Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant's election with traverse of the Group I (claims 1-23 and 29-33) in the reply filed on 12/29/2025 is acknowledged. Election of the species “a single combination of sequences on which claim 3 is readable” in the reply filed on 12/29/2025 is acknowledged. This is interpreted as election of the following sequences as are recited in claim 3: 5’-A-3’; Seq ID NO: 10, Seq ID NO: 11; Seq ID NO: 110 and 5'-AUGCAAC-3'.
The traversal is on the grounds that the prior art does not disclose or suggest engineering the guide RNA scaffold by the claimed structural modifications (including deletions within defined stem-loop regions) to
obtain an optimized scaffold that improves gene-editing efficiency.
This is not found persuasive because the gRNA for a CRISPR/Cas12f1 as recited by the claim 1 is known in the prior art and thus is not deemed a special technical feature.
Regarding claim 1: The claims are drawn to an engineered guide RNA comprising 1) an engineered scaffold; and 2) a spacer region linked in a 5’ to 3’ direction. The spacer comprises 10-50 nucleotides and is complementary to a target sequence.
The engineered scaffold of claim 1 requires the following sequences fused in the 5’ to 3’ direction, which can have any number of intervening sequences: of 5’-A-3’, Seq
The engineered scaffold of claim 1 requires the following elected sequences linked in 5’ to 3’: 5’-A-3’; Seq ID NO: 10 or 11; Seq ID NO: 110 or 5'-AUGCAAC-3'.
Claim 1 excludes a scaffold with a sequence identical to Seq ID No: 7. Claim 2 excludes a scaffold with a sequence identical to Seq ID NO: 315.
Turning to the art, Karvelis et al (Nucleic Acids Research (2020) 48:9;5016-5023; pub 4/4/2020; cited in the IDS filed 4/6/2023) teach a recently identified CRISPR-Cas system, Cas12f nucleases (previously identified as Cas14), which are nucleases that recognize and cleave dsDNA in a PAM dependent manner (abstract). Cas12f (also known as Cas14a) has been recently identified by sequence analysis of databases and are about half the size of the smallest Cas9 or Cas12 nucleases (p5016 ¶2/3; Fig 1). Karvelis teach Cas12f effectors are programmable dsDNA nucleases and could be adopted as genome editing tools (p5014 col1 ¶1).
Karvelis teach gRNAs that effectively target CRISPR-Cas12f for cleavage of dsDNA (p5017 ¶4). Karvelis teach a gRNA spacer of around 20 nt supported the most robust dsDNA cleavage, however teach gRNA spacer lengths of 15-40 bp (p5021 ¶1; Sup Data 1). This reads on the instant claim 1 “the spacer comprises 10 nucleotides to 50 nucleotides”.
Karvelis teach the Cas12f1 cleaves dsDNA andn is PAM-dependent (Fig 3a). Therefore the spacer of the gRNA taught by Karvelis has sequence complementary to a target sequence because the Cas would not cleave DNA specifically without said complementary sequence (Fig 3a).
Karvelis teach the sequence of the gRNA with a 20 nt spacer which reads on the gRNA of claim 1. Supplementary Data S1 teaches the gRNA sequence (gRNA 20nt figures s12, s14):
GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACAGUUGACCCAACGUCGCCGG
As required by the instant claims, the gRNA taught by Karvelis comprises 5’-A-3’, Seq ID NO: 10 and 5'-AUGCAAC-3' linked in a 5’ to 3’ direction (sequences in bold/underline above) and a 20 bp spacer (target) (Sub Data S1).
Regarding spacer length: MPEP reads “"[W]hen, as by a recitation of ranges or otherwise, a claim covers several compositions, the claim is ‘anticipated' if one of them is in the prior art." Titanium Metals Corp. v. Banner, 778 F.2d 775, 227 USPQ 773 (Fed. Cir. 1985)”
MPEP 2131.03 reads “When the prior art discloses a range which touches or overlaps the claimed range, but no specific examples falling within the claimed range are disclosed, a case by case determination must be made as to anticipation. In order to anticipate the claims, the claimed subject matter must be disclosed in the reference with ‘sufficient specificity to constitute an anticipation under the statute.' ”
MPEP 2131.03 further reads “If the prior art disclosure does not disclose a claimed range with "sufficient specificity" to anticipate a claimed invention, any evidence of unexpected results within the narrow range may render the claims nonobvious. See MPEP § 716.02 et seq.”.
In the case of the instant claim, the range disclosed by the prior art clearly overlaps with the claimed range. In the in the absence of new or unexpected results for values outside the claimed range, the range disclosed by the cited art is considered to disclose the claimed range with “sufficient specificity” to anticipate the claimed range.
The requirement is still deemed proper and is therefore made FINAL.
Claims Status
Claims 4-13, 18, 21, and 23-30, 32 have been withdrawn from consideration as being drawn to non-elected subject matter, and claims 1-3, 14-17, 19-20, 22, 31 and 33 have been considered on the merits.
Priority
Applicant' s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows: The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994). The disclosure of the prior-filed applications, KR10-2020-0129937, KR10-2020-0185528, and KR10-2021-0051552 filed 10/08/2020, 12/29/2020, 04/21/2021 fail to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application. Complete English translations for KR10-2020-0129937, KR10-2020-0185528 and KR10-2021-0051552 are absent.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-3, 14-17, 19-20, 22, 31 and 33 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claims are drawn to an engineered guide RNA. For brevity Claim 1 is analyzed to exemplify lack of written description, however the analysis is relevant to the cited claims.
Regarding claim 1: The claim is drawn to an engineered guide RNA (gRNA) comprising 1) an engineered scaffold; and 2) a spacer region linked in a 5’ to 3’ direction. The scaffold comprises the following elected sequences linked in 5’ to 3’: 5’-A-3’; Seq ID NO: 10 or 11; Seq ID NO: 110 or 5'-AUGCAAC-3'. The spacer comprises 10-50 nucleotides and is complementary to a target sequence.
The claim language “linked in a 5’ to 3’ direction” dictates the order of sequences for the gRNA, but does not exclude intervening sequences between the claimed sequences. Thus the broadest reasonable interpretation of the claim limitations encompasses the required nucleotide sequences with any number of intervening nucleotides. Thus the claim is drawn to a broad genus of gRNA comprising the required sequences linked in a 5’ to 3’ direction with any number of intervening nucleotides between the required sequences.
Teachings of the instant specification
The instant specification teaches some species of the claimed genus of gRNA.
The instant specification teaches specific sequences of the gRNA “a sequence of the vector may comprise a sequence selected from the group consisting of SEQ ID NOS: 210 to 258, SEQ ID NOS: 381 to 393, SEQ ID NOS: 395 to 407, SEQ ID NOS: 409 to 421, and SEQ ID NOS: 436 to 439” (p117 ¶2). Tables 03-08 also show examples of species of the claimed gRNA genus (p163-165).
The state of the art:
It is well known in the art that the effect of nucleic acid substitutions on polynucleotide activity is not predictable for Cas guide sequences. Guide sequence specificity and on-target editing is an important aspect to designing a CRISPR-Cas system, and the art teaches that small changes in the Cas guide sequences can have a large effect on the function of the guide sequence.
Tycko et all (Mol Cell(2016)63:3;1-31) review methods for optimizing CRISPR-Cas9 editing specificity (title). Tycko teach Cas9 localizes and cleaves the target DNA via a guide RNA, however in the context of large eukaryotic genomes, Cas9 is known to bind and cleave at off-target sites (p1/2 para1/1).
Tycko disclose guide sequence length ranges from 17-20 nucleotides, and while shorter sequences can mediate more precise genome editing, short sequences can also create new off-target sites due to their shorter length (p11 para3). Tycko also teach a guide sequence shorter than 16 nucleotides can generate a ‘dead guide' that mediates efficient Cas binding without nuclease activation (p11 para4). Thus the effect of changing guide sequence length is unpredictable and must be tested on a trial-and-error basis.
Tycko teach the addition of mismatched guanine nucleotides to the 5' end of the guide RNA (GGX20) can increase the specificity of the guide by 10-100 fold, however the effect of this modification on specificity is unpredictable and can also cause no change in specificity or severely reduce specificity (p12 para2). Tycko further disclose ‘GGX20' and truncated guides should be compared with standard-length guides on a case-by-case basis (p12 para2). Tycko disclose a change of only 2 nucleotides (representing a 10% change in identity for a standard 20nt guide) can improve specificity or severely reduce specificity. Thus trial-and error experimentation is required when implementing nucleotide sequence changes to guide sequences.
This demonstrates that, while gRNAs are known in the art, the effect of changes to guide sequences is highly specific to the guide sequence and residues in question and the effects of such changes are unpredictable.
This supports the effect introducing intervening nucleotide sequences interspersed between the claimed gRNA components must be experimentally tested using trial and error experimentation.
While Cas guide sequence variants are known in the art, the species examples provided in the art are not of a large enough breadth to impart predictability on the genus as claimed.
Conclusion
As described supra, the instant specification discloses sequences for gRNAs that represent species of the claimed gRNA genus.
However the species of guide nucleic acid variants disclosed in the instant specification are not sufficient to predict the genus of guide variants; broad genus of gRNA comprising the required sequences linked in a 5’ to 3’ direction with any number of intervening nucleotides between the required sequences, in view of the unpredictability of nucleic acid substitutions as evidenced by the art.
Furthermore, the instant specification provides no guidance as how to avoid losing key structural or binding components of Cas guides with nucleic insertions between the claimed gRNA sequences and the art does not provide a remedy.
One of ordinary skill in the art would understand that Cas guide RNA function requires binding to nucleic acid sequences (e.g. genomic DNA) and amino acid sequences (e.g. a Cas protein) for a functional system. One of ordinary skill in the art would also understand that the effect of nucleic acid insertions in the Cas guide sequence can have unpredictable effects on the encoded gRNA structure and thus binding activity. For example, Tycko teach changes in the guide sequences can have unpredictable effects on guide activity; a short guide can be more efficient, but can also be “dead” or can generate off-target effects.
This demonstrates that, while Cas guide variants are known in the art, the effect of changes to Cas guide sequences must be tested empirically. To determine how an inserted sequence affects guide function.
MPEP states “[a] specification may call for a reasonable amount of experimentation to make and use a patented invention. What is reasonable in any case will depend on the nature of the invention and the underlying art”.
In the case of the instant claims, trial and error and/or laborious screening methods are required to identify Cas guide variants as claimed and the species examples provided in the instant specification not of a large enough breadth to impart predictability on the genus as claimed.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 14 is indefinite because the claim recites “wherein one in which the sequence of the engineered tracrRNA is the same as… (Seq ID NO: 1)”. For purposes of compact prosecution this is interpreted as “wherein the sequence of the engineered tracerRNA is the same as… (Seq ID NO:1)”. If the claim were amended to recite “wherein
Claim 14 is also indefinite because the claim recites “and the engineered crRNA repeat sequence is the same as 5'-GAAUGAAGGAAUGCAAC-3' (SEQ ID NO: 3) is excluded”. The claim appears to both require and exclude 5'-GAAUGAAGGAAUGCAAC-3' thus the metes and bounds of the claim are unclear.
For purposes of compact prosecution this is considered a typing mistake and the claim is interpreted as “and the engineered crRNA repeat sequence is the same as 5'-GAAUGAAGGAAUGCAAC-3' (SEQ ID NO: 3)”. If the claim were amended to recite “and the engineered crRNA repeat sequence is the same as 5'-GAAUGAAGGAAUGCAAC-3' (SEQ ID NO: 3)
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-2 and 14-15 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Karvelis et al (Nucleic Acids Research (2020) 48:9;5016-5023; pub 4/4/2020; cited in the IDS filed 4/6/2023).
Regarding claims 1-2: The claims are drawn to an engineered guide RNA comprising 1) an engineered scaffold; and 2) a spacer region linked in a 5’ to 3’ direction. The spacer comprises 10-50 nucleotides and is complementary to a target sequence.
The engineered scaffold of claim 1 requires the following sequences fused in the 5’ to 3’ direction, which can have any number of intervening sequences: of 5’-A-3’, Seq
The engineered scaffold of claim 1 requires the following elected sequences linked in 5’ to 3’: 5’-A-3’; Seq ID NO: 10 or 11; Seq ID NO: 110 or 5'-AUGCAAC-3'.
Claim 1 excludes a scaffold with a sequence identical to Seq ID No: 7. Claim 2 excludes a scaffold with a sequence identical to Seq ID NO: 315.
Turning to the art, Karvelis teach a recently identified CRISPR-Cas system, Cas12f nucleases (previously identified as Cas14), which are nucleases that recognize and cleave dsDNA in a PAM dependent manner (abstract). Cas12f (also known as Cas14a) has been recently identified by sequence analysis of databases and are about half the size of the smallest Cas9 or Cas12 nucleases (p5016 ¶2/3; Fig 1). Karvelis teach Cas12f effectors are programmable dsDNA nucleases and could be adopted as genome editing tools (p5014 col1 ¶1).
Karvelis teach gRNAs that effectively target CRISPR-Cas12f for cleavage of dsDNA (p5017 ¶4). Karvelis teach a gRNA spacer of around 20 nt supported the most robust dsDNA cleavage, however teach gRNA spacer lengths of 15-40 bp (p5021 ¶1; Sup Data 1). This reads on the instant claim 1 “the spacer comprises 10 nucleotides to 50 nucleotides”.
Karvelis teach the Cas12f1 cleaves dsDNA andn is PAM-dependent (Fig 3a). Therefore the spacer of the gRNA taught by Karvelis has sequence complementary to a target sequence because the Cas would not cleave DNA specifically without said complementary sequence (Fig 3a).
Karvelis teach the sequence of the gRNA with a 20 nt spacer which reads on the gRNA of claim 1. Supplementary Data S1 teaches the gRNA sequence (gRNA 20nt figures s12, s14):
GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACAGUUGACCCAACGUCGCCGG
As required by the instant claims, the gRNA taught by Karvelis comprises 5’-A-3’, Seq ID NO: 10 and 5'-AUGCAAC-3' linked in a 5’ to 3’ direction (sequences in bold/underline above) and a 20 bp spacer (target) (Sub Data S1).
Regarding spacer length: MPEP reads “"[W]hen, as by a recitation of ranges or otherwise, a claim covers several compositions, the claim is ‘anticipated' if one of them is in the prior art." Titanium Metals Corp. v. Banner, 778 F.2d 775, 227 USPQ 773 (Fed. Cir. 1985)”
MPEP 2131.03 reads “When the prior art discloses a range which touches or overlaps the claimed range, but no specific examples falling within the claimed range are disclosed, a case by case determination must be made as to anticipation. In order to anticipate the claims, the claimed subject matter must be disclosed in the reference with ‘sufficient specificity to constitute an anticipation under the statute.' ”
MPEP 2131.03 further reads “If the prior art disclosure does not disclose a claimed range with "sufficient specificity" to anticipate a claimed invention, any evidence of unexpected results within the narrow range may render the claims nonobvious. See MPEP § 716.02 et seq.”.
In the case of the instant claim, the range disclosed by the prior art clearly overlaps with the claimed range. In the in the absence of new or unexpected results for values outside the claimed range, the range disclosed by the cited art is considered to disclose the claimed range with “sufficient specificity” to anticipate the claimed range.
Regarding claim 14: The claim requires a tracrRNA. The instant specification teaches the scaffold region may be subdivided into 6 regions, of which the tracrRNA regions 1-4 and the crRNA comprises regions 5-6. The requirement of “a tracrRNA” is considered to be met if the gRNA comprises a scaffold, because the instant specification teaches the tracrRNA is part of the scaffold.
The instant specification teaches the scaffold region is a region comprising a tracrRNA and a portion of a crRNA (p30 ¶1). The instant specification also teaches a crRNA may be divided into a crRNA repeat and a spacer (p29/20 ¶4/1).
The claim requires a spacer length 10 to 50 nt, a sequence complementary to a target sequence, and a sequence of the scaffold comprising in the 5’ to 3’ direction: : 5’-A-3’; Seq ID NO: 10 or 11; 5'-AUGCAAC-3'
The claim also requires the tracrRNA to be the same as Seq ID NO: 1 and the crRNA sequence is the same as Seq ID NO:3 of the instant disclosure.
The gRNA taught by Karvelis comprises the required sequences in the 5’ to 3’ order; 5’-A-3’, Seq ID NO: 10 and 5'-AUGCAAC-3' linked in a 5’ to 3’ direction, as discussed supra for claim 1. The sequence of the 20 nt gRNA taught by Karvelis comprises the sequences of Seq ID NO: 1 and Seq ID NO: 3 as shown below with the sequences of Seq ID NO: 1 and Seq ID NO:3, respectively, in bold/underline:
GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACAGUUGACCCAACGUCGCCGG
Regarding claim 15: Karvelis teach purification of the nuclease and gRNA for Un1Cas12f1 (Cas14a1) (p5022 col2 ¶2). This reads on a Cas12f1 protein as required by the claim.
Karvelas teach the engineered gRNA used with Un1Cas12f1 comprised a 20nt spacer (Fig 3). This reads on a CRISPR/Cas12f1 complex as required by the claim.
The sequence of Karvelis for gRNA with a 20nt spacer is below (Sup Data S1) with the required sequences linked in a 5’ to 3’ sequence and shown in bold/underline (5’-A-3’, Seq ID NO: 10 and 5'-AUGCAAC-3'):
GGGCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUUUCCUCUCCAAUUCUGCACAAGAAAGUUGCAGAACCCGAAUAGACGAAUGAAGGAAUGCAACAGUUGACCCAACGUCGCCGG
Therefore the disclosure of Karvelis anticipates the invention as claimed.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 19, 22, 31 and 33 are rejected under 35 U.S.C. 103 as being unpatentable over Karvelis et al (Nucleic Acids Research (2020) 48:9;5016-5023; cited in the IDS filed 4/6/2023) as applied to claims 1-2 and 14-15 above, and further in view of Liu et al (J Control Release (2017) 266;1-26) and as evidenced by Addgene (plasmid #112500 [online]. AddGene [retrieved on 5/22/2026]. Retrieved from the Internet: <https://www.addgene.org/112500/).
Claims 1-2 and 14-15 are anticipated by Karvelis, thus they are also rendered obvious (see above).
Regarding claims 19, 22, 31 and 33: The teachings of Karvelis are discussed supra. Karvelis also teach a vector comprising a nucleic acid sequence encoding a Cas12f1 protein and a first promoter operably linked to the Cas12f1 protein; Un1Cas12f1 (Cas14a1) was expressed in E. coli from the pLBH531_MBP-Cas14a1 plasmid; Addgene plasmid #112500 (p5018 col2 ¶2). As evidenced by Addgene plasmid #112500, the Cas protein is operably linked with the T7 promoter.
While Karvelis teach the gRNA is was produced by in vitro transcription, Karvelis do not teach the vector comprises a second sequence comprising a nucleic acid sequence encoding an engineered guide RNA comprising the required sequences linked in a 5’ to 3’ order (5’-A-3’, Seq ID NO: 10 and 5'-AUGCAAC-3').
Liu teach delivery strategies of the CRISPR-Cas9 gene-editing system (title). Liu teach the first and most straight forward approach to genome editing using the CRISPR-Cas system is to use a plasmid-based system which encodes the Cas protein and the gRNA from the same vector, thus avoiding multiple transfections of different components (p4 ¶4).
It would have been obvious to one of ordinary skill in the art to adapt the gRNA and CRISPR/Cas editing system of Karvelis by incorporating DNA sequences encoding the Cas12f1 protein and the gRNA operably linked to promoters in a plasmid vector as taught by Liu.
One of ordinary skill in the art would have been motivated to modify CRISPR/Cas editing system as taught by Karvelis by incorporating DNA sequences encoding the Cas12f1 protein and the gRNA operably linked to promoters in a plasmid vector because Liu teach using a plasmid-based system to deliver the CRISPR-Cas system from the same vector is the most straight forward approach and the first approach developed, thus the system is well known.
One would have had a reasonable expectation of success because Liu teach delivery of a CRISPR/Cas system using a plasmid-based system is the first approach developed and straight forward.
Furthermore, modifying the composition of Karvelis to using a plasmid-based system to deliver the CRISPR-Cas system as taught by Liu would necessarily result in DNA encoding the guide RNA of claims 1 and 14 as required by claims 31 and 33.
Thus the invention as claimed is rendered obvious by the combined teachings of Karvelis and Liu.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ANDREA LYNNE MORRIS SPENCER whose telephone number is (571)272-3328. The examiner can normally be reached Monday-Friday 9:00-5:00.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, James (Doug) Schultz can be reached at 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ANDREA LYNNE MORRIS SPENCER/Examiner, Art Unit 1631
/JAMES D SCHULTZ/Supervisory Patent Examiner, Art Unit 1631
Prosecution Insights