein 70 (HSP70) plays a major role in controlling protein quality in cells. Campanella teaches (same §, ¶5) it is known that intracellular protein degradation pathways are decreased with aging in many tissue and organs. Campanella teaches (§4. Hsp70-4.1. Biological Role in AD ¶2) evidence indicates that Hsp70 has neuroprotection activity against various intracellular amyloids in Drosophila and mouse models.
Regarding Claim 28: Campanella teaches (§4.2. Targeting and Inhibition ¶4) treating an AD model mouse with sulforaphane increases levels of HSP70 and CHIP, which induces amyloid-β (Aβ) and Tau clearance: Oral treatment of a triple transgenic mouse model of AD (3 × Tg-AD) with sulforaphane increases levels of Hsp70 and C-terminus of Hsp70-interacting protein (CHIP), inducing Aβ and Tau clearance and restoring memory deficits [114].
Therefore Campanella discloses a method of treating a disease caused by proteotoxicity (namely AD) by increasing the activity of CHIP in the mouse subject (i.e., by administering sulforaphane). Therefore Campanella anticipates Claim 28.
Claim(s) 28, 34, 36, and 39-40 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by or, in the alternative, under 35 U.S.C. 103 as obvious over US Patent Application No. 2014/0288152 (published 25 September 2014, “App152”, of record on IDS) as evidenced by John (2018. Arrhythmias in Cardiac Amyloidosis. J. Innov. Cardiac Rhythm Manage. 9[3]:3051, “John”).
App152 teaches (§Abstract) methods of modulating CHIP expression wherein (¶47) modulation includes increasing the expression and (¶108) small activating RNAs (saRNA) can increase CHIP expression. App152 teaches (¶61) increasing CHIP may protect against Alzheimer’s disease and (¶62) their methods/antisense oligont can be used to treat various diseases including various neurological diseases, amyloidosis, protein folding diseases, and myocardial infarction. App152 teaches (¶26) antisense oligont encompasses oligont that up- or downregulate a target.
Since App152 teaches method of increasing CHIP expression using saRNA to treat amyloidosis, App152 anticipates Claims 28 and 39.
John provides evidence that ATTR-CA is a kind of amyloidosis and that cardiac amyloidosis causes cardiac arrhythmia. That evidence also indicates that ATTR-CA is one kind of cardiac disease and that ATTR-CA is one kind of amyloidosis. Therefore the evidence of John indicates that since App152 discloses methods of increasing CHIP expression to treat amyloidosis (of which ATTR-CA is one), the reference encompasses methods of treating ATTR-CA (and, therefore, arrhythmia which is an outcome of ATTR-CA) using their method of increasing CHIP expression. Therefore App152 as evidenced by John anticipates Claims 34, 36, and 40.
Alternatively, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the method of App152 with the teachings of John for the benefit of treating ATTR-CA and arrhythmia. One would have been motivated to do so with a reasonable expectation of success because App152 teaches using their method to treat amyloidosis and John teaches ATTR-CA is a kind of amyloidosis and because John teaches cardiac amyloidosis causes arrhythmia. Therefore the limitations of Claims 34, 36, and 40 would have been obvious in view of App152 and John.
Claim(s) 28, 31-32, and 34 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Ranek (et al. 2014. Protein Kinase G Positively Regulates Proteasome-Mediated Degradation of Misfolded Proteins. Circulation 28:365, “Ranek”, of record on IDS) as evidenced by Ranek (et al. 2020. CHIP phosphorylation by protein kinase G enhances protein quality control and attenuates cardiac ischemic injury. Nat. Comm. 11:5237, “Ranek 2020”, of record on IDS).
Note that the Ranek 2020 reference is merely used to supply evidence that the outcomes recited in the claims would have inevitably flowed from the reference method.
Ranek teaches (§Abstract) activating PKG increases proteasome activities and facilitates degradation of misfolded proteins. Ranek teaches (§Main text ¶1) the majority of failing human hearts with hypertrophic, dilated, or ischemic cardiomyopathy display increases in ubiquitinated proteins and abnormal protein aggregation in the form of, for example, preamyloid oligomer formation… and often decreased proteasome activities. Ranek teaches (§Editorial see p. 325 Clinical Perspective on p 376) increased cGMP production and the resultant activation of cGMP-dependent protein kinase (PKG) has been demonstrated to reverse preexisting hypertrophy. Ranek teaches (same §) their work supports the hypothesis that PKG activation in cardiomyocytes enhances proteasome function and facilitates the degradation of misfolded proteins and suggests stimulating PKG as a therapeutic strategy to treat heart diseases.
Regarding Claims 31-32: Ranek used (§Abstract) the agent sildenafil to activate PKG.
Ranek teaches (§PKG Activation Protects Cardiomyocytes Against Proteotoxic Stress, final ¶) accumulation of misfolded proteins, including preamyloid oligomers in cardiomyocytes is sufficient to cause cardiomyopathy in mice but improving proteasome function slows the progression of cardiac proteinopathy and suggests stimulating PKG to improve protein quality control.
Therefore Ranek teaches a method of treating a cardiac disease caused by proteotoxicity wherein the method step comprises stimulating PKG activity.
Ranek does not teach that stimulating PKG activity increases CHIP activity but Ranek 2020 provides evidence that the outcome of increasing CHIP activity is an inherent outcome of stimulating PKG activity: Ranek teaches (§PKG directly phosphorylates CHIP at Ser20 in cell) PKG directly phosphorylates CHIP at Ser20 in cell and (§PKG activity increases CHIP phosphorylation and protein expression and counters proteotoxicity after myocardial infarction in vivo) PKG activity increases CHIP phosphorylation and protein expression and counters proteotoxicity.
Therefore, Ranek 2020 indicates that using Ranek’s method of stimulating PKG activity would have inevitably produced the outcome of increasing CHIP activity. Since all the limitations of Claims 28, 31-32, and 34 would have occurred in view of Ranek, the reference anticipates Claims 28, 31-32, and 34.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 28-30 and 39 are rejected under 35 U.S.C. 103 as being unpatentable over Campanella (et al. 2018. Heat Shock Proteins in Alzheimer’s Disease: Role and Targeting. Int. J. Mol. Sci. 19:2603, “Campanella”) as applied to claim 28 above, and further in view of Heimdal (et al. 2014. STUB1 mutations in autosomal recessive ataxias–evidence for mutation-specific clinical heterogeneity. Orphanet J. Rare Disease. 9:146, “Heimdal”), Graf (et al. 2010. Insights into the Conformational Dynamics of the E3 Ubiquitin Ligase CHIP in Complex with Chaperones and E2 Enzymes. Biochemistry 49:2121, “Graf”), Ardito (et al. 2017. The crucial role of protein phosphorylation in cell signaling and its use as targeted therapy [Review]. Int .J. Mol. Med. 40:271, “Ardito”), Sieracki (and Komarova. 2013. Studying Cell Signal Transduction with Biomimetic Point Mutations. From Book: Genetic Manipulation of DNA and Protein-Examples from Current Research, D. Figurski, ed. “Sieracki”), and United States Patent Application Publication No. US 2002/0177212 (published 28 November 2002, “App212”).
The teachings of Campanella as applicable to Claim(s) 28 have been described above in the 102 rejection.
As explained, Campanella teaches a method of treating AD in a mouse subject by administering sulforaphane, which increases levels of CHIP which clears Aβ and Tau and restores memory deficits.
Campanella teaches increasing CHIP activity can treat some proteinopathies.
Campanella does not teach increasing CHIP activity by administering a nucleic acid sequence encoding SEQ ID NO 1 (i.e., human CHIP) wherein the human CHIP comprises at least one phosphomimetic AA substitution at SEQ ID NO 1 position 19.
However, Heimdal teaches (§Abstract) CHIP has a role in ubiquitination, (§Background, final ¶) a mutation in its TPR domain causes autosomal recessive cerebellar ataxia, and (§CHIP-N65S demonstrates reduced ubiquitin ligase activity) that mutation reduces its ubiquitin ligase activity.
That indicates that CHIP’s TPR domain is important for its function in clearing misfolded proteins.
Heimdal doesn’t teach what regulates CHIP’s TPR domain.
However, Graf teaches (§Discussion ¶5) the highly solvent exposed N-terminal region of CHIP’s TPR domain seems to be an important recognition site for posttranslational modifications, including a phosphorylation site at Ser19.
Ardito teaches (§Abstract) protein phosphorylation is an important cellular regulatory mechanism and (§1. Introduction ¶1) a phosphorylated amino acid can bind molecules able to interact with other proteins and consequently assemble and detach proteic complexes.
Graf and Ardito indicate it was known in the art that phosphorylation is a known way that cells regulate protein activity and that specifically CHIP’s S19 position was of known importance.
Sieracki teaches (2.2 Post-translational modification offers fast and dynamic response to stimulus, entire §) post-translational modification including phosphorylation induces conformational changes that cause a downstream effect. Sieracki teaches (§2.3 Natural amino acids as substitutes for modified amino acids, entire §) glutamic acid (E) exhibits remarkable structural and functional similarity to the phosphorylated form of serine (S). Sieracki teaches (same §) it is possible to use a point mutation S[Wingdings font/0xE0]E to induce a conformational change and study if that recapitulates function of a phosphorylated S.
That indicates it is routine and convention in the art of structural biology and signal transduction to mutate S[Wingdings font/0xE0]E to mimic phosphorylation.
App212, teaches (Fig. 1, ¶12-14, ¶20-21, ¶28-29, ¶40) a nucleic acid sequence that encodes the AA sequence of CHIP. That figure is shown here:
PNG
media_image1.png
225
699
media_image1.png
Greyscale
PNG
media_image1.png
225
699
media_image1.png
Greyscale
The following alignment shows that sequence encodes a sequence that comprises 100% identity to clamed SEQ ID NO 1:
RESULT 1
US-10-013-939-1
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
Sequence 1, US/10013939
Publication No. US20020177212A1
GENERAL INFORMATION
APPLICANT: Patterson, Winston C.
APPLICANT: Ballinger, Carol A.
TITLE OF INVENTION: Polypeptide That Interacts With Heat Shock Proteins
FILE REFERENCE: 265.00010120
CURRENT APPLICATION NUMBER: US/10/013,939
CURRENT FILING DATE: 2002-06-07
PRIOR APPLICATION NUMBER: 60/134,433
PRIOR FILING DATE: 1999-05-17
PRIOR APPLICATION NUMBER: 09/573,473
PRIOR FILING DATE: 2000-05-17
NUMBER OF SEQ ID NOS: 20
SEQ ID NO 1
LENGTH: 1286
TYPE: DNA
ORGANISM: Homo sapiens
Alignment Scores:
Length: 1286
Score: 1590.00 Matches: 303
Percent Similarity: 100.0% Conservative: 0
Best Local Similarity: 100.0% Mismatches: 0
Query Match: 100.0% Indels: 0
Gaps: 0
US-18-027-671A-1 (1-303) x US-10-013-939-1 (1-1286)
Qy 1 MetLysGlyLysGluGluLysGluGlyGlyAlaArgLeuGlyAlaGlyGlyGlySerPro 20 SEQ ID NO 1
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 97 ATGAAGGGCAAGGAGGAGAAGGAGGGCGGCGCACGGCTGGGCGCTGGCGGCGGAAGCCCC 156 App212 SEQ #1
Qy 21 GluLysSerProSerAlaGlnGluLeuLysGluGlnGlyAsnArgLeuPheValGlyArg 40
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 157 GAGAAGAGCCCGAGCGCGCAGGAGCTCAAGGAGCAGGGCAATCGTCTGTTCGTGGGCCGA 216
Qy 41 LysTyrProGluAlaAlaAlaCysTyrGlyArgValIleThrArgAsnProLeuValAla 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 217 AAGTACCCGGAGGCGGCGGCCTGCTACGGCCGCGTGATCACCCGGAACCCGCTGGTGGCC 276
Qy 61 ValTyrTyrThrAsnArgAlaLeuCysTyrLeuLysMetGlnGlnHisGluGlnAlaLeu 80
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 277 GTGTATTACACCAACCGGGCCTTGTGCTACCTGAAGATGCAGCAGCACGAGCAGGCCCTG 336
Qy 81 AlaAspCysArgArgAlaLeuGluLeuAspGlyGlnSerValLysAlaHisPhePheLeu 100
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 337 GCCGACTGCCGGCGCGCCCTGGAGCTGGACGGGCAGTCTGTGAAGGCGCACTTCTTCCTG 396
Qy 101 GlyGlnCysGlnLeuGluMetGluSerTyrAspGluAlaIleAlaAsnLeuGlnArgAla 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 397 GGGCAGTGCCAGCTGGAGATGGAGAGCTATGATGAGGCCATCGCCAATCTGCAGCGAGCT 456
Qy 121 TyrSerLeuAlaLysGluGlnArgLeuAsnPheGlyAspAspIleProSerAlaLeuArg 140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 457 TACAGCCTGGCCAAGGAGCAGCGGCTGAACTTCGGGGACGACATCCCCAGCGCTCTTCGA 516
Qy 141 IleAlaLysLysLysArgTrpAsnSerIleGluGluArgArgIleHisGlnGluSerGlu 160
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 517 ATCGCGAAGAAGAAGCGCTGGAACAGCATTGAGGAGCGGCGCATCCACCAGGAGAGCGAG 576
Qy 161 LeuHisSerTyrLeuSerArgLeuIleAlaAlaGluArgGluArgGluLeuGluGluCys 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 577 CTGCACTCCTACCTCTCCAGGCTCATTGCCGCGGAGCGTGAGAGGGAGCTGGAAGAGTGC 636
Qy 181 GlnArgAsnHisGluGlyAspGluAspAspSerHisValArgAlaGlnGlnAlaCysIle 200
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 637 CAGCGAAACCACGAGGGTGATGAGGACGACAGCCACGTCCGGGCCCAGCAGGCCTGCATT 696
Qy 201 GluAlaLysHisAspLysTyrMetAlaAspMetAspGluLeuPheSerGlnValAspGlu 220
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 697 GAGGCCAAGCACGACAAGTACATGGCGGACATGGACGAGCTTTTTTCTCAGGTGGATGAG 756
Qy 221 LysArgLysLysArgAspIleProAspTyrLeuCysGlyLysIleSerPheGluLeuMet 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 757 AAGAGGAAGAAGCGAGACATCCCCGACTACCTGTGTGGCAAGATCAGCTTTGAGCTGATG 816
Qy 241 ArgGluProCysIleThrProSerGlyIleThrTyrAspArgLysAspIleGluGluHis 260
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 817 CGGGAGCCGTGCATCACGCCCAGTGGCATCACCTACGACCGCAAGGACATCGAGGAGCAC 876
Qy 261 LeuGlnArgValGlyHisPheAspProValThrArgSerProLeuThrGlnGluGlnLeu 280
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 877 CTGCAGCGTGTGGGTCATTTTGACCCCGTGACCCGGAGCCCCCTGACCCAGGAACAGCTC 936
Qy 281 IleProAsnLeuAlaMetLysGluValIleAspAlaPheIleSerGluAsnGlyTrpVal 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 937 ATCCCCAACTTGGCTATGAAGGAGGTTATTGACGCATTCATCTCTGAGAATGGCTGGGTG 996
Qy 301 GluAspTyr 303
|||||||||
Db 997 GAGGACTAC 1005
That indicates that the sequence encoding CHIP and its AA sequence were known in the art.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the method of increasing CHIP activity in a cell of Campanella with the Heimdal’s teachings about the importance of the TPR domain for CHIP function, Graf’s teaching that CHIP has an important phosphorylation site at Ser19, Ardito’s teachings about the general importance of phosphorylation for protein regulation, Sieracki’s teachings about using S[Wingdings font/0xE0]E as a phosphomimetic to study protein function, and App212’s teachings about the nucleic acid sequence encoding CHIP for the benefit of producing a nucleic acid encoding an activated form of CHIP.
One would have been motivated to do so with a reasonable expectation of success because Campanella teaches administering sulforaphane increases levels of CHIP which clears Aβ and Tau and restores memory deficits and Heimdal teaches defective CHIP causes ARCA so an artisan would have been looking for other ways to increase CHIP activity or replace CHIP in cells and patients. Teachings in the art indicate an artisan would have had all the tools necessary to do so: Ardito and Sieracki teach phosphorylation was known to affect protein function, including turning a protein to its “active” state. Sieracki teaches it was routine and conventional to point mutate an S[Wingdings font/0xE0]E mutation to mimic phosphorylation. Heimdal and Graf teach CHIP’s TPR domain was known to be important and Graf teaches the TPR domain was known to contain only two phosphorylation sites, Ser19 and one other. Then, App212 teaches both the AA sequence of CHIP and a nucleic acid sequence encoding CHIP. An artisan would have found it obvious to try inducing a point mutation at Ser19 for the benefit of testing whether an S[Wingdings font/0xE0]E mutation would produce an active form of CHIP that would function to clear Aβ and Tau. In doing so, they would have produced a nucleic acid sequence encoding human CHIP (i.e., App212) wherein the CHIP comprises an S[Wingdings font/0xE0]E substitution. In so doing, they would have produced the claimed invention.
Obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). The motivation to combine falls under an “obvious to try” rationale; see MPEP 2143(I)(E):
To reject a claim based on this rationale, Office personnel must resolve the Graham factual inquiries. Then, Office personnel must articulate the following:
(1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem;
(2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem;
(3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success; and
(4) whatever additional findings based on the Graham factual inquiries may be necessary, in view of the facts of the case under consideration, to explain a conclusion of obviousness.
The rationale to support a conclusion that the claim would have been obvious is that "a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely that product [was] not of innovation but of ordinary skill and common sense.
Regarding (1): Campanella teaches administering sulforaphane increases levels of CHIP which clears Aβ and Tau and restores memory deficits and Heimdal teaches defective CHIP causes ARCA so an artisan would have been looking for other ways to increase CHIP activity or replace CHIP in cells and patients.
Regarding (2): Heimdal and Graf teach CHIP’s TPR domain was known to be important and Graf teaches the TPR domain was known to contain only two phosphorylation sites, Ser19 and one other.
Regarding (3): Sieracki teaches it was routine and conventional to point mutate an S[Wingdings font/0xE0]E mutation to mimic phosphorylation.
Therefore, the limitations of Claims 28-30 and 39 would have been obvious in view of Campanella, Heimdal, Graf, Ardito, Sieracki, and App212.
Claim(s) 28, 34, 36-37, and 40 are rejected under 35 U.S.C. 103 as being unpatentable over Campanella (et al. 2018. Heat Shock Proteins in Alzheimer’s Disease: Role and Targeting. Int. J. Mol. Sci. 19:2603, “Campanella”) as applied to claim 28 above, and further in view of Pattison (et al. 2008. Cardiomyocyte Expression of a Polyglutamine Preamyloid Oligomer Causes Heart Failure. Circulation 117:2743, “Pattison”) and John (2018. Arrhythmias in Cardiac Amyloidosis. J. Innov. Cardiac Rhythm Manage. 9[3]:3051, “John”).
The teachings of Campanella as applicable to Claim(s) 28 have been described above in the 102 rejection.
As explained, Campanella teaches a method of treating AD in a mouse subject by administering sulforaphane, which increases levels of CHIP which clears Aβ and Tau and restores memory deficits.
Campanella does not teach increasing CHIP activity to treat a cardiac proteotoxicity (Claim 34) or amyloid accumulation in the myocardium (Claim 36) or the specific disease ATTR-CA (Claim 37). Campanella does not teach increasing CHIP activity to treat cardiac arrhythmia (Claim 40).
Regarding Claims 34 and 36: However, Pattison teaches that (§Main text ¶1) amyloidosis in the heart has been characterized. Pattison teaches (§Main text ¶1) amyloid accumulation, including cytoplasmic, soluble oligomeric forms of amyloidogenic proteins or preamyloid oligomers (PAOs) cause heart disease: (§Main text ¶1) a number of inherited forms of systemic amyloidoses, such as those associated with mutations in the serum protein transthyretin, can have diverse effects on heart function and result in dilated or restrictive cardiomyopathy or diastolic dysfunction. Pattison teaches (same § and ¶) PAOs are the primary cytotoxic entities in several amyloidogenic diseases. Pattison teaches (§Clinical Perspective p. 2751) PAOs accumulate as intracellular, soluble amyloid precursors. Pattison teaches (§Clinical Perspective) PAOs are found in cardiomyocytes from the failing human myocardium. Pattison teaches (§Abstract-Conclusions) their data confirm their hypothesis that expression of an exogenous PAO-forming peptide is toxic to cardiomyocytes and is sufficient to cause cardiomyocyte loss and heart failure in mice.
Altogether, Pattison teaches that amyloidosis, including that associated with transthyretin, causes heart disease.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify Campanella’s method of treating AD (which increases levels of CHIP which clears Aβ and Tau) with Pattison’s teachings about amyloidosis causing heart failure for the benefit of using Campanella’s method to treat amyloidosis in the heart. One would have been motivated to do so with a reasonable expectation of success because Campanella teaches their method clears Aβ and tau from cells and it would have been obvious to try using Campanella’s method to clear any amyloidosis, including that described by Pattison.
Therefore the limitations of Claims 34 and 36 would have been obvious in view of Campanella and Pattison.
As discussed above, Pattison teaches (§Main text ¶1) there is an inherited forms amyloidosis that is associated with mutations in the serum protein transthyretin and that cytosolic PAOs are thought responsible for the disease.
Regarding Claims 37 and 40: John teaches (§Introduction ¶2) mutant TTR (ATTRm) causes familial amyloidosis, wherein patients are generally born with a pathological mutation in the TTR gene that results in accelerated breakdown of TTR to amyloid. John teaches (Table 1 title and content) cardiac arrhythmia (CA) is caused by each variety of amyloidosis.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the method of treating cardiac amyloidosis of Campanella and Pattison by using it, based on the teachings of John, to treat ATTR-CA and resultant cardiac arrhythmia, for the benefit of clearing amyloid deposits in the heart and reducing heart failure. One would have been motivated to do so with a reasonable expectation of success because Campanella teaches their method clears amyloid, Pattison teaches amyloidosis (including familial amyloidosis caused by mutant transthyretin) and PAOs cause heart disease, and John teaches any form of cardiac amyloidosis causes cardiac arrhythmias, and it would have been obvious to an artisan to try using Campanella’s method to treat cardiac amyloidosis and/or cardiac arrhythmia.
Therefore the limitations of Claims 37 and 40 (and 34) would have been obvious in view of Campanella, Pattison, and John.
Claim(s) 28 and 31-34 are rejected under 35 U.S.C. 103 as being unpatentable over Ranek (et al. 2014. Protein Kinase G Positively Regulates Proteasome-Mediated Degradation of Misfolded Proteins. Circulation 28:365, “Ranek”, of record on IDS) as evidenced by Ranek (et al. 2020. CHIP phosphorylation by protein kinase G enhances protein quality control and attenuates cardiac ischemic injury. Nat. Comm. 11:5237, “Ranek 2020”, of record on IDS) as applied to Claims 28, 31-32, and 34 in the 102 rejection above, and further in view of McMurray (and Docherty. 2019. Phosphodiesterase-9 Inhibition in Heart Failure A Further Opportunity to Augment the Effects of Natriuretic Peptides? J. A. Coll. Cardiol. 74[7], “McMurray”).
Note that the Ranek 2020 reference is merely used to supply evidence that the outcomes recited in the claims would have inevitably flowed from the reference method.
The teachings of Ranek as applicable to Claim(s) 28, 31-32, and 34 have been described above in the 102 rejection.
Ranek teaches a method of increasing PKG activity by administering an agent that stimulates PKG activity. As explained, Ranek 2020 provides evidence that using that method to treat a cardiac proteinopathy would have produced the outcome of increasing CHIP activity.
As discussed above, Ranek teaches (§Main text ¶1) the majority of failing human hearts with hypertrophic, dilated, or ischemic cardiomyopathy display increases in ubiquitinated proteins and abnormal protein aggregation in the form of, for example, preamyloid oligomer formation… and often decreased proteasome activities. That indicates that abnormal protein aggregation, including preamyloid oligomer formation, occurs in heart failure and other heart issues. Ranek also teaches (§Editorial see p. 325 Clinical Perspective on p 376) increased cGMP production increases PKG activation.
Ranek does not teach using a PDE9 inhibitor to increase PKG/cGMP activity and treat a cardiac proteinopathy (Claim 33).
Regarding Claim 33: However, McMurray teaches using PDE9 inhibitor to treat heart failure. McMurray teaches (§Main text ¶3):
Inhibition of PDE9 activity, increasing transduction of the NP/cGMP pathway, may therefore represent a novel therapeutic target to maximize the beneficial natriuretic, diuretic, arterial and venous vasodilatory, and antifibrotic/apoptotic effects of NP in HF. In murine models of cardiac hypertrophy, genetic or pharmacological PDE9 inhibition has been demonstrated to increase intracellular cGMP levels and reverse cardiac hypertrophy and dysfunction independent of NO activity, confirming that this benefit is mediated via the NP/cGMP pathway.
That indicates inhibiting PDE9 activity is known to activate the cGMP pathway (and, therefore, PKG).
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the methods for treating cardiac proteinopathy of Ranek with the PDE9 inhibitor of McMurray for the benefit of using PDE9 inhibitors to treat a cardiac proteinopathy. One would have been motivated to do so with a reasonable expectation of success because McMurray teaches (§Main text ¶3) PDE9 has the greatest affinity for cGMP of all the PDEs so an artisan would have understood inhibiting PDE9 would have activated cGMP. Therefore the limitations of Claim 33 would have been obvious in view of Ranek and McMurray.
Conclusion
No claim is allowed.
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Otto (et al. 2002. IMAGES IN CARDIOLOGY: Intracellular cardiac amyloidosis in familiar amyloid polyneuropathy of the Portuguese type. Heart 88:90). Otto describes an instance of intracellular cardiac amyloidosis.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUTHIE S ARIETI whose telephone number is (571)272-1293. The examiner can normally be reached M-Th 8:30AM-4PM, alternate Fridays 8:30AM-4PM (ET).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
RUTHIE S ARIETI
Examiner
Art Unit 1635
/RUTH SOPHIA ARIETI/Examiner, Art Unit 1635
/NANCY J LEITH/Primary Examiner, Art Unit 1636
Prosecution Insights