Prosecution Insights
Last updated: April 19, 2026
Application No. 18/037,029

SUPPRESSING HIPPO SIGNALING IN THE STEM CELL NICHE PROMOTES SKELETAL MUSCLE REGENERATION

Non-Final OA §103§112§DP
Filed
May 15, 2023
Examiner
ARIETI, RUTH SOPHIA
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Texas Heart Institute
OA Round
1 (Non-Final)
46%
Grant Probability
Moderate
1-2
OA Rounds
2y 7m
To Grant
99%
With Interview

Examiner Intelligence

Grants 46% of resolved cases
46%
Career Allow Rate
37 granted / 81 resolved
-14.3% vs TC avg
Strong +73% interview lift
Without
With
+72.7%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
37 currently pending
Career history
118
Total Applications
across all art units

Statute-Specific Performance

§101
5.1%
-34.9% vs TC avg
§103
30.5%
-9.5% vs TC avg
§102
12.3%
-27.7% vs TC avg
§112
29.2%
-10.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 81 resolved cases

Office Action

§103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 1-4, 6, 8-9, 11, 15-16, 20, 23, 26-32, 34-36, 38-39, and 42 are pending. Information Disclosure Statement The IDS has been considered. The Spec. cites references. The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Drawings The drawings are objected to because of the following informalities: Figs. 2, 5GH, 6AC, 7AC, 8AC, 9, 10AD, 11AC, 12AB, 13A, 14, 15BDF: A clearer, crisper version of each figure or panel (as indicated) is required. Many figure descriptions and some ¶ in the Spec. (e.g., ¶124) describe color but that is not shown in the black/white figures. Should Applicant want to submit color Figures, instructions for doing so appear below. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification: The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2). Specification The disclosure is objected to because of the following informalities: some text in the Spec. describes color figures but no color is shown in the Figs. See, e.g., ¶123-124, ¶129-130, and Fig. descriptions. Appropriate correction is required. The use of the term(s): Alexa-Fluor® (see, e.g., ¶146), Leica® (e.g., ¶146), Olympus® (e.g., ¶147), Lipofectamine® and RNAiMAX® (e.g., ¶148), Invitrogen®, QuantStudio®, Qiagen®, TaqMan® (¶150), Miltenyi Biotec® (¶151), Nunc® (¶152), Thermo Fisher Scientific®, CLICK-iT (e.g., ¶153) Graph Pad®(¶154) which is a trade name or a mark used in commerce, has been noted in this application. The term(s) should be accompanied by the generic terminology; furthermore the term(s) should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Interpretation The claims recite …at least 80% identity to a nucleotide sequence selected from the group consisting of SEQ ID NO 2, SEQ ID NO 3, and SEQ ID NO 4; and wherein the inhibitory nucleic acid targets Salvador. The recitation wherein the inhibitory nucleic acid targets Salvador is interpreted as a function resulting from the structure of a nucleic acid having at least 80% identity to SEQ ID NOs 2-4. The claims recite a nucleic acid construct. That is defined in the Spec. ¶56 as a synthesized nucleic acid molecule comprising one or more functional nucleotide sequences. The claims recite operably linked. That is defined in the Spec. ¶57 as refer[ring] to the association of nucleic acid sequences on a polynucleotide so that the function of one of the sequences is affected by another. Claim 26 recites …wherein the nucleotide sequences are expressed in the skeletal muscle cells. Claim 26 depends from Claim 1 which recites …the method comprising delivering to skeletal muscle cells… therefore wherein the nucleotide sequences are expressed in the skeletal muscle cells is interpreted as an outcome of carrying out the method step of delivering. Claim 28 recites a nucleic acid having the nt sequence set forth in SEQ ID NO…. “Having” is interpreted as open language, the same as “comprising”. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-4, 6, 9, 11, 15-16, 20, 23, 26-28, 30-32, 34-36, 38-39, and 42 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first -paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a written description rejection. All of the claimed methods (Claims 1-4, 6, 9, 11, 15-16, 20, 23, 26-28, 30-32, 34-36, 38-39, and 42) are interpreted of methods of treating. This interpretation is consistent with the contemplated use of these methods as treatments because the claims recite treatment-related outcomes and because the Spec. discusses (¶4-7) a need for treatment methods and discloses (¶8-13) providing therapy and treatment. Claims 1-4 recite methods for increasing angiogenesis in skeletal muscle (Claim 1 and claims depending therefrom), regenerating myofibers in skeletal muscle (Claim 2), inducing proliferation of satellite cites in skeletal muscle (Claim 3), and treating limb ischemia in a mammalian subject (Claim 4) by delivering to skeletal muscle cells a composition comprising at least one inhibitor nucleic acid, wherein the inhibitory nucleic acid has or is encoded by a sequence having at least 80% identity to a nt sequence selected from the group consisting of SEQ ID NO 2, 3, or 4; wherein the inhibitory nucleic acid targets Salvador. Claim 39 recites the method wherein the skeletal muscle is ischemic, atrophied, or has suffered a traumatic injury. Claim 42 recites the mammalian subject on whom the method is used has a condition selected from the group consisting of limb ischemia, peripheral vascular disease, and sarcopenia. Those broad claims encompass the large genus of inhibitory nucleic acids that have at least 80% sequence identity to SEQ ID NO 2, 3, or 4. Sequences that encode inhibitory nucleic acids that have at least 80% sequence identity to SEQ ID NO 2, 3, or 4 is an even larger genus of nucleotide sequences. Any kind of nucleic acid sequence that has or encodes a nucleic acid sequence that has at least 80% identity to SEQ ID NO 2, 3, or 4 would be encompassed by the claims as instantly presented. In addition, Claims 1-4, 39, and 42 recite certain outcomes that occur as a result of administering the inhibitory nucleic acid having or being encoded by a sequence having at least 80% identity to a nt sequence selected from the group consisting of SEQ ID NO 2, 3, or 4: increasing angiogenesis in skeletal muscle, regenerating myofibers in skeletal muscle, inducing proliferation of satellite cites in skeletal muscle, treating limb ischemia in a mammalian subject, treating skeletal muscle that is ischemic, atrophied, or has suffered traumatic injury; and treating any limb ischemia, peripheral vascular disease, and sarcopenia. Using any of the claimed methods to treat any of those conditions would be encompassed by the claims as instantly presented. Claim 16 recites that the nt sequence encoding the RNA is operably linked to a tissue-specific promoter. That broad claim encompasses the large genus of tissue-specific promoters; any tissue-specific promoter and any kind of tissue-specific promoter would be encompassed by the claims as instantly presented. Claims 27 and 28 recite that nt sequences of SEQ ID NOs 2, 3, and 4 are regulated by a single promoter. That broad claims encompass the large genus of promoters; any promoter would be encompassed by the claims as instantly presented. Claim 30 recites that the nucleic acid construct comprises sequences encoding a 3’- or 5’-miR-30 sequence. That broad claim encompasses the large genus of 3’- or 5’-miR-30 sequences; any 3’- or 5’-miR-30 sequences and any kind of 3’- or 5’-miR-30 sequences would be encompassed by the claims as instantly presented. Claim 34 recites that the nucleic acid construct comprises a post-transcriptional regulatory element. That broad claim encompasses the large genus of post-transcriptional regulatory elements; any kind of post-transcriptional regulatory element would be encompassed by the claims as instantly presented. An original claim may lack written description support when a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. See MPEP 2163. Regarding the sequences encompassed by Claims 1-4 and claims depending therefrom: inhibitory nucleic acids having or encoding a sequence having at least 80% identity to SEQ ID NOs 2-4 includes a large genus of nt sequences that may be ≤20% different from SEQ ID NOs 2-4. A nt sequence could be or have: up to 20% of the nts removed from SEQ ID NOs 2-4; a single chunk comprising ≤20% of the nts different from SEQ ID NOs 2-4; every 5th nt (starting at any position) different from SEQ ID NOs 2-4; every 5th nt (starting at any position) removed from SEQ ID NOs 2-4; any other combination of nts mutated or removed as long as the total adds up to ≤20% of total nts. Each of those categories comprises a broad subgenus with diverse members and different structures that affect their functions. The claims recite that the inhibitory nucleic acid targets Salvador, but some of those structures may have altered SAV1-targeting activity or other altered function(s). The Spec. doesn’t disclose any requisite sequence that is responsible for the claimed function of targeting SAV1. In addition, Applicant hasn’t demonstrated possession of a representative number of species of the inhibitory nucleic acids that have at least 80% identity to SEQ ID NO 2, 3, or 4. The Spec. describes that (¶114-117, Fig. 3) the inventors measured the ability of SEQ ID NOs 2, 3, and 4 to suppress endogenous SAV1 expression. Fig. 3 shows (¶114-117) transfecting mouse cardiomyocytes with SEQ ID NO 2 reduces SAV1 expression, infecting pig kidney cells with a lentivirus encoding SEQ ID NO 3 reduces SAV1 expression, and infecting human cardiomyocyte-like cells with AAV encoding SEQ ID NO 4 reduces SAV1 expression. None of the other examples discuss any of the claimed SEQ ID NOs, let alone sequences that are at least 80% identical to them. Regarding what structure is encompassed by the inhibitory nucleic acids having or encoding by a sequence having at least 80% identity to SEQ ID NOs 2-4, the Spec. does not provide information describing its required features. The Spec. does not disclose what physical structure is responsible for the claimed function. The Spec. discloses (¶70-71): The inventors used a novel AAV9 vector with a minimally sized skeletal muscle-specific expression cassette to accommodate its packaging and to induce pooled miR30-based shRNAs for SAVI knockdown in mouse myofibers, but nothing in the Spec. discloses what SEQ ID NOs were encoded by that AAV9. Therefore it is not possible to determine that the AAV9 used in the Examples encoded SEQ ID NOs 2-4 or sequences 80% identical to those SEQ ID NOs. Applicant’s examples do show (Fig. 3, ¶114-117) SEQ ID NOs 2, 3, and 4 suppress endogenous SAV1 expression. However, those examples are not sufficient to provide written description support for inhibitory nucleic acids having or encoding a sequence having at least 80% identity to SEQ ID NOs 2-4 and which result in the claimed outcomes. Although the claims claim the functional characteristics (i.e., the inhibitory nucleic acid targets Salvador, or increase angiogenesis, etc.), the functional characteristic is not coupled with any known structure. Although the Specification teaches the examples discussed above, it does not identify a core structure necessary for performing the claimed function(s) of targeting Salvador. The Spec. does not disclose any core structure, partial structure, physical or chemical property, or functional characteristic coupled with a known or disclosed structure/function relationship responsible for targeting Salvador in such a way to demonstrate possession of the full invention as claimed at time of filing. The inhibitory nucleic acids having or encoding a sequence having at least 80% identity to SEQ ID NOs 2-4 do not share a core structure. Therefore a person of ordinary skill must conclude that Applicant has not demonstrated possession of inhibitory nucleic acids having or encoding a sequence having at least 80% identity to SEQ ID NOs 2-4. The specification teaches only these species within the claimed genus/genera: SEQ ID NOs 2, 3, and 4. But those are only a paltry number compared with the breadth of what is claimed. Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genera and subgenera that are encompassed by the claims. Regarding the claimed outcomes, the following issues exist: Only Example 1 (¶113-117) shows inhibiting SAV1 using sequences 100% identical to SEQ ID NOs 2, 3, or 4. None of the examples that show effects on increasing angiogenesis, regenerating myofibers, inducing proliferation of satellite cells, or treating limb ischemia were obtained using an inhibitory nucleic acid having or encoded by a sequence having at least 80% identity to a nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4; and wherein the inhibitory nucleic acid targets Salvador or having SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4. The Spec. discloses (Examples starting at ¶119) the claimed outcomes result from using an AAV9 vector containing a myogenic-specific cassette under the cardiac troponin T promoter to drive the miR30-based shRNA to knockdown SAV1. That AAV9 vector was used in all the Examples besides for Example 1. However, the Spec. never clearly discloses the inhibitory nucleic acid(s) comprised by their AAV9 vector used in Examples 2-7. The Examples show the following: Example 1 (¶114-117) and Fig. 3 shows transfecting mouse cardiomyocytes with SEQ ID NO 2 reduces SAV1 expression, infecting pig kidney cells with a lentivirus encoding SEQ ID NO 3 reduces SAV1 expression, and infecting human cardiomyocyte-like cells with AAV encoding SEQ ID NO 4 reduces SAV1 expression. Fig. 4 (¶118) isn’t directly relevant to the claims because the experiment didn’t evaluate the effect of any inhibitor nucleic acid. Examples 2-6 (Figs. 5-15) show that some claimed outcomes can result from administering to a muscle the AAV9 disclosed in ¶119. Although data in Figs. 5-15 show that some SAV1-targeting inhibitor nucleic acid has the effects claimed, it is not clear that those results are obtained with any or all of SEQ ID NOs 2, 3, and 4. The text describing the examples merely discusses an AAV9-mediated KD of SAV1 but never discloses the sequences expressed from that AAV9. The text (¶119) doesn’t clarify which SEQ ID NO(s) were administered in the AAV9 because the Spec. discloses merely the inventors used a muscle-tropic AAV9 vector containing a myogenic-specific cassette under the cardiac troponin T promoter to drive the miR30-based shRNA to knockdown SAV1 in myofibers of the ischemic legs of C57BL/6J mice. That § doesn’t clearly disclose any of the claimed SEQ ID NOs were used in the AAV9. The same AAV9 was used in the rest of the examples. The other Examples (aside from Example 1) also do not disclose using any of the claimed SEQ ID NOs. The methods (¶138) similarly disclose using a mir30-based SAV1 shRNA, under the control of the cardiac troponin T promoter, but that does not clearly disclose that the shRNA described is any of SEQ ID NOs 2-4. Example 2/Fig. 5 shows (¶29, ¶119) that AAV9-mediated knockdown (KD) of SAV1 results in increased YAP+ nuclear localization in muscle fibers of ischemic legs in mice. The text (¶119) doesn’t clarify which SEQ ID NO(s) were administered in the AAV9 because the Spec. discloses merely the inventors used a muscle-tropic AAV9 vector containing a myogenic-specific cassette under the cardiac troponin T promoter to drive the miR30-based shRNA to knockdown SAV1 in myofibers of the ischemic legs of C57BL/6J mice but that doesn’t clearly disclose any of the claimed SEQ ID NOs. Example 3/Fig. 6 shows (¶30, ¶120-122) functional outcome of hindlimb ischemia after AAV9-shRNA-mediated SAV1 knockdown in ischemic legs: they observed restored blood flow, more capillaries per myofiber, and greater treadmill endurance vs. control. Example 3 used AAV9 SAV1 shRNA but no SEQ ID NOs are specified. Example 4/Fig. 7 shows (¶31, ¶123-124) more EdU+ cells after SAV1 KD in ischemic muscle. Example 4 used AAV9 SAV1 shRNA but no SEQ ID NOs are specified. Example 4/Fig. 8 shows (¶32, ¶123-124) SAV1 KD promotes satellite and endothelial cell proliferation. Example 4/Fig. 9 shows (¶33, ¶123-124) SAV1 KD in mouse ischemic hindlimb results in proliferation of EdU+Pax7+ satellite cells. Example 5/Fig. 10 shows (¶34, ¶125-130) skeletal muscle regeneration after muscle injury with a toxin (i.e., CTX): SAV1-shRNA-treated muscle had large-caliber regenerated myofibers and higher capillary density vs. control. Example 5 used AAV9 SAV1 shRNA but no SEQ ID NOs are specified. Example 5/Fig. 11 shows (¶35, ¶125-130) skeletal muscle regeneration after muscle injury with a toxin: SAV1-shRNA-treated muscle had a greater proportion of larger regenerated myofibers and a significantly higher ratio of Pax7+/EdU– nuclei vs. control; no significant differences were observed in % EdU+ nuclei or % Pax7+EdU+ cells. Example 5/Fig. 12 shows (¶36, ¶125-130) effect of shRNA injection after CTX-induced muscle injury: SAV1 KD resulted in more Pax7+EdU+ satellite cell clusters. Example 5/Fig. 13 shows (¶37, ¶125-130) SAV1 KD in CTX-injured muscle promoted angiogenesis. Example 5/Fig. 14 reportedly shows (¶38, ¶125-130) representative images of inflammatory inflammation in the enlarged interstitial space and around myofibers and blood vessels; those details aren’t visible due to image quality. Example 6/Fig. 15 shows (¶39, ¶131-134) medium generated from SAV1 silencing in C2C12 myotubes promoted satellite cell proliferation in vitro: conditioned medium from cells transfected with SAV1 siRNA reduces SAV1 mRNA expression; satellite cells cultured in conditioned medium (which was collected from cells transfected with SAV1 siRNA or AAV SAV1 shRNA; no SEQ ID NOs were specified) exhibit increased % of EdU+ cells. The example transfected cells with siRNA and also transduced cells with AAV9 SAV1 shRNA. Altogether, the Spec. provides no evidence that all of the claimed methods were possessed at time of filing. The Spec. presents no evidence of possessing any inhibitory nucleic acid having or encoded by a sequence having at least 80% identity to a nt sequence selected from the group consisting of SEQ ID NO 2, SEQ ID NO 3, or SEQ ID NO 4. As discussed, only Example 1 discusses using any of the claimed SEQ ID NOs and while the Spec. discloses administering AAV9 resulted in treatment, nothing in the Spec. discloses the sequences encoded by the AAV9 that was administered. Regarding Claims 39 and 42, nothing in the Spec. discloses any treatment of peripheral vascular disease in any organ or body part besides for skeletal muscle using the claimed methods of administering sequences having 80% identity to the claimed sequences. The Spec. provides no evidence of possessing a method that results in the claimed outcomes of increasing angiogenesis in skeletal muscle, regenerating myofibers in skeletal muscle, inducing proliferation of satellite cites in skeletal muscle, treating limb ischemia in a mammalian subject, treating skeletal muscle that is ischemic, atrophied, or has suffered traumatic injury; and treating any limb ischemia, peripheral vascular disease, and sarcopenia because although many of those outcomes were observed in Applicant’s experiments, those outcomes were observed after administering AAV9 SAV1 shRNA and nothing in the Spec. clarifies that AAV9 SAV1 shRNA encodes the claimed SEQ ID NOs 2-4 or sequences at least 80% identical to those SEQ ID NOs. Yet, the claims encompass treating all of the recited conditions using those specific SEQ ID NOs. The Spec. as filed does not provide evidence of treating all of the recited conditions using those specific SEQ ID NOs. The specification teaches using only these species within the claimed genus/genera, and only provides evidence of using them to decrease SAV1 expression: SEQ ID NOs 2, 3, and 4. Altogether, using those species to obtain the one single outcome of reducing SAV1 expression are only a paltry number compared with the breadth of what is claimed. Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genera and subgenera that are encompassed by the claims. Note that Applicant may overcome some aspects of this rejection (i.e., using sequences with 100% identity to the claimed SEQ ID NOs to obtain most of the claimed outcomes; see below §Scope of Enablement) by clarifying, IF APPROPRIATE, that the AAV9 SAV1 shRNA used in Examples 2-7 comprises the claimed SEQ ID NOs. Regarding the tissue-specific promoter, promoter, 3’- or 5’-miR-30 sequence, and post-transcriptional regulatory element of Claims 16, 27-28, 30, and 34, the Spec. describes using (¶115) a general U6 promoter (which is not tissue-specific) and (¶116, ¶119, ¶138) the tissue-specific cardiac troponin T (cTnT) promoter. The Spec. generally discusses (¶19-20, ¶56, ¶58) using a promoter, tissue-specific promoter, nucleic acid construct that comprises sequences encoding a 3'-microRNA-30 sequence and a 5'-microRNA-30 sequence, and a post-transcriptional regulatory element, but does not provide any more detail than that they may be used. The Spec. discloses (¶87-96) specific kinds of promoters and regulatory elements but doesn’t provide any more detail than that they may be used. The Spec. doesn’t provide any examples that demonstrate they were in possession of the methods wherein the nucleic acid construct comprises any tissue-specific promoter, promoter, 3’- or 5’-miR-30 sequence, and post-transcriptional regulatory element. The Spec. discusses (¶119) driving a miR30-based shRNA under the cTnT promoter, but does not disclose what miR-30 sequence(s) was used. Regarding what structures are encompassed by the claimed tissue-specific promoter, promoter, 3’- or 5’-miR-30 sequence, and post-transcriptional regulatory element, the Spec. does not provide information describing any required structural features. The Spec. does not disclose what physical structure(s) are responsible for the claimed function. Applicant’s examples show nucleic acid constructs comprising a U6 promoter (which is not tissue-specific) and the tissue-specific cardiac troponin T (cTnT) promoter. However, those examples are not sufficient to provide written description support for any tissue-specific promoter, any promoter, any 3’- or any 5’-miR-30 sequence, and any post-transcriptional regulatory element. Furthermore, the examples are not sufficient to demonstrate possession of nucleic acid constructs encoding SEQ ID NOs 2, 3, and 4 under the regulatory control of a single promoter, let alone under the control of representative number of species from the broad genera of tissue-specific promoters, promoters, and post-transcriptional regulatory elements, or nucleic acid constructs comprising sequence encoding 3’- or 5’-miR-30 sequences. Although the claims claim the functional characteristics (i.e., being a tissue-specific promoter, promoter, 3’- or 5’-miR-30 sequence, or post-transcriptional regulatory element), the functional characteristic is not coupled with any known structure. Although the Specification teaches the examples discussed above, it does not identify a core structure necessary for performing the claimed function(s) of being a tissue-specific promoter, promoter, 3’- or 5’-miR-30 sequence, or post-transcriptional regulatory element. The Spec. does not disclose any core structure, partial structure, physical or chemical property, or functional characteristic coupled with a known or disclosed structure/function relationship responsible for being a tissue-specific promoter, promoter, 3’- or 5’-miR-30 sequence, or post-transcriptional regulatory element in such a way to demonstrate possession of the full invention as claimed at time of filing. The specification demonstrates possession of nucleic acid constructs comprising only these species within the claimed genus/genera: a U6 promoter and the tissue specific cTnT promoter. But those are only a paltry number compared with the breadth of what is claimed. Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genera and subgenera that are encompassed by the claims. While none of these elements is specifically required to demonstrate possession, in combination their absence means that one skilled in the art at the time of filing would conclude that the inventors lacked possession of the full breadth of the invention claimed. Claims 1-4, 16, 27-28, 30, and 34, 39, and 42 are rejected for failing to demonstrate possession of the claimed invention. Claims 6, 9, 11, 15-16, 20, 23, 26-28, 30-32, 34-36, 38-39, and 42 are rejected because they depend from Claim(s) 1-4, 16, 27-28, 30, and 34 and do not remedy the issues. Claim 42 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for: A method of increasing angiogenesis in skeletal muscle by administering at least one inhibitory nucleic acid, wherein the inhibitory nucleic acid is, or is encoded by, a nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4; wherein the mammalian subject has a condition from the group consisting of limb ischemia, peripheral vascular disease of a limb or skeletal muscle, and sarcopenia…, does not reasonably provide enablement for: the methods wherein the condition is any peripheral vascular disease. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims. This is a scope of enablement rejection. The factors to be considered in determining whether a disclosure would require undue experimentation include: (A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the specification; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. In re Wands, 8 USPQ2d, 1400 (CAFC 1988) and MPEP 2164.01. The breadth of the claims and the nature of the invention: With respect to claim breadth, the standard under 35 U.S.C. §112(a) entails determining what the claims recite and what the claims mean as a whole. All of the claimed methods are interpreted of methods of treating. This interpretation is consistent with the contemplated use of these methods as treatments because the claims recite treatment-related outcomes and because the Spec. discusses (¶4-7) a need for treatment methods and discloses (¶8-13) providing therapy and treatment. The broadest reasonable interpretation (BRI) of the methods of Claim 42 is that the method will be able to treat any limb ischemia, any peripheral vascular disease (PVD), and any sarcopenia. The nature of the invention of Claim 42 is a method for treating treat any limb ischemia, any peripheral vascular disease (PVD), and any sarcopenia by administering to skeletal muscle cells an inhibitory nucleic acid, wherein the inhibitory nucleic acid has or is encoded by a sequence having at least 80% identity to SEQ ID NOs 2-4. A skilled artisan would not be able to use the method as claimed with a reasonable expectation of success based solely on what is disclosed in the specification. The problem with Claim 42 is peripheral vascular disease (PVD) can affect organs but the Spec. only describes using their methods in skeletal muscle. Therefore successfully using the method of Claim 42 to treat any peripheral vascular disease is unpredictable. The state of the art and prior art, the level of one of ordinary skill, and the level of predictability in the art: The art and prior art teach that RNA interference therapies need to be specific for their target. The art of Johns Hopkins Medicine (2026. Peripheral Vascular Disease. Available online at hopkinsmedicine.org. Accessed on 09 March 2026, “Hopkins”) teaches (§What is Peripheral Vascular Disease?) PVD can affect any blood vessel outside of the heart. Northwestern Medicine (2026. What is Peripheral Vascular Disease? Available online at nm.org. Accessed on 09 March 2026, “NWU”) teaches (§What is Peripheral Vascular Disease? ¶2) PVD can occur in vessels that carry blood to the legs, arms, stomach, or kidneys. Blood vessels in the stomach, kidneys, or other organs are not in skeletal muscle. Khachigian (et al. 2023. Gene Therapeutic Strategies for Peripheral Artery Disease and New Opportunities Provided by Adeno-Associated Virus Vectors. Arterioscler. Thromb. Vasc. Biol. 43[6]:836–851, Khachigian”) is drawn to treating peripheral artery disease in limbs and teaches (§Optimal Delivery Approach: Intramuscular, Regional Intravascular, or Systemic) intramuscular delivery can result in some off-target transduction but most delivered transgene is expressed at or near the site of delivery. That indicates that a nucleic acid should be administered at or to an organ in need of therapy. The instant claims recite administering the claimed nucleic acids to skeletal muscle cells. Therefore an artisan would determine that successfully using the claimed method of treating any PVD—including PVD in organs like the stomach or kidneys—by injecting to skeletal muscle the claimed nucleic acids would be unpredictable. The art indicates that there is no evidence that it would be possible to treat any PVD in any organ by delivering the claimed nucleic acids to skeletal muscle. The amount of direction provided by the specification and the existence of working examples: What is enabled by the working examples is narrow compared to the breadth of the claims: Example 1 (¶114-117) and Fig. 3 shows transfecting mouse cardiomyocytes with SEQ ID NO 2 reduces SAV1 expression, infecting pig kidney cells with a lentivirus encoding SEQ ID NO 3 reduces SAV1 expression, and infecting human cardiomyocyte-like cells with AAV encoding SEQ ID NO 4 reduces SAV1 expression. Fig. 4 (¶118) isn’t directly relevant to the claims because the experiment didn’t evaluate the effect of any inhibitor nucleic acid. Examples 2-6 (Figs. 5-15) show that some claimed outcomes can result from administering to a muscle the AAV9 disclosed in ¶119. Although data in Figs. 5-15 show that some SAV1-targeting inhibitor nucleic acid has the effects claimed, it is not clear that those results are obtained with any or all of SEQ ID NOs 2, 3, and 4. The text describing the examples merely discusses an AAV9-mediated KD of SAV1 but never discloses the sequences expressed from that AAV9. The text (¶119) doesn’t clarify which SEQ ID NO(s) were administered in the AAV9 because the Spec. discloses merely the inventors used a muscle-tropic AA V9 vector containing a myogenic-specific cassette under the cardiac troponin T promoter to drive the miR30-based shRNA to knockdown SAV1 in myofibers of the ischemic legs of C57BL/6J mice. That § doesn’t clearly disclose any of the claimed SEQ ID NOs were used in the AAV9. The same AAV9 was used in the rest of the examples. The other Examples (aside from Example 1) also do not disclose using any of the claimed SEQ ID NOs. The methods (¶138) similarly disclose using a mir30-based SAV1 shRNA, under the control of the cardiac troponin T promoter, but that does not clearly disclose that the shRNA described is any of SEQ ID NOs 2-4. Example 2/Fig. 5 shows (¶29, ¶119) that AAV9-mediated knockdown (KD) of SAV1 result in increased YAP+ nuclear localization in muscle fibers of ischemic legs in mice. The text (¶119) doesn’t clarify which SEQ ID NO(s) were administered in the AAV9 because the Spec. discloses merely the inventors used a muscle-tropic AA V9 vector containing a myogenic-specific cassette under the cardiac troponin T promoter to drive the miR30-based shRNA to knockdown SAV1 in myofibers of the ischemic legs of C57BL/6J mice but that doesn’t clearly disclose any of the claimed SEQ ID NOs. Example 3/Fig. 6 shows (¶30, ¶120-122) functional outcome of hindlimb ischemia after AAV9-shRNA-mediated SAV1 knockdown in ischemic legs: they observed restored blood flow, more capillaries per myofiber, and greater treadmill endurance vs. control. Example 3 used AAV9 SAV1 shRNA but no SEQ ID NOs are specified. Example 4/Fig. 7 shows (¶31, ¶123-124) more EdU+ cells after SAV1 KD in ischemic muscle. Example 4 used AAV9 SAV1 shRNA but no SEQ ID NOs are specified. Example 4/Fig. 8 shows (¶32, ¶123-124) SAV1 KD promotes satellite and endothelial cell proliferation. Example 4/Fig. 9 shows (¶33, ¶123-124) SAV1 KD in mouse ischemic hindlimb results in proliferation of EdU+Pax7+ satellite cells. Example 5/Fig. 10 shows (¶34, ¶125-130) skeletal muscle regeneration after muscle injury with a toxin (i.e., CTX): SAV1-shRNA-treated muscle had large-caliber regenerated myofibers and higher capillary density vs. control. Example 5 used AAV9 SAV1 shRNA but no SEQ ID NOs are specified. Example 5/Fig. 11 shows (¶35, ¶125-130) skeletal muscle regeneration after muscle injury with a toxin: SAV1-shRNA-treated muscle had a greater proportion of larger regenerated myofibers and a significantly higher ratio of Pax7+/EdU– nuclei vs. control; no significant differences were observed in % EdU+ nuclei or % Pax7+EdU+ cells. Example 5/Fig. 12 shows (¶36, ¶125-130) effect of shRNA injection after CTX-induced muscle injury: SAV1 KD resulted in more Pax7+EdU+ satellite cell clusters. Example 5/Fig. 13 shows (¶37, ¶125-130) SAV1 KD in CTX-injured muscle promoted angiogenesis. Example 5/Fig. 14 reportedly shows (¶38, ¶125-130) representative images of inflammatory inflammation in the enlarged interstitial space and around myofibers and blood vessels; those details aren’t visible due to image quality. Example 6/Fig. 15 shows (¶39, ¶131-134) medium generated from SAV1 silencing in C2C12 myotubes promoted satellite cell proliferation in vitro: conditioned medium from cells transfected with SAV1 siRNA reduces SAV1 mRNA expression; satellite cells cultured in conditioned medium (which was collected from cells transfected with SAV1 siRNA or AAV SAV1 shRNA) exhibit increased % of EdU+ cells. The example transfected cells with siRNA and also transduced cells with AAV9 SAV1 shRNA. Altogether, the Spec. provides no evidence of using any inhibitory nucleic acid having or encoded by a sequence having at least 80% identity to a nt sequence selected from the group consisting of SEQ ID NO 2, SEQ ID NO 3, or SEQ ID NO 4 to treat PVD in any organ. Specifically regarding Claim 42, nothing in the Spec. discloses any treatment of peripheral vascular disease in any organ or body part besides for skeletal muscle. Yet, the claims encompass treating any peripheral vascular disease. Although the level of an artisan is high, the art of using any interfering RNA to obtain the treatment outcome recited in the claims—namely, treat any peripheral vascular disease—is unpredictable. The art is unpredictable regarding using the method of Claim 42 to treat any peripheral vascular disease because Hopkins and NWU teach organs can be afflicted by PVD and Khachigian teaches nucleic acids for treating PAD (a kind of PVD) that are injected to muscle stay in the local area and do not travel throughout the body. Furthermore, the Spec. as filed does not provide evidence of successfully using their method to treat any PVD. Therefore, the method could not be used as claimed to obtain the outcome of treating any peripheral vascular disease. The quantity of experimentation needed to make or use the invention: The standard of an enabling disclosure is not the ability to make and test if the invention works but one of the ability to make and use with a reasonable expectation of success. A patent is granted for a completed invention, not the general suggestion of an idea (MPEP 2164.03 and Chiron Corp. v. Genentech Inc., 363 F.3d 1247, 1254, 70 USPQ2d 1321, 1325-26 (Fed. Cir. 2004). The instant specification is not enabling because one cannot follow the guidance presented therein or within the art at the time of filing, and practice the claimed method without first making a substantial inventive contribution. Given the teachings of Hopkins and NWU about the diverse body parts that are afflicted by PVD and given Khachigian’s discussion of delivery approaches for treating PAD, an artisan of ordinary skill would not be able to use the invention as claimed with a reasonable expectation of success. The amount of experimentation required for enabling guidance commensurate in scope with what is claimed goes beyond what is considered “routine” within the art and constitutes undue further experimentation in order to successfully use the method of treating any PVD with a reasonable expectation of success. Claim 42 is rejected for those reasons. In conclusion, the specification provides enablement for: A method of increasing angiogenesis in skeletal muscle by administering at least one inhibitory nucleic acid, wherein the inhibitory nucleic acid is, or is encoded by, a nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4; wherein the mammalian subject has a condition from the group consisting of limb ischemia, peripheral vascular disease of a limb or skeletal muscle, and sarcopenia. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 30 and 39 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. A claim may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173. In the present instance, Claim 30 recites comprises sequences encoding a 3’ microRNA-30 sequence and a 5’ microRNA-30 sequence. The claim(s) are considered indefinite because there is a question or doubt as to what are the metes and bounds of the claim. Neither the claims nor the Spec. define what is a microRNA-30 sequence, nor do they clarify its nucleotide sequence. Furthermore, a search for microRNA-30 or miR-30 revealed that there are numerous miR-30, including (for human alone, see miRBase search results for “mir-30”, filtered. Searched on 09 March 2026) at least -30a, -30b, -30c, -30c-1, -30c-2, -30d, and -30e. Therefore it is not clear which miR-30(s) are required by the claim. Claim 30 is rejected for those reasons. In the interest of compact prosecution the claim is interpreted as any known miR-30 sequence. In the present instance, Claim 39 recites wherein the skeletal muscle is…atrophied or has suffered a traumatic injury. The claim(s) are considered indefinite because there is a question or doubt as to what are the metes and bounds of the claim. Neither the claims nor the Spec. define what is considered atrophied or ha[ving] suffered a traumatic injury, nor do they clarify criteria for determining whether a muscle has atrophied or has suffered a traumatic injury. Therefore an artisan would not be able to determine when to apply the method. Claim 39 is rejected for those reasons. In the interest of compact prosecution the claim is interpreted as applying the method when skeletal muscle has atrophied vs. a baseline measurement or has suffered a traumatic injury vs. a baseline measurement. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1-4, 6, 8-9, 11, 15-16, 20, 23, 36-32, 34, 38-39, and 42 are rejected under 35 U.S.C. 103 as being unpatentable over: Plouffe (et al. 2015. Disease implications of the Hippo/YAP pathway. Trends Molec. Med. 21[4]:212-222, “Plouffe”), He (et al. 2017. The role of Hippo/yes-associated protein signalling in vascular remodelling associated with cardiovascular disease. Brit. J. Pharmacol. 175:1354-1361, “He”), Choi (et al. 2015. Yes-associated protein regulates endothelial cell contact-mediated expression of angiopoietin-2. Nat. Comm. 6:6943, “Choi”), Lee (et al. 2010. The Hippo–Salvador pathway restrains hepatic oval cell proliferation, liver size, and liver tumorigenesis. PNAS 107[8]:8249-8253, “Lee”), Zhou (2014. An emerging role for Hippo-YAP signaling in cardiovascular development. J. Biomed. Res. 28[4]:251-254, “Zhou”), Watt (et al. April 2019. Author manuscript of The Hippo Signaling Pathway in the Regulation of Skeletal Muscle Mass and Function. Exerc. Sport Sci. Rev. 46[2]:92-96, “Watt”, published version of record on IDS), Watt (et al. 2015. The Hippo pathway effector YAP is a critical regulator of skeletal muscle fibre size. Nat. Comm. 6:6048, “Watt 2015”), International Publication Number WO 2015/089074 (published 18 June 2015, “WO074” of record on IDS) as evidenced by Wikipedia (“Post transcriptional regulation”. page archived 25 October 2020. Available at Wikipedia.org. Accessed on 11 March 2026, “Wikipedia”), International Publication Number WO 2019/051117 (published 14 March 2019, “WO117”, of record on IDS), and Wikipedia ("WHP Posttransciptional Response Element". page archived 09 March 2018. Available at Wikipedia.org. Accessed on 11 March 2026, “Wikipedia”). The prior art teaches Salvador (SAV1) and YAP are in the same signaling pathway and teaches a connection between the presence of SAV1 and amount of YAP was known. The prior art also teaches connections between the Hippo pathway and each of the claimed outcomes. Plouffe teaches (§Abstract) the Hippo signaling pathway is important for controlling organ size and tissue homeostasis. Plouffe teaches (Fig. 1) SAV1 is upstream of YAP in the Hippo pathway: SAV1 [together in complex with another protein partner] phosphorylate and activate [LATS1/2] and [MOB1]. When activated, LATS1/2 phosphorylates [YAP/TAZ], the primary effectors of the Hippo pathway. When phosphorylated, YAP/TAZ are sequestered in the cytoplasm or degraded. When YAP/TAZ are dephosphorylated, they translocate to the nucleus where they interact with [TEAD1–4] to induce transcription and promote cell proliferation and inhibit apoptosis. Plouffe teaches (§The Hippo pathway in intestinal regeneration) YAP plays an important role in regeneration following injury and (§The Hippo pathway in cardiomyocyte regeneration): SAV1-deficient cardiomyocytes can re-enter the cell cycle and undergo cell division and SAV1 heart-specific knockout mice show improved recovery following ischemia, with ejection fraction and fractional shortening values comparable to those of control, non-ischemic mice [58]. These reports suggest that Hippo-deficient hearts exhibit increased regenerative potential. YAP transgenic mice also show increased regeneration and decreased fibrosis following heart injury. Those teachings indicate that the Hippo pathway was known to be involved in cell regenerative potential. He, drawn to the role of Hippo pathway component YAP in vascular remodeling, teaches (§Introduction ¶2) Hippo/Yap signaling was found to contribute to vascular remodeling and related CVDs, including pulmonary hypertension, atherosclerosis, aortic aneurysms, restenosis and angiogenesis. He teaches (§Components of the Hippo/YAP pathway, Fig. 1) YAP is a transcriptional enhancer that is downstream of SAV1. He teaches (§Hippo/YAP pathway and angiogenesis) angiogenesis is an important process to form new blood vessels under both physiological and pathophysiological conditions and angiogenesis is involved in ischaemia-induced vascular remodelling, which restores perfusion in some ischaemic conditions, such as acute myocardial infarction and hind-limb ischaemia. He teaches (same §) YAP deficiency leads to defective tubular network formation of ECs and suppresses angiogenesis. He teaches (same §) these findings imply that YAP might be a potent therapeutic target to regulate angiogenesis for ischaemic diseases. Both Plouffe and He indicate that SAV1 is upstream of and negatively regulates YAP’s functions (which include angiogenesis and cell growth and proliferation) by resulting in YAP phosphorylation which keeps it out of the nucleus. Both Plouffe and He teach that nuclear YAP is necessary for downstream functions such as angiogenesis (which restores perfusion in limb-ischemia) to occur. Choi, drawn to YAP’s regulation of ANG2 expression and, therefore, angiogenesis, teaches (§Abstract) over-expression of YAP-active form in endothelial cells (EC) enhances angiogenic sprouting. Choi teaches (Fig. 2) YAP deficient EC display impair angiogenesis. Together, He’s and Choi’s teachings indicate increasing the amount of YAP in a cell’s nucleus induces angiogenesis and suggest YAP as a therapeutic target for regulating angiogenesis to treat ischemic diseases including hind limb ischemia. Conversely, He and Choi teach that decreasing YAP decreases angiogenesis. Lee, drawn to the Hippo pathway in liver cell proliferation and size, teaches (§Abstract) ablation of WW45 increased the abundance of YAP and induced its localization to the nucleus in oval cells, likely accounting for their increased proliferative capacity. Lee teaches (same §) WW45 is simply another name for SAV1. Zhou, drawn to Hippo pathway role in cardiovascular development, teaches (§ROLE OF YAP IN MOUSE CARDIOVASCULAR DEVELOPMENT) the YAP gain-of-function phenotype in mouse heart largely phenocopies the cardiac-specific knockout of SAV1. In addition, the teachings of Watt indicate that (§The Hippo signaling pathway, Fig. 1) the Hippo pathway works the same way in skeletal muscle as in other tissues described in Plouffe, He, Choi, Lee, and Zhou: SAV1 acts, upstream in the pathway and with a partner, to phosphorylate and downregulate YAP, thereby inhibiting YAP. Watt teaches (§Introduction ¶1) key elements of the Hippo signaling pathway, an essential mediator of tissue growth in a number of epithelial cell types, function during adult skeletal muscle fiber growth. Watt teaches (same §) their findings indicate the Hippo pathway is a critical element in both muscle fibers and muscle satellite cells. Watt teaches (§Yap and Taz expression in skeletal muscle) YAP is controlled by negative feedback mechanisms and amount of YAP increases during chronic mechanical overload-induced hypertrophy in mouse skeletal muscle (suggesting an anabolic role), and that YAP supports skeletal muscle regeneration. Watt teaches (same §) a reduction in YAP plays a role in age-dependent loss of skeletal muscle mass (i.e., sarcopenia). Watt teaches (§The functional role of Yap and Taz during satellite cell activation) transient activation of YAP enhances satellite cell proliferative dynamics and permits myoblast differentiation to support skeletal muscle growth and adaptation. Watt teaches (§Yap and Taz promote muscle growth via Tead in Post-natal muscle fibers) YAP stimulates muscle fiber hypertrophy. Together, Watt’s teachings indicate that YAP functions to increase proliferation of satellite cells and increase muscle hypertrophy, and that YAP supports skeletal muscle regeneration. Watt’s teachings also indicate that (Fig. 1) Hippo signaling in skeletal muscle works the same as in other cells and tissues: SAV1 negatively regulates YAP. Watt 2015 teaches (§Abstract) YAP positively regulates basal skeletal muscle mass and protein synthesis. Watt 2015 teaches (§YAP is required to maintain basal skeletal myofibre size) injecting to mouse skeletal muscle AAV encoding a YAP-targeting shRNA and (§YAP promotes hypertrophy via TEAD transcription factors) injecting to mouse skeletal muscle AAV encoding a YAP. Watt 2015 teaches (same § and Figs. 1a and 3a) increasing YAP expression resulted in an increase in muscle mass and mean myofiber cross-sectional area (CSA). Watt 2015 teaches (same §) these results support the hypothesis that YAP positively regulates muscle mass, and that increasing YAP levels is sufficient to promote muscle hypertrophy in vivo [emphasis added]. Watt 2015 teaches (§Abstract) YAP abundance and activity in muscles is increased following injury or degeneration of motor nerves, as a process to mitigate neurogenic muscle atrophy. Watt 2015 suggests (same §) further investigation to identify interventions that promote YAP activity in skeletal muscle might aid the development of therapeutics to combat muscle wasting and neuromuscular disorders. Watt 2015’s teachings indicate it was routine and conventional in the art of increasing skeletal muscle mass to administer via intramuscular injection to skeletal muscle an AAV vector encoding shRNA or encoding a gene to up- or down-regulate a target within the Hippo pathway. Watt 2015’s teachings indicate that increasing YAP levels was known to promote muscle hypertrophy in vivo. Therefore, in view of the teachings of Plouffe, He, and Choi, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention that upregulating the amount of cellular YAP would increase angiogenesis and treat limb ischemia (i.e., some limitations of Claims 1, 4, 39, and 42). It would also have been obvious, in view of the teachings of Lee and Zhou, that downregulating the amount of SAV1 would be one way to effectively upregulate the amount of YAP. It would also have been obvious, in view of the teachings of Watt and Watt 2015, that the Hippo pathway works the same in skeletal muscle as other tissues and that increasing YAP would increase skeletal muscle mass and proliferation of satellite cells and increase skeletal muscle regeneration; all of those functions are simply another way of saying “regenerating myofibers” (some limitations of Claims 2 and 3). It would have been obvious, in view of the teachings of Watt, to increase YAP to treat sarcopenia (i.e., a limitation of Claim 42). The teachings of Watt 2015 indicate that upregulating YAP increases muscle mass and muscle fiber cross-sectional area, so it would have been obvious to upregulate YAP, including by downregulating SAV1, to increase skeletal muscle mass. Plouffe, He, Choi, Lee, Zhou, Watt, and Watt 2015 do not teach administering an inhibitory nucleic acid having or encoded by a sequence having identity to claimed SEQ ID NOs 2, 3, and/or 4, or the other claim limitations. However, WO074, drawn to Hippo and dystrophin complex signaling in cardiomyocyte renewal, teaches (¶8) shRNA that targets any member of the Hippo pathway, including SAV1. Although WO074 is drawn to treating cardiac conditions, it teaches (¶51) treating individuals suffering from degeneration of skeletal muscle fibers. Regarding the SEQ ID NOs recited in the claims and Claims 8-9 and 11: WO074 teaches (¶9) using nucleic acid compositions that target SAV1 in a mammal, the nucleic acid compositions are shRNA molecules, and the compositions can comprise shRNA molecules comprising one or more of SEQ ID NOs 4, 5, 6, and 12; or (¶10-12) derivatives of those sequences that can have at least 80% identity to those SEQ ID NOs. The following alignments show that WO074 SEQ ID NO 4 is 100% identical to claimed SEQ ID NO 2, WO074 SEQ ID NO 5 is 100% identical to claimed SEQ ID NO 3, and WO074 SEQ ID NOs 6 and 12 are each 95.2% identical to claimed SEQ ID NO 4. WO074 SEQ ID NOs 4 and 5 are each 21-mer. WO074 SEQ ID NOs 6 and 12 are each 20-mer: BCB15648 (NOTE: this sequence has 7 duplicates in the database searched. See complete list at the end of this report) ID BCB15648 standard; DNA; 21 BP. XX AC BCB15648; XX DT 13-AUG-2015 (first entry) XX DE Mouse salvador (Sav1) cDNA-targeted shRNA, SEQ ID 4. XX KW Protein salvador homolog 1; SAV1 gene; antiinflammatory; cardiac failure; KW cardiant; cardiovascular disease; cardiovascular-gen.; KW diabetic cardiomyopathy; duchenne dystrophy; fibrosis; gene silencing; KW growth-disorder-gen.; ischemia; muscular-gen.; myocardial disease; KW myocardial infarction; necrosis; neuroprotective; rna interference; KW short hairpin RNA; ss; therapeutic; vasotropic. XX OS Mus musculus. XX CC PN WO2015089074-A1. XX CC PD 18-JUN-2015. XX CC PF 09-DEC-2014; 2014WO-US069349. XX PR 09-DEC-2013; 2013US-0913715P. XX CC PA (BAYU ) BAYLOR COLLEGE MEDICINE. CC PA (TEXA-) TEXAS HEART INST. XX CC PI Martin JF, Morikawa Y, Heallen TR, Leach J; XX DR WPI; 2015-35680T/46. XX CC PT New isolated synthetic nucleic acid composition useful for treating CC PT individual for cardiac condition e.g. cardiovascular disease, heart CC PT failure, myocardial infarction, ischemia, and necrosis, comprises CC PT specific base pair sequence. XX CC PS Claim 1; SEQ ID NO 4; 55pp; English. XX CC The present invention relates to a novel isolated synthetic nucleic acid CC composition comprising shRNA oligonucleotides (see BCB15648-BCB15656). CC The invention further provides: (1) a method for treating an individual CC for a cardiac condition (e.g., cardiovascular disease, cardiomyopathy, CC heart failure, myocardial infarction, ischemia, necrosis, fibrosis, or CC diabetic cardiomyopathy, age-related cardiomyopathy) and duchenne CC muscular dystrophy (DMD), by providing the composition or a shRNA that CC targets a salvador (Sav1) to the individual; and (2) a kit comprising the CC composition. The present sequence represents a mouse Sav1 cDNA-targeted CC shRNA, which is used in the composition of the invention for treating the CC above-mentioned cardiac condition. Note: This sequence is described in CC the specification as a short hairpin RNA (shRNA) but is shown as a DNA CC sequence. XX SQ Sequence 21 BP; 9 A; 2 C; 8 G; 2 T; 0 U; 0 Other; Query Match 100.0%; Score 21; Length 21; Best Local Similarity 100.0%; Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AAGTACGTGAAGAAGGAGACG 21 Claimed SEQ ID NO 2 ||||||||||||||||||||| Db 1 AAGTACGTGAAGAAGGAGACG 21 WO074 SEQ ID NO 4 BCB15649 (NOTE: this sequence has 7 duplicates in the database searched. See complete list at the end of this report) ID BCB15649 standard; DNA; 21 BP. XX AC BCB15649; XX DT 13-AUG-2015 (first entry) XX DE Mouse salvador (Sav1) cDNA-targeted shRNA, SEQ ID 5. XX [repeated data is truncated] CC PN WO2015089074-A1. XX [repeated data is truncated] XX CC PS Claim 1; SEQ ID NO 5; 55pp; English. XX [repeated data is truncated] XX SQ Sequence 21 BP; 4 A; 8 C; 2 G; 7 T; 0 U; 0 Other; Query Match 100.0%; Score 21; Length 21; Best Local Similarity 100.0%; Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AAGATTTACCCCTTCCTCCTG 21 Claimed SEQ ID NO 3 ||||||||||||||||||||| Db 1 AAGATTTACCCCTTCCTCCTG 21 WO074 SEQ ID NO 5 BCB15650 (NOTE: this sequence has 5 duplicates in the database searched. See complete list at the end of this report) ID BCB15650 standard; DNA; 20 BP. XX AC BCB15650; XX DT 13-AUG-2015 (first entry) XX [repeated data is truncated] XX CC PN WO2015089074-A1. XX [repeated data is truncated] XX CC PS Claim 1; SEQ ID NO 6; 55pp; English. XX [repeated data is truncated] XX SQ Sequence 20 BP; 3 A; 5 C; 5 G; 7 T; 0 U; 0 Other; Query Match 95.2%; Score 20; Length 20; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 2 ATTCCTGACTGGCTTCAGGT 21 Claimed SEQ ID NO 4 |||||||||||||||||||| Db 1 ATTCCTGACTGGCTTCAGGT 20 WO074 SEQ ID NO 6 BCB15656 ID BCB15656 standard; DNA; 20 BP. XX AC BCB15656; XX DT 13-AUG-2015 (first entry) XX DE Human salvador (Sav1) cDNA-targeted shRNA, SEQ ID 12. XX [repeated data is truncated] XX OS Homo sapiens. XX CC PN WO2015089074-A1. XX [repeated data is truncated] XX CC PS Claim 1; SEQ ID NO 12; 55pp; English. XX [repeated data is truncated] XX SQ Sequence 20 BP; 3 A; 5 C; 5 G; 7 T; 0 U; 0 Other; Query Match 95.2%; Score 20; Length 20; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 2 ATTCCTGACTGGCTTCAGGT 21 Claimed SEQ ID NO 4 |||||||||||||||||||| Db 1 ATTCCTGACTGGCTTCAGGT 20 WO074 SEQ ID NOs 9 and 12 Therefore WO074 discloses SEQ ID NOs identical to claimed SEQ ID NOs 2 and 3 and at least 80% identical to claimed SEQ ID NO 4. Those are limitations recited in Claims 1-4, 6, and 8. Regarding Claims 6, 26-27: WO074 teaches (¶15) some embodiments wherein two or more of the nucleic acids comprising SEQ ID NOs 4-6 and 12 are present in the same vector and are regulated by the same regulatory sequence. Those are limitations of Claims 6 and 26-27. Regarding Claims 15-16, 20, 23, 29, 31-32: Regarding the vectors, WO074 teaches (¶13) the vector encoding the nucleic acids can be a viral or nonviral vector and can be a lentiviral vector. WO074 teaches (¶18) an AAV9 vector. A vector is a kind of nucleic acid construct. Regarding the promoters, tissue-specific promoters, and cardiac troponin T promoter, WO074 teaches (¶14) expression of the nucleic acid can be regulated by a tissue- or cell-specific promoter, including a cTNT promoter. Therefore WO074 teaches limitations of Claims 15-16, 20, 23, 29, 31-32. Regarding Claim 34, WO074 teaches (¶83) a vector that comprises a polyadenylation signal. Evidence from Wikipedia demonstrates that (§Mechanism ¶1-2, bulleted list) a polyA signal is a post-transcriptional regulatory element. Therefore WO074 teaches limitations of Claim 34. Regarding Claim 38, WO074 teaches (¶76-78) administering shRNA to a subject including a mammalian subject. Therefore WO074 teaches limitations of Claim 38. In addition, WO117, drawn to Hippo pathway deficiency reversing systolic heart failure post-infarction, teaches (¶12) shRNA that targets SAV1. Regarding a sequence that is or comprises exactly claimed SEQ ID NO 4 (i.e., Claim 28): WO117 teaches (¶18, Fig. 4i) an AAV9 construct comprising three SAV1-targeting shRNAs. One of those sequences is a 22-mer that comprises claimed SEQ ID NO 4; note that WO117 does not provide a SEQ ID NO for that sequence. An annotated Fig. 4i is shown here to indicate the sequence, and an alignment to claimed SEQ ID NO 4 is shown after that: PNG media_image1.png 479 631 media_image1.png Greyscale BGD27434 ID BGD27434 standard; DNA; 22 BP. XX AC BGD27434; XX DT 02-MAY-2019 (first entry) XX DE Mouse SAV1 targeting shRNA sense stand # 3. XX KW Protein salvador homolog 1; RNA interference; SAV; SAV1 gene; Salv; WW45; KW WWp4; cardiant; cardiovascular disease; diabetic cardiomyopathy; KW diagnostic test; duchenne dystrophy; fibrosis; gene silencing; KW heart disease; ischemia; myocardial disease; myocardial infarction; KW necrosis; prophylactic to disease; KW salvador family WW domain containing protein 1 gene; salvador homolog 1; KW short hairpin RNA; ss; therapeutic. XX OS Mus sp. XX CC PN WO2019051117-A1. XX CC PD 14-MAR-2019. XX CC PF 06-SEP-2018; 2018WO-US049792. XX PR 06-SEP-2017; 2017US-0554627P. XX CC PA (BAYU ) BAYLOR COLLEGE MEDICINE. XX CC PI Martin JF, Leach J; XX DR WPI; 2019-242265/22. XX CC PT Treating an individual for a cardiac condition, such as cardiovascular CC PT disease, cardiomyopathy and heart failure, involves providing an CC PT effective amount of a Park2 nucleic acid composition and/or Park2 CC PT polypeptide composition to individual. XX CC PS Example 1; Fig 4i; 123pp; English. XX CC The invention relates to a novel method and composition, used for CC treating an individual for a cardiac condition. The cardiac condition in CC the individual causes the individual to be in need of cardiomyocyte CC renewal, and the heart of the individual may have cardiomyocyte CC apoptosis, necrosis, and/or autophagy. The composition is used for CC preventing or diagnosed as having a cardiac condition such as CC cardiovascular disease, cardiomyopathy, heart failure, myocardial CC infarction, ischemia, fibrosis, or diabetic cardiomyopathy, age-related CC cardiomyopathy, and individual has Duchenne muscular dystrophy. The CC composition may be provided to the individual systemically, locally CC (including to the heart), or both. The method enables to treat an CC individual for a cardiac condition, which reduces severity or delays CC onset of one or more cardiac conditions in a mammal. The present sequence CC represents a mouse salvador homolog 1 (SAV1/Salv/SAV/WW45/WWP4/salvador CC family WW domain containing protein 1) targeting shRNA, used in the CC composition for treating an individual for a cardiac condition. Note: CC This sequence is described in the specification as a shRNA but is shown CC as a DNA sequence. XX SQ Sequence 22 BP; 4 A; 6 C; 5 G; 7 T; 0 U; 0 Other; Query Match 100.0%; Score 21; Length 22; Best Local Similarity 100.0%; Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AATTCCTGACTGGCTTCAGGT 21 Claimed SEQ ID NO 4 ||||||||||||||||||||| Db 2 AATTCCTGACTGGCTTCAGGT 22 WO117 SAV1-targeting shRNA sequence (Fig. 4i) That alignment indicates that the WO117 sequence (which will be referred to “SEQ ID NO 4i”) has 100% identity to—and therefore has—the sequence set forth in claimed SEQ ID NO 4. Furthermore, WO117 teaches (¶136) the RNA duplex of their invention can comprise two complementary single-stranded RNAs that can be various lengths including 20-, 21-, or 22-mer. Therefore WO117 teaches some limitations of Claim 28. Regarding limitations of Claim 30, WO117 teaches (¶175, Fig. 4i) an AAV9 comprising a triple shRNA construct with flanking miR30 sequences. That indicates (and Fig. 4i shows) the construct comprises sequences encoding a 5’ miR-30 sequence and a 3’ miR-30 sequence. Those are limitations of Claim 30. Regarding Claim 35 (i.e., the WPRE element), WO117 Fig. 4i (above) shows including that element in the nucleic acid construct. Furthermore, Wikipedia, drawn to a description of the WPRE, teaches that the WPRE creates a tertiary structure that enhances expression and that a WPRE is commonly used in molecular biology to increase expression of genes delivered by viral vectors. Therefore, in view of Plouffe, He, and Choi’s teachings about SAV1 negatively regulating YAP in the Hippo pathway; Lee and Zhou’s teachings about SAV1 downregulation resulting in YAP upregulation; Watt and Watt 2015’s teachings about increasing YAP to increase muscle regeneration and satellite cell proliferation; and He’s teachings about upregulating YAP to regulate angiogenesis (including to treat limb ischemia), it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to use WO074 and WO113’s methods of inhibiting SAV1 using SAV1-targeting shRNAs comprising WO074 SEQ ID NOs 4 and 5 and WO117 SEQ ID NO 4i. One would have used those teachings and methods of Watt, Watt 2015, WO074, and WO117 (including intramuscular injection of nucleic acid constructs encoding the shRNAs comprising specific SEQ ID NOs) to inhibit SAV1 and thereby increase YAP for the benefits of increasing YAP to increase angiogenesis in skeletal muscle suffering from limb ischemia and thereby treat the condition, regenerate muscle cells in aged skeletal muscle, and enhance satellite cell proliferation. One would have been motivated to do so with a reasonable expectation of success because the teachings of Plouffe (Fig. 1), He (Fig. 1), Choi (§Abstract, Fig. 2), Lee (§Abstract), Zhou (§ROLE OF YAP IN MOUSE CARDIOVASCULAR DEVELOPMENT) indicate that downregulating SAV1 upregulates YAP; because Watt and Watt 2015 indicate YAP (Watt 2015 §YAP promotes hypertrophy via TEAD transcription factors) promotes hypertrophy, (Watt §Yap and Taz expression in skeletal muscle ¶1) supports muscle regeneration, (Watt §The functional role of Yap and Taz during satellite cell activation ¶1) enhances satellite cell proliferative dynamics and suggest (Watt §Yap and Taz expression in skeletal muscle ¶1) increasing YAP could treat sarcopenia; because He and Choi teach YAP is necessary for angiogenesis and He suggests (§Hippo/YAP pathway and angiogenesis) upregulating YAP to increase angiogenesis and treat ischemic disease; and because WO074 and WO117 teach methods and shRNA constructs for inhibiting SAV1. In addition, Watt 2015 indicates it is routine and conventional to administer shRNA to skeletal muscle. It would have been a simple matter to deliver to skeletal muscle by known methods the shRNAs disclosed in WO074 and WO117 to inhibit SAV1. It would have been obvious to use any or all of the SAV1-targeting shRNAs of WO074 and WO117 because the references teach only a handful of shRNAs and using any of them would have been obvious. It would have been obvious to encode any number of those shRNAs on a single nucleic acid construct under the control of any promoter because WO074 teaches doing so and an artisan would have wanted to maximize shRNA expression. It would have been obvious to encode the shRNAs on the AAV9 shown in WO117 Fig. 4i because WO117 teaches (¶175) AAV9 is muscle-tropic. Then, an artisan would have expected the shRNA or shRNAs to be expressed in the muscle cells. Therefore the limitations of Claims 1-4, 6, 8-9, 11, 15-16, 20, 23, 26-32, 34, 38-39, and 42 would have been obvious in view of Plouffe, He, Choi, Lee, Zhou, Watt, Watt 2015, WO074, and WO117. It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the AAV comprising SEQ ID NOs 2, 3, and/or 4 of Plouffe, He, Choi, Lee, Zhou, Watt, Watt 2015, WO074, and WO117 with the WPRE of WO117 and Wikipedia for the benefit of increasing expression of genes delivered by viral vectors. One would have been motivated to do so with a reasonable expectation of success because WO117 shows (Fig. 4i) a nucleic acid construct comprising a WPRE and Wikipedia teaches using a WPRE to enhance expression is commonly used in the art of molecular biology. Therefore the limitations of Claims 1-4, 6, 8-9, 11, 15-16, 20, 23, 26-32, 34-35, 38-39, and 42 would have been obvious in view of Plouffe, He, Choi, Lee, Zhou, Watt, Watt 2015, WO074, WO117 and Wikipedia. Claim(s) 1-4, 6, 8-9, 11, 15-16, 20, 23, 26-32, 34-36, 38-39, and 42 are rejected under 35 U.S.C. 103 as being unpatentable over Plouffe, He, Choi, Lee, Zhou, Watt, Watt 2015, WO074, WO117, and Wikipedia as applied to Claims 1-4, 6, 8-9, 11, 15-16, 20, 23, 36-32, 34-35, 38-39, and 42 in the 103 rejection above, and further in view of US Patent Application Publication No. US 2020/0148745 (published 14 May 2020, “App745”). The teachings of Plouffe, He, Choi, Lee, Zhou, Watt, Watt 2015, WO074, WO117, and Wikipedia as applicable to Claim(s) 1-4, 6, 8-9, 11, 15-16, 20, 23, 36-32, 34, 38-39, and 42 have been described above. Plouffe, He, Choi, Lee, Zhou, Watt, Watt 2015, WO074, WO117, and Wikipedia make obvious methods of increasing angiogenesis in skeletal muscle, the method comprising delivering to skeletal muscle cells an effective amount of a composition comprising at a nucleic acid construct comprising nucleic acids having the nt sequence of SEQ ID NO 2, SEQ ID NO 3, and SEQ ID NO 4; wherein the nucleic acids are operably linked to a promoter, wherein the nucleic acid construct is comprised in an AAV, and wherein the AAV comprises a post-transcriptional regulatory element. Plouffe, He, Choi, Lee, Zhou, Watt, Watt 2015, WO074, WO117, and Wikipedia do not teach the AAV comprises 5’ and 3’ inverted terminal repeat sequences (ITRs). Regarding Claim 36: However, App475, drawn to AAV vectors, teaches (¶99) functional flanking ITRs are necessary for rescue, replication, and packaging of an AAV virion, and an AAV vector is defined to include those sequences. Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the AAV comprising SEQ ID NOs 2, 3, and/or 4 of Plouffe, He, Choi, Lee, Zhou, Watt, Watt 2015, WO074, and WO117 with the flanking ITRs of App475 for the benefit of packaging an AAV virion. One would have been motivated to do so with a reasonable expectation of success because the teachings of App475 indicate that it was routine and conventional to include such flanking ITRs in any AAV vector. Note that a person of ordinary skill would understand that “flanking ITRs” are 5’ and 3’ ITRs. Therefore the limitations of Claim 36 would have been obvious in view of Plouffe, He, Choi, Lee, Zhou, Watt, Watt 2015, WO074, WO117, Wikipedia, and App475. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-4, 6, 8-9, 11, 15-16, 20, 23, 26-32, 34-36, 38-39, and 42 are rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims of the following U.S. Patents in view of Plouffe (et al. 2015. Disease implications of the Hippo/YAP pathway. Trends Molec. Med. 21[4]:212-222, “Plouffe”), He (et al. 2017. The role of Hippo/yes-associated protein signalling in vascular remodelling associated with cardiovascular disease. Brit. J. Pharmacol. 175:1354-1361, “He”), Choi (et al. 2015. Yes-associated protein regulates endothelial cell contact-mediated expression of angiopoietin-2. Nat. Comm. 6:6943, “Choi”), Lee (et al. 2010. The Hippo–Salvador pathway restrains hepatic oval cell proliferation, liver size, and liver tumorigenesis. PNAS 107[8]:8249-8253, “Lee”), Zhou (2014. An emerging role for Hippo-YAP signaling in cardiovascular development. J. Biomed. Res. 28[4]:251-254, “Zhou”), Watt (et al. April 2019. Author manuscript of The Hippo Signaling Pathway in the Regulation of Skeletal Muscle Mass and Function. Exerc. Sport Sci. Rev. 46[2]:92-96, “Watt”, published version of record on IDS), Watt (et al. 2015. The Hippo pathway effector YAP is a critical regulator of skeletal muscle fibre size. Nat. Comm. 6:6048, “Watt 2015”), International Publication Number WO 2015/089074 (published 18 June 2015, “WO074” of record on IDS) as evidenced by Wikipedia (“Post transcriptional regulation”. page archived 25 October 2020. Available at Wikipedia.org. Accessed on 11 March 2026, “Wikipedia”), and International Publication Number WO 2019/051117 (published 14 March 2019, “WO117”, of record on IDS), Wikipedia ("WHP Posttransciptional Response Element". page archived 09 March 2018. Available at Wikipedia.org. Accessed on 11 March 2026, “Wikipedia”), and US Patent Application Publication No. US 2020/0148745 (published 14 May 2020, “App745”). US Patent Abbreviation Claims US 9,732,345 US345 1-24 US 10,119,141 US141 1-17 US 11,459,565 US565 1-19 US 11,981,895 US895 1-21 US 12,480,120 US120 1-18 The instant claims are directed to methods of increasing angiogenesis, regenerating myofibers, inducing proliferation of satellite cells, and treating limb ischemia in skeletal muscle, the method comprising delivering to skeletal muscle cells an effective amount of a composition comprising at a nucleic acid construct comprising nucleic acids having the nt sequences of any or all of SEQ ID NO 2, SEQ ID NO 3, and/or SEQ ID NO 4 or 80% identity to them; wherein the nucleic acids are operably linked to a promoter (including a single promoter regulating all three) that can be a tissue-specific promoter including a cardiac troponin T promoter, wherein the inhibitor nucleic acid can be shRNA, wherein the nucleotide sequence(s) can be comprised in a vector or in a nucleic acid construct, wherein the nucleic acid construct can comprise sequences encoding 3’ and 5’ miR-30 sequences and/or the construct can be comprised in a viral vector that can be an AAV or lentivirus, and wherein the AAV can comprise 5’ and 3’ ITR or a post-transcriptional regulatory element that can be WPRE. The instant claims also recite the method wherein the composition is administered to a mammalian subject, wherein the skeletal muscle is ischemic, atrophied, or has suffered a traumatic injury, or where when the mammalian subject has a condition that can be limb ischemia, PVD, or sarcopenia. The patented claims are directed to (US345, US565) methods of treating an individual in need of treatment for a cardiac condition, comprising providing synthetic nucleic acids comprising specific SEQ ID NOs or nucleic acids comprising at least 80% identity to certain SEQ ID NOs, wherein the nucleic acid can be in a vector and can be regulated by a cTNT promoter, wherein two or more of the SEQ ID NOs can be on the same vector and can be regulated by the same regulatory sequence; and (US141, US565, US895, US120) isolated synthetic nucleic acid compositions comprising specific SEQ ID NOs or nucleic acids comprising at least 80% identity to certain SEQ ID NOs, wherein the nucleic acid can be in a vector and can be regulated by a cTNT promoter, wherein two or more of the SEQ ID NOs can be on the same vector and can be regulated by the same regulatory sequence. The following shows select sequence alignments demonstrating that the patented SEQ ID NOs are identical to the instantly claimed SEQ ID NOs. Note that SEQ ID NOs 10, 11, and 12 are identical across the issued patents. Only one alignment is shown per instantly claimed SEQ ID NO. Note that the alignment results below show the issued patent for Application No. 15/102593 is US9708613 whereas the actual issue number is US9732345. RESULT 1 US-15-102-593-10 (NOTE: this sequence has 17 duplicates in the database searched. See complete list at the end of this report) Sequence 10, US/15102593 Patent No. 9708613 GENERAL INFORMATION APPLICANT: Martin, James F. APPLICANT: Yuka, Morikawa APPLICANT: Todd, Heallen Ryan APPLICANT: Leach, John TITLE OF INVENTION: HIPPO AND DYSTROPHIN COMPLEX SIGNALING IN CARDIOMYOCYTE RENEWAL FILE REFERENCE: BAYM.P0129US CURRENT APPLICATION NUMBER: US/15/102,593 CURRENT FILING DATE: 2016-06-08 PRIOR APPLICATION NUMBER: PCT/US2014/069349 PRIOR FILING DATE: 2014-12-09 PRIOR APPLICATION NUMBER: 61/913,715 PRIOR FILING DATE: 2013-12-09 NUMBER OF SEQ ID NOS: 12 SEQ ID NO 10 LENGTH: 21 TYPE: DNA ORGANISM: Homo sapiens Query Match 100.0%; Score 21; Length 21; Best Local Similarity 100.0%; Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AAGTACGTGAAGAAGGAGACG 21 claimed SEQ ID NO 2 ||||||||||||||||||||| Db 1 AAGTACGTGAAGAAGGAGACG 21 RESULT 1 US-15-102-593-11 (NOTE: this sequence has 17 duplicates in the database searched. See complete list at the end of this report) Sequence 11, US/15102593 Patent No. 9708613 GENERAL INFORMATION APPLICANT: Martin, James F. APPLICANT: Yuka, Morikawa APPLICANT: Todd, Heallen Ryan APPLICANT: Leach, John TITLE OF INVENTION: HIPPO AND DYSTROPHIN COMPLEX SIGNALING IN CARDIOMYOCYTE RENEWAL FILE REFERENCE: BAYM.P0129US CURRENT APPLICATION NUMBER: US/15/102,593 CURRENT FILING DATE: 2016-06-08 PRIOR APPLICATION NUMBER: PCT/US2014/069349 PRIOR FILING DATE: 2014-12-09 PRIOR APPLICATION NUMBER: 61/913,715 PRIOR FILING DATE: 2013-12-09 NUMBER OF SEQ ID NOS: 12 SEQ ID NO 11 LENGTH: 21 TYPE: DNA ORGANISM: Homo sapiens Query Match 100.0%; Score 21; Length 21; Best Local Similarity 100.0%; Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AAGATTTACCCCTTCCTCCTG 21 claimed SEQ ID NO 3 ||||||||||||||||||||| Db 1 AAGATTTACCCCTTCCTCCTG 21 RESULT 25 US-15-102-593-12 (NOTE: this sequence has 17 duplicates in the database searched. See complete list at the end of this report) Sequence 12, US/15102593 Patent No. 9708613 GENERAL INFORMATION APPLICANT: Martin, James F. APPLICANT: Yuka, Morikawa APPLICANT: Todd, Heallen Ryan APPLICANT: Leach, John TITLE OF INVENTION: HIPPO AND DYSTROPHIN COMPLEX SIGNALING IN CARDIOMYOCYTE RENEWAL FILE REFERENCE: BAYM.P0129US CURRENT APPLICATION NUMBER: US/15/102,593 CURRENT FILING DATE: 2016-06-08 PRIOR APPLICATION NUMBER: PCT/US2014/069349 PRIOR FILING DATE: 2014-12-09 PRIOR APPLICATION NUMBER: 61/913,715 PRIOR FILING DATE: 2013-12-09 NUMBER OF SEQ ID NOS: 12 SEQ ID NO 12 LENGTH: 20 TYPE: DNA ORGANISM: Homo sapiens Query Match 95.2%; Score 20; Length 20; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 2 ATTCCTGACTGGCTTCAGGT 21 claimed SEQ ID NO 4 |||||||||||||||||||| Db 1 ATTCCTGACTGGCTTCAGGT 20 All claim sets are directed to methods or compositions comprising the exact same SEQ ID NOs. The issued claims do not recite using the SEQ ID NOs to treat skeletal muscle-related conditions; however, using the patented SEQ ID NOs to treat those conditions would have been obvious in view of the prior art of Plouffe (§Abstract, Fig. 1; §The Hippo pathway in intestinal regeneration, §The Hippo pathway in cardiomyocyte regeneration), He (§Introduction ¶2, §Components of the Hippo/YAP pathway, Fig. 1; §Hippo/YAP pathway and angiogenesis), Choi (§Abstract, Fig. 2), Lee (§Abstract), Zhou (§ROLE OF YAP IN MOUSE CARDIOVASCULAR DEVELOPMENT), Watt (§The Hippo signaling pathway, Fig. 1, §Introduction ¶1, §Yap and Taz expression in skeletal muscle, §The functional role of Yap and Taz during satellite cell activation, §Yap and Taz promote muscle growth via Tead in Post-natal muscle fibers), Watt 2015 (§Abstract, §YAP is required to maintain basal skeletal myofibre size, §YAP promotes hypertrophy via TEAD transcription factors, Figs. 1a and 3a), WO074 (¶8, ¶51, ¶9, ¶10-12, ¶15, ¶13, ¶18, ¶14, ¶83, ¶76-78), WO117 (¶12, ¶18, Fig. 4i, ¶136, ¶175, Fig. 4i), Wikipedia, and App745 (¶99) for the benefits of increasing angiogenesis, regenerating myofibers, inducing proliferation of satellite cells, and treating limb ischemia in skeletal muscle, as taught in the prior art. One would have been motivated to do so with a reasonable expectation of success because the cited prior art teaches that increasing YAP induces the outcomes of increasing angiogenesis, regenerating myofibers, inducing proliferation of satellite cells, and treating limb ischemia in skeletal muscle, and also teaches that it is possible to increase YAP by inhibiting a Hippo pathway component upstream of YAP, namely SAV1. The cited prior art also teaches benefits of including the various elements (e.g., the WPRE element increases gene expression). Therefore it would have been obvious to use the patented SEQ ID NOs to inhibit SAV1, thereby increasing YAP and inducing the outcomes of increasing angiogenesis, regenerating myofibers, inducing proliferation of satellite cells, and treating limb ischemia in skeletal muscle. Therefore the instant claims would have been obvious in view of the patented claims and the cited prior art. In addition, it would not be possible to use the instant claims without the compositions of the patented claims. Claims 1-4, 6, 8-9, 11, 15-16, 20, 23, 26-32, 34-36, 38-39, and 42 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-9 of U.S. Patent No. US 11,944,671 (“US671”) in view of Plouffe, He, Choi, Lee, Zhou, Watt, Watt 2015, WO074, WO117, Wikipedia, App745, and Leduc-Gaudet (et al. April 2019. Parkin overexpression protects from ageing-related loss of muscle mass and strength. J. Physiol. 597.7:1975–1991, “Leduc-Gaudet”). The instant claims are directed to methods of increasing angiogenesis, regenerating myofibers, inducing proliferation of satellite cells, and treating limb ischemia in skeletal muscle, the method comprising delivering to skeletal muscle cells an effective amount of a composition comprising at a nucleic acid construct comprising nucleic acids having the nt sequences of any or all of SEQ ID NO 2, SEQ ID NO 3, and/or SEQ ID NO 4 or 80% identity to them; wherein the nucleic acids are operably linked to a promoter (including a single promoter regulating all three) that can be a tissue-specific promoter including a cardiac troponin T promoter, wherein the inhibitor nucleic acid can be shRNA, wherein the nucleotide sequence(s) can be comprised in a vector or in a nucleic acid construct, wherein the nucleic acid construct can comprise sequences encoding 3’ and 5’ miR-30 sequences and/or the construct can be comprised in a viral vector that can be an AAV or lentivirus, and wherein the AAV can comprise 5’ and 3’ ITR or a post-transcriptional regulatory element that can be WPRE. The instant claims also recite the method wherein the composition is administered to a mammalian subject, wherein the skeletal muscle is ischemic, atrophied, or has suffered a traumatic injury, or where when the mammalian subject has a condition that can be limb ischemia, PVD, or sarcopenia. The patented claims are directed to methods of treating an individual for heart failure, the method comprising administering to the individual an effective amount of a Park2 nucleic acid and an shRNA that targets SAV1, wherein the shRNA comprises a sequence selected from the group consisting of SEQ ID NO 27, 28, and 29. The following shows select sequence alignments demonstrating that the patented SEQ ID NOs are identical to the instantly claimed SEQ ID NOs: US-16-644-435-27 Filing date in PALM: 2020-03-04 Sequence 27, US/16644435 Patent No. 11944671 GENERAL INFORMATION APPLICANT: BAYLOR COLLEGE OF MEDICINE TITLE OF INVENTION: HIPPO PATHWAY DEFICIENCY REVERSES SYSTOLIC HEART FAILURE TITLE OF INVENTION: POST-INFARCTION FILE REFERENCE: BAYM.P0240US-1001116313 CURRENT APPLICATION NUMBER: US/16/644,435 CURRENT FILING DATE: 2020-03-04 PRIOR APPLICATION NUMBER: PCT/US2018/049792 PRIOR FILING DATE: 2018-09-06 PRIOR APPLICATION NUMBER: 62/554,627 PRIOR FILING DATE: 2017-09-06 NUMBER OF SEQ ID NOS: 38 SEQ ID NO 27 LENGTH: 21 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic Oligonucleotide Query Match 100.0%; Score 21; Length 21; Best Local Similarity 100.0%; Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AAGTACGTGAAGAAGGAGACG 21 claimed SEQ ID NO 2 ||||||||||||||||||||| Db 1 AAGTACGTGAAGAAGGAGACG 21 US-16-644-435-28 Filing date in PALM: 2020-03-04 Sequence 28, US/16644435 Patent No. 11944671 GENERAL INFORMATION APPLICANT: BAYLOR COLLEGE OF MEDICINE TITLE OF INVENTION: HIPPO PATHWAY DEFICIENCY REVERSES SYSTOLIC HEART FAILURE TITLE OF INVENTION: POST-INFARCTION FILE REFERENCE: BAYM.P0240US-1001116313 CURRENT APPLICATION NUMBER: US/16/644,435 CURRENT FILING DATE: 2020-03-04 PRIOR APPLICATION NUMBER: PCT/US2018/049792 PRIOR FILING DATE: 2018-09-06 PRIOR APPLICATION NUMBER: 62/554,627 PRIOR FILING DATE: 2017-09-06 NUMBER OF SEQ ID NOS: 38 SEQ ID NO 28 LENGTH: 21 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide Qy 1 AAGATTTACCCCTTCCTCCTG 21 claimed SEQ ID NO 3 ||||||||||||||||||||| Db 1 AAGATTTACCCCTTCCTCCTG 21 US-16-644-435-29 Filing date in PALM: 2020-03-04 Sequence 29, US/16644435 Patent No. 11944671 GENERAL INFORMATION APPLICANT: BAYLOR COLLEGE OF MEDICINE TITLE OF INVENTION: HIPPO PATHWAY DEFICIENCY REVERSES SYSTOLIC HEART FAILURE TITLE OF INVENTION: POST-INFARCTION FILE REFERENCE: BAYM.P0240US-1001116313 CURRENT APPLICATION NUMBER: US/16/644,435 CURRENT FILING DATE: 2020-03-04 PRIOR APPLICATION NUMBER: PCT/US2018/049792 PRIOR FILING DATE: 2018-09-06 PRIOR APPLICATION NUMBER: 62/554,627 PRIOR FILING DATE: 2017-09-06 NUMBER OF SEQ ID NOS: 38 SEQ ID NO 29 LENGTH: 20 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic Oligonucleotide Qy 2 ATTCCTGACTGGCTTCAGGT 21 claimed SEQ ID NO 4 |||||||||||||||||||| Db 1 ATTCCTGACTGGCTTCAGGT 20 Both claim sets are directed to methods or compositions comprising the exact same SEQ ID NOs. The issued claims do not recite using the SEQ ID NOs to treat skeletal muscle-related conditions; however, using the patented methods and SEQ ID NOs to treat those conditions would have been obvious in view of the prior art of Plouffe (§Abstract, Fig. 1; §The Hippo pathway in intestinal regeneration, §The Hippo pathway in cardiomyocyte regeneration), He (§Introduction ¶2, §Components of the Hippo/YAP pathway, Fig. 1; §Hippo/YAP pathway and angiogenesis), Choi (§Abstract, Fig. 2), Lee (§Abstract), Zhou (§ROLE OF YAP IN MOUSE CARDIOVASCULAR DEVELOPMENT), Watt (§The Hippo signaling pathway, Fig. 1, §Introduction ¶1, §Yap and Taz expression in skeletal muscle, §The functional role of Yap and Taz during satellite cell activation, §Yap and Taz promote muscle growth via Tead in Post-natal muscle fibers), Watt 2015 (§Abstract, §YAP is required to maintain basal skeletal myofibre size, §YAP promotes hypertrophy via TEAD transcription factors, Figs. 1a and 3a), WO074 (¶8, ¶51, ¶9, ¶10-12, ¶15, ¶13, ¶18, ¶14, ¶83, ¶76-78), WO117 (¶12, ¶18, Fig. 4i, ¶136, ¶175, Fig. 4i), Wikipedia, and App745 (¶99). In addition, WO117 teaches (¶27) Park2 is necessary for cardiac muscle regeneration and Leduc-Gaudet teaches (§Abstract) overexpressing PARK2 (called by its protein name, Parkin in the reference) increases muscle mass and fiber size. One would have used the patented methods in view of the teachings of the cited prior art for the benefits of increasing angiogenesis, regenerating myofibers, inducing proliferation of satellite cells, and treating limb ischemia in skeletal muscle, as taught in the prior art. One would have been motivated to do so with a reasonable expectation of success because the cited prior art teaches that increasing YAP induces the outcomes of increasing angiogenesis, regenerating myofibers, inducing proliferation of satellite cells, and treating limb ischemia in skeletal muscle, and also teaches that it is possible to increase YAP by inhibiting a Hippo pathway component upstream of YAP, namely SAV1. The cited prior art also teaches benefits of including the various elements (e.g., the WPRE element increases gene expression) and (Leduc-Gaudet) expressing PARK2 in muscles. Therefore it would have been obvious to use the patented methods and SEQ ID NOs to inhibit SAV1, thereby increasing YAP and inducing the outcomes of increasing angiogenesis, regenerating myofibers, inducing proliferation of satellite cells, and treating limb ischemia in skeletal muscle. Therefore the instant claims would have been obvious in view of the patented claims and the cited prior art. In addition, it would not be possible to use the instant claims without the compositions of the patented claims. Claims 1-4, 6, 8-9, 11, 15-16, 20, 23, 26-32, 34-36, 38-39, and 42 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 5, 7-8, 14-15, 17, 19, 25-27, 29, 30, 33, 35, 43-44 of copending Application No. 18/876035 (“App035”) in view of Plouffe, He, Choi, Lee, Zhou, Watt, Watt 2015, WO074, WO117, and Wikipedia. The instant claims are directed to methods of increasing angiogenesis, regenerating myofibers, inducing proliferation of satellite cells, and treating limb ischemia in skeletal muscle, the method comprising delivering to skeletal muscle cells an effective amount of a composition comprising at a nucleic acid construct comprising nucleic acids having the nt sequences of any or all of SEQ ID NO 2, SEQ ID NO 3, and/or SEQ ID NO 4 or 80% identity to them; wherein the nucleic acids are operably linked to a promoter (including a single promoter regulating all three) that can be a tissue-specific promoter including a cardiac troponin T promoter, wherein the inhibitor nucleic acid can be shRNA, wherein the nucleotide sequence(s) can be comprised in a vector or in a nucleic acid construct, wherein the nucleic acid construct can comprise sequences encoding 3’ and 5’ miR-30 sequences and/or the construct can be comprised in a viral vector that can be an AAV or lentivirus, and wherein the AAV can comprise 5’ and 3’ ITR or a post-transcriptional regulatory element that can be WPRE. The instant claims also recite the method wherein the composition is administered to a mammalian subject, wherein the skeletal muscle is ischemic, atrophied, or has suffered a traumatic injury, or where when the mammalian subject has a condition that can be limb ischemia, PVD, or sarcopenia. The copending App035 claims are directed to methods of improving systolic function, reducing arrhythmia, promoting capillary formation, and treating/preventing/reducing risk of arrhythmia in a human patient, the method comprising delivering to heart tissue an effective amount of a composition comprising at a nucleic acid construct comprising nucleic acids having the nt sequences of any or all of SEQ ID NO 2, SEQ ID NO 3, and/or SEQ ID NO 4 or 80% identity to them; wherein the nucleic acids are operably linked to a promoter (including a single promoter regulating all three) that can be a tissue-specific promoter, wherein the inhibitor nucleic acid can be shRNA, wherein the nucleotide sequence(s) can be comprised in a vector or in a nucleic acid construct, wherein the nucleic acid construct can comprise sequences encoding 3’ and 5’ miR-30 sequences and/or the construct can be comprised in a viral vector that can be an AAV or lentivirus, and wherein the AAV can comprise 5’ and 3’ ITR or a post-transcriptional regulatory element. The copending claims also recite the method wherein the composition is administered to a human subject who has experienced or is at risk for myocardial infarction. The following shows select sequence alignments demonstrating that the copending SEQ ID NOs are identical to the instantly claimed SEQ ID NOs: US-18-876-035-2 Filing date in PALM: 2024-12-17 Sequence 2, US/18876035 Publication No. US20250283080A1 GENERAL INFORMATION APPLICANT: Baylor College of Medicine (en) TITLE OF INVENTION: GENE THERAPY OF HIPPO SIGNALING IMPROVES HEART FUNCTION IN A CLINICALLY RELEVANT MODEL (en) FILE REFERENCE: BAYM.P0372WO CURRENT APPLICATION NUMBER: US/18/876,035 CURRENT FILING DATE: 2024-12-17 NUMBER OF SEQ ID NOS: 4 SEQ ID NO 2 LENGTH: 21 TYPE: DNA FEATURE: NAME/KEY: source LOCATION: 1..21 QUALIFIERS: mol_type = other DNA organism = synthetic construct Qy 1 AAGTACGTGAAGAAGGAGACG 21 claimed SEQ ID NO 2 ||||||||||||||||||||| Db 1 AAGTACGTGAAGAAGGAGACG 21 US-18-876-035-3 Filing date in PALM: 2024-12-17 Sequence 3, US/18876035 Publication No. US20250283080A1 GENERAL INFORMATION APPLICANT: Baylor College of Medicine (en) TITLE OF INVENTION: GENE THERAPY OF HIPPO SIGNALING IMPROVES HEART FUNCTION IN A CLINICALLY RELEVANT MODEL (en) FILE REFERENCE: BAYM.P0372WO CURRENT APPLICATION NUMBER: US/18/876,035 CURRENT FILING DATE: 2024-12-17 NUMBER OF SEQ ID NOS: 4 SEQ ID NO 3 LENGTH: 21 TYPE: DNA FEATURE: NAME/KEY: source LOCATION: 1..21 QUALIFIERS: mol_type = other DNA organism = synthetic construct Qy 1 AAGATTTACCCCTTCCTCCTG 21 claimed SEQ ID NO 3 ||||||||||||||||||||| Db 1 AAGATTTACCCCTTCCTCCTG 21 US-18-876-035-4 Filing date in PALM: 2024-12-17 Sequence 4, US/18876035 Publication No. US20250283080A1 GENERAL INFORMATION APPLICANT: Baylor College of Medicine (en) TITLE OF INVENTION: GENE THERAPY OF HIPPO SIGNALING IMPROVES HEART FUNCTION IN A CLINICALLY RELEVANT MODEL (en) FILE REFERENCE: BAYM.P0372WO CURRENT APPLICATION NUMBER: US/18/876,035 CURRENT FILING DATE: 2024-12-17 NUMBER OF SEQ ID NOS: 4 SEQ ID NO 4 LENGTH: 21 TYPE: DNA FEATURE: NAME/KEY: source LOCATION: 1..21 QUALIFIERS: mol_type = other DNA organism = synthetic construct Qy 2 ATTCCTGACTGGCTTCAGGT 21 claimed SEQ ID NO 4 |||||||||||||||||||| Db 1 ATTCCTGACTGGCTTCAGGT 20 Both claim sets are directed to methods comprising the exact same SEQ ID NOs. The copending claims do not recite using the SEQ ID NOs to treat skeletal muscle-related conditions; however, using the patented methods and SEQ ID NOs to treat those conditions would have been obvious in view of the prior art of Plouffe (§Abstract, Fig. 1; §The Hippo pathway in intestinal regeneration, §The Hippo pathway in cardiomyocyte regeneration), He (§Introduction ¶2, §Components of the Hippo/YAP pathway, Fig. 1; §Hippo/YAP pathway and angiogenesis), Choi (§Abstract, Fig. 2), Lee (§Abstract), Zhou (§ROLE OF YAP IN MOUSE CARDIOVASCULAR DEVELOPMENT), Watt (§The Hippo signaling pathway, Fig. 1, §Introduction ¶1, §Yap and Taz expression in skeletal muscle, §The functional role of Yap and Taz during satellite cell activation, §Yap and Taz promote muscle growth via Tead in Post-natal muscle fibers), Watt 2015 (§Abstract, §YAP is required to maintain basal skeletal myofibre size, §YAP promotes hypertrophy via TEAD transcription factors, Figs. 1a and 3a), WO074 (¶8, ¶51, ¶9, ¶10-12, ¶15, ¶13, ¶18, ¶14, ¶83, ¶76-78), WO117 (¶12, ¶18, Fig. 4i, ¶136, ¶175, Fig. 4i), and Wikipedia. One would have used the copending methods in view of the teachings of the cited prior art for the benefits of increasing angiogenesis, regenerating myofibers, inducing proliferation of satellite cells, and treating limb ischemia in skeletal muscle, as taught in the prior art. One would have been motivated to do so with a reasonable expectation of success because the cited prior art teaches that increasing YAP induces the outcomes of increasing angiogenesis, regenerating myofibers, inducing proliferation of satellite cells, and treating limb ischemia in skeletal muscle, and also teaches that it is possible to increase YAP by inhibiting a Hippo pathway component upstream of YAP, namely SAV1. The cited prior art also teaches benefits of including the various elements (e.g., the WPRE element increases gene expression). Therefore it would have been obvious to use the copending methods and SEQ ID NOs to inhibit SAV1, thereby increasing YAP and inducing the outcomes of increasing angiogenesis, regenerating myofibers, inducing proliferation of satellite cells, and treating limb ischemia in skeletal muscle. Therefore the instant claims would have been obvious in view of the copending claims and the cited prior art. In addition, it would not be possible to use the instant claims without the compositions of the copending claims. This is a provisional nonstatutory double patenting rejection. Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUTHIE S ARIETI whose telephone number is (571)272-1293. The examiner can normally be reached M-Th 8:30AM-4PM, alternate Fridays 8:30AM-4PM (ET). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. RUTHIE S ARIETI Examiner (Ruth.Arieti@uspto.gov) Art Unit 1635 /RUTH SOPHIA ARIETI/Examiner, Art Unit 1635 /NANCY J LEITH/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

May 15, 2023
Application Filed
Mar 12, 2026
Non-Final Rejection — §103, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12594349
COMPOSITIONS AND METHODS FOR THE TARGETING OF PCSK9
2y 5m to grant Granted Apr 07, 2026
Patent 12584134
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Mar 24, 2026
Patent 12540324
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Feb 03, 2026
Patent 12540326
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Feb 03, 2026
Patent 12534728
RNAi Agents for Inhibiting Expression of 17beta-HSD Type 13 (HSD17B13), Compositions Thereof, and Methods of Use
2y 5m to grant Granted Jan 27, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
46%
Grant Probability
99%
With Interview (+72.7%)
2y 7m
Median Time to Grant
Low
PTA Risk
Based on 81 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month