Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on May 1, 2026 has been entered.
Detailed Action
This action is in response to the papers filed May 1, 2026 and April 2, 2026.
Amendments
Applicant's response and amendments, filed April 2, 2026, is acknowledged. Applicant has cancelled Claims 1-16, 18, 25, and 29-30, amended Claims 17 and 24.
Claims 17, 19-24, and 26-28 are pending.
Priority
This application is a continuation of application 16/489,770 filed August 29, 2019, now U.S. Patent 11,564,996, which is a 371 of PCT/US2018/020470 filed on March 1, 2018. Applicant’s claim for the benefit of a prior-filed application provisional application 62/469,642 filed on March 10, 2017 and 62/465,649 filed on March 1, 2017 under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365(c) is acknowledged.
Information Disclosure Statement
Applicant has filed an Information Disclosure Statement on May 1, 2026 that has been considered.
The signed and initialed PTO Forms 1449 are mailed with this action.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
1. The prior rejection of Claim 24 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s cancellation of “about”, which the Examiner finds persuasive.
2. The prior rejection of Claims 29-30 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s cancellation of the claims.
3. Claim 23 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 19 recites a pharmaceutical composition comprising a recombinant AAV vector and a pharmaceutically acceptable excipient.
Claim 20 recites wherein the pharmaceutically acceptable excipient is suitable for delivery to a plurality of ocular cells of a subject.
Claim 23, dependent upon Claim 20, recites wherein the subject is a human.
Claim 23 fails to further limit, at least, Claim 20, because the claim recites an intended use of the pharmaceutical composition.
Either this is an inherent property of (that naturally flows from) the pharmaceutical composition of Claim 20, or it is not, and something [structure] of Claim 23 must change.
To the extent it is an inherent property of (that naturally flows from) the product of Claim 20, then the instant claim fails to further limit Claim 20.
Furthermore, in regard to instant claims, it is noted that the “wherein the subject is a human” clause does not recite any additional structure(s), but simply states an intended use of the pharmaceutical composition.
A recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. The phrase “wherein the subject is a human” is an intended use limitation, which does not contain any further structural limitations with respect to the claimed “pharmaceutically acceptable excipient is suitable for delivery to a plurality of ocular cells of a subject” (Claim 20) (see MPEP §2114).
Therefore, the "wherein" clause is not considered to further limit the method defined by the claim and has not been given weight in construing the claims. See Texas Instruments, Inc. v. International Trade Comm., 988 F.2d 1165, 1171,26 USPQ2d 1018, 1023 (Fed Cir. 1993) ("A 'whereby' clause that merely states the result of the limitations in the claim adds nothing to the patentability or substance of the claim."). See also Minton v. National Assoc. of Securities Dealers, Inc., 336 F.3d 1373, 1381, 67 USPQ2d 1614, 1620 (Fed. Cir. 2003) ("A whereby clause in a method claim is not given weight when it simply expresses the intended result of a process step positively recited.").
'Even if such a phrase did hold patentable weight, the phrase would likely be rejected under 35 USC 112(b) for being indefinite because such a phrase would amount to a 'functional limitation' whereby one of ordinary skill in the art would essentially need to 'guess' what steps must occur in the claim, in addition to the positively-recited method steps, in order to result in 'wherein the....' (the 'intended result' phrase in the claim).
The claims fail to recite, and the specification fails to disclose, a first pharmaceutical composition comprising a recombinant AAV vector and a pharmaceutically acceptable excipient suitable for delivery to a plurality of ocular cells of a subject that is not ‘suitable for a human subject’, as opposed to a second pharmaceutical composition comprising a recombinant AAV vector and a pharmaceutically acceptable excipient suitable for delivery to a plurality of ocular cells of a subject that is also ‘suitable for a human subject’, for example.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
4. Claim 23 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 19 recites a pharmaceutical composition comprising a recombinant AAV vector and a pharmaceutically acceptable excipient.
Claim 20 recites wherein the pharmaceutically acceptable excipient is suitable for delivery to a plurality of ocular cells of a subject.
Claim 23, dependent upon Claim 20, recites wherein the subject is a human.
Claim 23 fails to further limit, at least, Claim 20, because the claim recites an intended use of the pharmaceutical composition.
Either this is an inherent property of (that naturally flows from) the pharmaceutical composition of Claim 20, or it is not, and something [structure] of Claim 23 must change.
To the extent it is not an inherent property of (that naturally flows from) the product of Claim 20, then the instant claim lacks adequate written description for failing to recite the pharmaceutically acceptable carrier or excipient that is suitable for delivery to a plurality of ocular cells of a human.
In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. The disclosure of a single species is rarely, if ever, sufficient to describe a broad genus, particularly when the specification fails to describe the features of that genus, even in passing. (see In re Shokal 113USPQ283(CCPA1957); Purdue Pharma L.P. vs Faulding Inc. 56 USPQ2nd 1481 (CAFC 2000).
The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997).
The claims fail to recite, and the specification fails to disclose, a first pharmaceutical composition comprising a recombinant AAV vector and a pharmaceutically acceptable excipient suitable for delivery to a plurality of ocular cells of a subject that is not ‘suitable for a human subject’, as opposed to a second pharmaceutical composition comprising a recombinant AAV vector and a pharmaceutically acceptable excipient suitable for delivery to a plurality of ocular cells of a subject that is also ‘suitable for a human subject’, for example.
The claims fail to recite, and the specification fails to disclose, how to transform or otherwise modify a first pharmaceutical composition comprising a recombinant AAV vector and a pharmaceutically acceptable excipient suitable for delivery to a plurality of ocular cells of a subject that is not ‘suitable for a human subject’, into a second pharmaceutical composition comprising a recombinant AAV vector and a pharmaceutically acceptable excipient suitable for delivery to a plurality of ocular cells of a subject that is now necessarily and predictably ‘suitable for a human subject’, for example.
Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function … does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is”).
Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
5. The prior rejection of Claims 17, 19-20, and 23 under AIA 35 U.S.C. 103 as being unpatentable over Neitz et al (U.S. 2012/0172419; of record) in view of Drivas et al (U.S. 2016/0185832; Applicant’s own work; of record) and Chung et al (June 2013; Applicant’s own work; of record in IDS) is withdrawn in light of Applicant’s amendment to the independent claim to recite the hybrid promoter of SEQ ID NO:10, a limitation the cited prior art do not teach/disclose, necessitating new grounds of rejection.
6. The prior rejection of Claims 17, 19-20 and 23 under AIA 35 U.S.C. 103 as being unpatentable over Acland et al (U.S. 2014/0377224; Applicant’s own work; of record) in view of Lewis et al (WO 16/019364; Applicant’s own work, published outside instant application’s grace period; of record in IDS), Chung et al (June 2013; Applicant’s own work; of record in IDS), GenBank BC050327 (Homo sapiens LCA5, complete cDNA, 2007; of record), and Neitz et al (U.S. 2012/0172419; of record) is withdrawn in light of Applicant’s amendment to the independent claim to recite the hybrid promoter of SEQ ID NO:10, a limitation the cited prior art do not teach/disclose, necessitating new grounds of rejection.
7. Claims 17, 19-20, and 23 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Neitz et al (U.S. 2012/0172419; of record) in view of Drivas et al (U.S. 2016/0185832; Applicant’s own work; of record), Chung et al (June 2013; Applicant’s own work; of record in IDS), and Bennett et al (U.S. 2014/0087444; Applicant’s own work; of record in IDS).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
With respect to Claim 17, Neitz et al is considered relevant prior art for having disclosed an rAAV virion comprising an AAV capsid (e.g. [0074], “packaging of the AAV virion, “cap from AAV…”), wherein said rAAV genome comprises a nucleic acid sequence encoding human Lebercillin (e.g. [0069], LCA5), wherein said nucleic acid sequence (SEQ ID NO:48; lower line) is at least 99.8% identical (2 mismatches) to instant SEQ ID NO:2 (upper line), as shown below:
ATGGGGGAAAGAGCAGGAAGTCCAGGTACTGACCAAGAAAGAAAGGCAGGCAAACACCAT 60
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
ATGGGGGAAAGAGCAGGAAGTCCAGGTACTGATCAAGAAAGAAAGGCAGGCAAACACCAT
MGERAGSPGTDQERKAGKHH
MGERAGSPGTDQERKAGKHH
CATCACCAAGCCCCTCGGAAACCAAGCCCCAAGGGTCTACCAAACAGAAAGGGAGTCCGA 240
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
CATCACCAAGCCCCTCGGAAACCAAGCCCTAAGGGTCTACCAAACAGAAAGGGAGTCCGA
HHQAPRKPSPKGLPNRKGVR
HHQAPRKPSPKGLPNRKGVR
As shown above, the sequences encode the identical amino acid sequences, respectively.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Those of ordinary skill in the art would reasonably interpret the 2 dispersed, mismatches to merely represent sequencing errors or stochastic mutation during cloning and replication of the LCA5 coding sequence, and that they are not material to the functionality of the thus-encoded LCA5 protein.
There is no objective evidence of record that the two, dispersed, nucleotide differences between the prior art LCA5 sequence and instant SEQ ID NO:2 are material to patentability determination.
The instant specification fails to disclose a step of intentionally manipulating the prior art-recognized LCA5 nucleic acid to comprise the instant T>C changes shown in SEQ ID NO:2.
The instant specification fails to disclose an element of criticality of the two Cytosine nucleotides, as opposed to the two Thymidine nucleotides.
Neither the prior art nor the instant specification teach/disclose that LCA5 activities are predicated upon and absolutely require the two specific Cytosine nucleotide differences present in SEQ ID NO:2.
Thus, it appears that Applicant’s instant SEQ ID NO:2 is merely a laboratory-specific artefact arrived at via a sequencing error or mere natural background mutation during cloning and propagating the LCA5 encoding nucleic acid molecule in Applicant’s laboratory.
Neitz et al do not disclose wherein the expression control sequence is a hybrid promoter comprising a CMV enhancer and a CBA promoter.
However, prior to the effective filing date of the instantly claimed invention, Drivas et al (Applicant’s own work) is considered relevant prior art for having disclosed a rAAV whose genome comprises a therapeutic gene for the treatment of an eye disease or disorder, e.g. Lebercillin (e.g. [0013], rAAV CEP290; [0032], “useful for the treatment of…LCA”), wherein the therapeutic transgene is operably linked to either a CMV promoter [0073], a rhodopsin kinase promoter [0082], or a hybrid promoter, e.g. CBA promoter with CMV enhancer [0073].
Furthermore, Applicant’s own prior art (Chung et al, 2013) previously successfully demonstrated that AAV-mediated gene transfer of an AAV expression vector encoding a CBA promoter driving expression of lebercillin (syn. LCA5), successfully restores retinal and visual function in LCA5 mutant mice.
Bennett et al (Applicant’s own work) is considered relevant prior art for having disclosed an AAV expression vector (SEQ ID NO:2) which comprises:
i) a 5’ AAV ITR sequence;
ii) a CMV/CBA synthetic promoter (e.g. [0053]; lower line), having a nucleotide sequence that is 100% identical to instant SEQ ID NO:10 (upper line, as shown below), operably linked to;
iii) the artisan’s transgene of interest, including genes that are mutated in inherited forms of blindness such as Leber Congenital Amaurosis (e.g. [0064]); and
iv) a 3’ AAV ITR sequence.
CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATT
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATT
GACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCA
ATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCC
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCC
AAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTA
CATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTAA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTAA
CATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACC
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACC
CCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGG
GGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAG
AGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCG
GCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCG
|||||||||||||||||||||||||||||||||||||||||||
GCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCG
Neitz et al disclosed wherein the rAAV expresses the therapeutic transgene in a human photoreceptor cell (e.g. [0096], “primate retinal cone cell”; [0083], “primate, such as an adult human”; [0099], “more preferably in human retinal cone cells”).
Applicant (Drivas et al) previously disclosed wherein the rAAV expresses the therapeutic transgene in a human photoreceptor cell (e.g. [0067], “supports transgene expression in photoreceptors”; [0091], “preferably human, being treated”).
Neitz et al disclosed the rAAV vector comprises 5’ and 3’ ITRs (e.g. [0074], “the gene delivery vector is bounded on the 5’ and 3’ end by functional AAV ITRs”).
Applicant (Drivas et al) previously disclosed wherein the rAAV comprises 5’ and 3’ ITRs [0062].
Neitz et al disclosed wherein the AAV capsid may be an AAV2, AAV5, or AAV8 capsid (e.g. [0074], cap from AAV2, AAV5, AAV7, AAV8).
Applicant (Drivas et al) previously disclosed wherein rAAV has an AAV5, AAV7, or AAV8 capsid (e.g. [0055-57, 157]).
Applicant (Bennet et al) previously disclosed wherein the rAAV has an AAV2, AAV5, AAV7, or AAV8 capsid (e.g. [0084]).
Resolving the level of ordinary skill in the pertinent art.
People of the ordinary skill in the art will be highly educated individuals such as medical doctors, scientists, or engineers possessing advanced degrees, including M.D.'s and Ph.D.'s. Thus, these people most likely will be knowledgeable and well-read in the relevant literature and have the practical experience in molecular biology, cloning, gene therapy vectors, and gene therapy methods of treating retinal disorders. Therefore, the level of ordinary skill in this art is high.
"A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at ___, 82 USPQ2d at 1396.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first promoter operably linked to a LCA5 transgene, as disclosed by Neitz et al, with a second promoter operably linked to a LCA5 transgene, i.e. a CMV promoter, a rhodopsin kinase promoter, or a hybrid CBA promoter with CMV enhancer, as disclosed by Drivas et al, in a rAAV expression vector, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first promoter operably linked to a LCA5 transgene, with a second promoter operably linked to a LCA5 transgene, i.e. a CMV promoter, a rhodopsin kinase promoter, or a hybrid CBA promoter with CMV enhancer, in a rAAV expression vector because Applicant themselves (Drivas et al) previously disclosed the use of a CMV promoter, a rhodopsin kinase promoter, or a hybrid CBA promoter to drive expression of the artisan’s therapeutic transgene of interest in photoreceptor cells, and Applicant themselves (Chung et al) previously successfully demonstrated the use of a hybrid CBA promoter to drive expression of a lebercillin transgene in photoreceptor cells via an AAV vector.
Prior to the effective filing date of the instantly claimed invention, it also would have been obvious to one of ordinary skill in the art to substitute a first hybrid CBA promoter with CMV enhancer, as disclosed by Applicant (Drivas et al), with a second hybrid CBA promoter with CMV enhancer having the nucleotide sequence of instant SEQ ID NO:10, as disclosed by Applicant (Bennet et al), in a rAAV expression vector, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first hybrid CBA promoter with CMV enhancer with a second hybrid CBA promoter with CMV enhancer having the nucleotide sequence of instant SEQ ID NO:10 in a rAAV expression vector because Applicant themselves (Bennett et al) previously disclosed the use of a hybrid CBA promoter comprising SEQ ID NO:10 to drive expression of the artisan’s therapeutic transgene of interest from an rAAV expression vector, whereby the transgene of interest includes genes that are mutated in inherited forms of blindness such as Leber Congenital Amaurosis.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claims 19-20, Neitz et al disclosed a pharmaceutical composition comprising a carrier and a rAAV (Example 1, [0140], [0143], subretinal injections).
Applicant (Drivas et al) previously disclosed a pharmaceutical composition comprising a carrier and a rAAV (e.g. Example 14, [0158]).
Applicant (Bennett et al) previously disclosed subretinal injection of a composition comprising the recombinant AAV vector (e.g. Example, 3, [0115]), whereby those of ordinary skill in the art would have immediately recognized that in vivo administration of rAAV vectors is routinely performed in the context of a pharmaceutically acceptable carrier.
With respect to Claim 23, Netiz et al disclosed wherein subject to be treated includes human subjects (e.g. [0078], “methods…restore visual capacity in the primate”, “more preferably is a human”).
Applicant (Drivas et al) previously disclosed wherein subject to be treated includes human subjects (e.g. [0091], “preferably human, being treated”).
Applicant (Bennett et al) previously disclosed wherein the subject to be treated includes human subjects (e.g. [0068], “rAAV used in the treatment of human diseases”).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that neither Neitz et al, Drivas et al, nor Chung et al teach/disclose SEQ ID NO:10.
Applicant’s argument(s) has been fully considered, but is not persuasive. In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
Applicant themselves (Bennett et al) previously disclosed an AAV expression vector (SEQ ID NO:2) which comprises:
i) a 5’ AAV ITR sequence;
ii) a CMV/CBA synthetic promoter (e.g. [0053]), having a nucleotide sequence that is 100% identical to instant SEQ ID NO:10, operably linked to;
iii) the artisan’s transgene of interest, including genes that are mutated in inherited forms of blindness such as Leber Congenital Amaurosis (e.g. [0064]); and
iv) a 3’ AAV ITR sequence.
Applicant iterates prior arguments.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner has rebutted prior arguments in prior Office Actions.
8. Claims 19-22 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Neitz et al (U.S. 2012/0172419; of record) in view of Drivas et al (U.S. 2016/0185832; Applicant’s own work; of record), Chung et al (June 2013; Applicant’s own work; of record in IDS), and Bennett et al (U.S. 2014/0087444; Applicant’s own work; of record in IDS), as applied to Claims 17, 19-20, and 23 above, and in further view of Masuda et al (1996; of record), Mizuno et al (1998; of record), and Yoshida et al (2003; co-authors to Mizuno et al; of record).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Neither Neitz et al, Drivas et al, Chung et al, nor Bennett et al teach/disclose wherein the rAAV is formulated with a lipid delivery vehicle, more specifically, a liposome.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 21-22, Masuda et al is considered relevant prior art for having taught a method of gene delivery to mammalian retinal photoreceptors, the method comprising the step of subretinal injection of pharmaceutical composition comprising liposomes encapsulating the artisan’s gene of interest (e.g. Abstract, “Injection into the….subretinal space resulted in the expression of the gene in… retinal ganglion cells and retinal pigment epithelial cells”).
Mizuno et al is considered relevant prior art for having taught a pharmaceutical composition comprising rAAV virions encapsulated in liposomes (e.g. Title; pg 352, col. 2, liposomes containing 10^8 particles of rAAV).
Yoshida et al (is considered relevant prior art for having taught that using AAV virion-associated liposomes increased the transduction efficiency more than 6-fold compared to the AAV virion alone (pg 265, col. 1, citing Mizuno et al (1998)), as illustrated in Figure 4 (shown below).
PNG
media_image1.png
140
390
media_image1.png
Greyscale
Applicant previously disclosed wherein the therapeutic transgene is operably linked to a hybrid promoter, e.g. CBA promoter/CMV enhancer [0070, 73].
Masuda et al taught wherein the transgene is operably linked to a hybrid promoter, i.e. CMV promoter/immediate early enhancer (e.g. pg 1915, col. 1, Methods).
Mizuno et al taught wherein the transgene is operably linked to a CMV promoter (e.g. pg 352, col. 1, “CMV promoter”).
Neitz et al disclosed wherein the rAAV expresses the therapeutic transgene in a human photoreceptor cell (e.g. [0096], “primate retinal cone cell”; [0083], “primate, such as an adult human”; [0099], “more preferably in human retinal cone cells”).
Applicant previously disclosed wherein the rAAV expresses the therapeutic transgene in a human photoreceptor cell (e.g. [0067], “supports transgene expression in photoreceptors”; [0091], “preferably human, being treated”).
Masuda et al taught wherein the transgene is expressed in photoreceptor cells (e.g. Abstract, “Injection into the….subretinal space resulted in the expression of the gene in… retinal ganglion cells and retinal pigment epithelial cells”; Figure 4).
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first pharmaceutical composition comprising rAAV virus particles, as disclosed by Neitz et al and Drivas et al, with a second pharmaceutical composition comprising rAAV virus particles and liposomes, as taught by Mizuno et al and Yoshida et al with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first pharmaceutical composition comprising rAAV virus particles, with a second pharmaceutical composition comprising rAAV virus particles and liposomes because those of ordinary skill in the art had long-recognized, about 20 years(!) prior to the effective filing date of the instantly claimed invention, that:
i) pharmaceutical formulations of a liposome composition can be administered to the eye of a subject via subretinal injection, thereby effectively delivering the artisan’s gene of interest to retinal photoreceptor cells (Masuda et al); and
ii) pharmaceutical compositions comprising liposomes encapsulating rAAV virus particles improves rAAV transduction (Mizuno et al, Yoshida et al).
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claims 19-20, Neitz et al disclosed a pharmaceutical composition comprising a carrier and a rAAV (Example 1, [0140], [0143], subretinal injections).
Applicant (Drivas et al) previously disclosed a pharmaceutical composition comprising a carrier and a rAAV (e.g. Example 14, [0158]).
Mizuno et al taught a pharmaceutical composition comprising a carrier and a rAAV (entire paper).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Masuda et al, Mizuno et al, and Yoshida et al do not cure the defect of Neitz et al, Drivas et al, and Chung et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Neitz et al, Drivas et al, and Chung et al are discussed above and incorporated herein. Applicant does not contest the teachings of Masuda et al, Mizuno et al, and Yoshida et al as applied to the obviousness to substitute a first pharmaceutical composition comprising rAAV virus particles, as disclosed by Neitz et al and Drivas et al, with a second pharmaceutical composition comprising rAAV virus particles and liposomes, as taught by Mizuno et al and Yoshida et al with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first pharmaceutical composition comprising rAAV virus particles, with a second pharmaceutical composition comprising rAAV virus particles and liposomes because those of ordinary skill in the art had long-recognized, about 20 years(!) prior to the effective filing date of the instantly claimed invention, that:
i) pharmaceutical formulations of a liposome composition can be administered to the eye of a subject via subretinal injection, thereby effectively delivering the artisan’s gene of interest to retinal photoreceptor cells (Masuda et al); and
ii) pharmaceutical compositions comprising liposomes encapsulating rAAV virus particles improves rAAV transduction (Mizuno et al, Yoshida et al).
9. Claims 17, 19-20 and 23 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Acland et al (U.S. 2014/0377224; Applicant’s own work; of record) in view of Lewis et al (WO 16/019364; Applicant’s own work, published outside instant application’s grace period; of record in IDS), Chung et al (June 2013; Applicant’s own work; of record in IDS), GenBank BC050327 (Homo sapiens LCA5, complete cDNA, 2007; of record), Neitz et al (U.S. 2012/0172419; of record), and Bennett et al (U.S. 2014/0087444; Applicant’s own work).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
With respect to Claim 17, Acland et al is considered relevant prior art for having disclosed rAAV expression vectors encoding a hybrid promoter (e.g. [0041]; claim 9) operably linked to LCA5 (e.g. [0031]), and a method of treating an ocular condition in a mammalian subject comprising the step of administering by intravitreal or subretinal injection said rAAV expression vector encoding a hybrid promoter operably linked to LCA5 (e.g. [0031]; claim 9).
Acland et al disclosed administering at least 1x10^9 genome copies of the rAAV viral vector (e.g. claim 9).
Acland et al disclosed a hybrid promoter comprising a CBA promoter/CMV enhancer (e.g. [0041]; claim 9).
Similarly, Lewis et al is considered relevant prior art for having disclosed rAAV expression vectors encoding a hybrid promoter operably linked to LCA5, and a method of treating an ocular condition in a mammalian subject comprising the step of administering by intravitreal or subretinal injection said rAAV expression vector encoding a hybrid promoter operably linked to LCA5 (e.g. [00160]; claim 42).
Lewis et al disclosed administering at least 1x10^9 genome copies of the rAAV viral vector (e.g. [00148, 153]).
Lewis et al disclosed a hybrid promoter comprising a CBA promoter/CMV enhancer [0081], or a hybrid promoter comprising a CMV promoter, immediate early enhancer, and an operator [00233].
Applicant’s own prior art (Chung et al, 2013) previously successfully demonstrated that AAV-mediated gene transfer of an AAV expression vector encoding a CBA promoter driving expression of lebercillin (syn. LCA5), successfully restores retinal and visual function in LCA5 mutant mice.
Neither Acland et al nor Lewis et al disclosed wherein the LCA5 transgene comprises a nucleotide sequence that is at least 90% identical to SEQ ID NO:2.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claims 17-19, GenBank et al taught the nucleotide sequence of human LCA5 cDNA, wherein said nucleotide sequence is at least 99.7% identical to instant SEQ ID NO:2 (six mismatches).
Similarly, Neitz et al is considered relevant prior art for having disclosed an rAAV virion comprising an AAV capsid (e.g. [0074], “packaging of the AAV virion, “cap from AAV…”), wherein said rAAV genome comprises a nucleic acid sequence encoding human Lebercillin (e.g. [0069], LCA5), wherein said nucleic acid sequence (SEQ ID NO:48; lower line) is at least 99.8% identical (2 mismatches) to instant SEQ ID NO:2 (upper line), as shown below:
ATGGGGGAAAGAGCAGGAAGTCCAGGTACTGACCAAGAAAGAAAGGCAGGCAAACACCAT 60
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
ATGGGGGAAAGAGCAGGAAGTCCAGGTACTGATCAAGAAAGAAAGGCAGGCAAACACCAT
MGERAGSPGTDQERKAGKHH
MGERAGSPGTDQERKAGKHH
CATCACCAAGCCCCTCGGAAACCAAGCCCCAAGGGTCTACCAAACAGAAAGGGAGTCCGA 240
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
CATCACCAAGCCCCTCGGAAACCAAGCCCTAAGGGTCTACCAAACAGAAAGGGAGTCCGA
HHQAPRKPSPKGLPNRKGVR
HHQAPRKPSPKGLPNRKGVR
As shown above, the sequences encode the identical amino acid sequences, respectively.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Those of ordinary skill in the art would reasonably interpret the 2 dispersed, mismatches to merely represent sequencing errors or stochastic mutation during cloning and replication of the LCA5 coding sequence, and that they are not material to the functionality of the thus-encoded LCA5 protein.
There is no objective evidence of record that the two, dispersed, nucleotide differences between the prior art LCA5 sequence and instant SEQ ID NO:2 are material to patentability determination.
The instant specification fails to disclose a step of intentionally manipulating the prior art-recognized LCA5 nucleic acid to comprise the instant T>C changes shown in SEQ ID NO:2.
The instant specification fails to disclose an element of criticality of the two Cytosine nucleotides, as opposed to the two Thymidine nucleotides.
Neither the prior art nor the instant specification teach/disclose that LCA5 activities are predicated upon and absolutely require the two specific Cytosine nucleotide differences present in SEQ ID NO:2.
Thus, it appears that Applicant’s instant SEQ ID NO:2 is merely a laboratory-specific artefact arrived at via a sequencing error or mere natural background mutation during cloning and propagating the LCA5 encoding nucleic acid molecule in Applicant’s laboratory.
Neitz et al disclosed a method of treating an eye disease or disorder in a subject, the method comprising the step of administering the rAAV gene therapy vector to the subject’s eyes via subretinal injection (e.g. Example 1, [0140, 143], subretinal injections; [0188-189], “cones express the transgene”, “this is the first time that measurements from cones…have been achieved”).
While the Neitz et al working example successfully demonstrated the use of rAAV-L-opsin transgene, Neitz et al clearly disclosed LCA5 as an intended therapeutic transgene to be used in the therapeutic method (e.g. [0069], claims 1 and 10).
Neitz et al disclosed administering at least 1x10^9 genome copies of the rAAV viral vector (e.g. [0076]; Example 1, [0140, 144]).)
The specification need not contain an example if the invention is otherwise disclosed in such manner that one skilled in the art will be able to practice it without an undue amount of experimentation. In re Borkowski, 422 F.2d 904, 908, 164 USPQ 642, 645 (CCPA 1970).
A reference contains an "enabling disclosure" if the public was in possession of the claimed invention before the date of invention. "Such possession is effected if one of ordinary skill in the art could have combined the publication's description of the invention with his [or her] own knowledge to make the claimed invention." In re Donohue, 766 F.2d 531, 226 USPQ 619 (Fed. Cir. 1985). No undue experimentation is required.
Acland et al disclosed wherein the rAAV expression vector comprises 5’ and 3’ ITRs (e.g. [0020-23, 25]).
Lewis et al disclosed wherein the rAAV expression vector comprises 5’ and 3’ ITRs (e.g. [00127]; claims 25-26; Figures 9A, 12).
Neitz et al disclosed the rAAV vector comprises 5’ and 3’ ITRs (e.g. [0074], “the gene delivery vector is bounded on the 5’ and 3’ end by functional AAV ITRs”).
Acland et al disclosed the rAAV expression vectors are encapsidated into AAV viruses (e.g. [0046-53]), wherein the AAV viral capsid is serotype AAV2, 3, 4, 5, or 6 (e.g. [0023, 53]).
Lewis et al disclosed the rAAV expression vectors are encapsidated into AAV viruses (e.g. [00234]), wherein the AAV viral capsid is any of serotypes AAV1 to AAV10, or AAV7m8 (e.g. claim 30).
Applicant (Chung et al) previously taught wherein the rAAV has an AAV9 capsid.
Neitz et al disclosed wherein the AAV capsid may be an AAV2, AAV5, or AAV8 capsid (e.g. [0074], cap from AAV2, AAV5, AAV7, AAV8).
Bennett et al (Applicant’s own work) is considered relevant prior art for having disclosed an AAV expression vector (SEQ ID NO:2) which comprises:
i) a 5’ AAV ITR sequence;
ii) a CMV/CBA synthetic promoter (e.g. [0053]), having a nucleotide sequence that is 100% identical to instant SEQ ID NO:10, operably linked to;
iii) the artisan’s transgene of interest, including genes that are mutated in inherited forms of blindness such as Leber Congenital Amaurosis (e.g. [0064]); and
iv) a 3’ AAV ITR sequence.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first LCA5 nucleotide sequence, as disclosed by Acland et al and/or Lewis et al, with a second LCA5 nucleotide sequence comprising at least 90%, 95%, and/or 100% identity to SEQ ID NO:2, as taught/disclosed by GenBank and Neitz et al, in a rAAV expression vector comprising a hybrid promoter comprising a CBA promoter and a CMV enhancer operably linked to a LCA5 transgene with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first LCA5 nucleotide sequence with a second LCA5 nucleotide sequence comprising at least 90%, 95%, and/or 100% identity to SEQ ID NO:2 in a rAAV expression vector comprising a hybrid promoter comprising a CBA promoter and a CMV enhancer operably linked to a LCA5 transgene in a method of treating an eye disease or disorder in a subject because those of ordinary skill in the art had long-recognized that the wildtype human LCA5 cDNA naturally comprises a nucleotide sequence that is at least 99.7% to 99.8% identical to instant SEQ ID NO:2 (Genbank; Neitz et al).
The "mere existence of differences between the prior art (6 or 2 nucleotide mismatches) and an invention (SEQ ID NO:2) does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Those of ordinary skill in the art would reasonably interpret the 2 dispersed, mismatches to merely represent sequencing errors or stochastic mutation during cloning and replication of the LCA5 coding sequence, and that they are not material to the functionality of the thus-encoded LCA5 protein.
There is no objective evidence of record that the two, dispersed, nucleotide differences between the prior art LCA5 sequence and instant SEQ ID NO:2 are material to patentability determination.
The instant specification fails to disclose a step of intentionally manipulating the prior art-recognized LCA5 nucleic acid to comprise the instant T>C changes shown in SEQ ID NO:2.
The instant specification fails to disclose an element of criticality of the two Cytosine nucleotides, as opposed to the two Thymidine nucleotides.
Neither the prior art nor the instant specification teach/disclose that LCA5 activities are predicated upon and absolutely require the two specific Cytosine nucleotide differences present in SEQ ID NO:2.
Thus, it appears that Applicant’s instant SEQ ID NO:2 is merely a laboratory-specific artefact arrived at via a sequencing error or mere natural background mutation during cloning and propagating the LCA5 encoding nucleic acid molecule in Applicant’s laboratory.
Prior to the effective filing date of the instantly claimed invention, it also would have been obvious to one of ordinary skill in the art to substitute a first hybrid CBA promoter with CMV enhancer, as disclosed by Applicant (Drivas et al), with a second hybrid CBA promoter with CMV enhancer having the nucleotide sequence of instant SEQ ID NO:10, as disclosed by Applicant (Bennet et al), in a rAAV expression vector, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first hybrid CBA promoter with CMV enhancer with a second hybrid CBA promoter with CMV enhancer having the nucleotide sequence of instant SEQ ID NO:10 in a rAAV expression vector because Applicant themselves (Bennett et al) previously disclosed the use of a hybrid CBA promoter comprising SEQ ID NO:10 to drive expression of the artisan’s therapeutic transgene of interest from an rAAV expression vector, whereby the transgene of interest includes genes that are mutated in inherited forms of blindness such as Leber Congenital Amaurosis.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claims 19-20, Acland et al disclosed a pharmaceutical composition comprising the rAAV and a pharmaceutically acceptable excipient suitable for delivery to the subject’s eye (e.g. [0054]).
Lewis et al disclosed a pharmaceutical composition comprising the rAAV and a pharmaceutically acceptable excipient suitable for delivery to the subject’s eye (e.g. [00145, 149]).
Neitz et al disclosed a pharmaceutical composition comprising a carrier and a rAAV (Example 1, [0140], [0143], subretinal injections).
Applicant (Bennett et al) previously disclosed subretinal injection of a composition comprising the recombinant AAV vector (e.g. Example, 3, [0115]), whereby those of ordinary skill in the art would have immediately recognized that in vivo administration of rAAV vectors is routinely performed in the context of a pharmaceutically acceptable carrier.
With respect to Claim 23, Acland et al disclosed wherein the hybrid promoter is capable of directing expression of the transgene in a photoreceptor cell (e.g. claim 20), including human photoreceptor cells (e.g. claims 9 and 20).
Lewis et al disclosed wherein the hybrid promoter is capable of directing expression of the transgene in a photoreceptor cell (e.g. [00105, 270]), including human photoreceptor cells (e.g. claims 21-22).
Neitz et al disclosed wherein the rAAV expresses the therapeutic transgene in a human photoreceptor cell (e.g. [0096], “primate retinal cone cell”; [0083], “primate, such as an adult human”; [0099], “more preferably in human retinal cone cells”). Netiz et al disclosed wherein subject to be treated includes human subjects (e.g. [0078], “methods…restore visual capacity in the primate”, “more preferably is a human”).
Applicant (Drivas et al) previously disclosed wherein subject to be treated includes human subjects (e.g. [0091], “preferably human, being treated”).
Applicant (Bennett et al) previously disclosed wherein the subject to be treated includes human subjects (e.g. [0068], “rAAV used in the treatment of human diseases”).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant iterates prior arguments.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner has rebutted prior arguments above and in prior Office Actions.
10. Claims 19-22 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Acland et al (U.S. 2014/0377224; Applicant’s own work; of record) in view of Lewis et al (WO 16/019364; Applicant’s own work, published outside instant application’s grace period; of record in IDS), Chung et al (2013; Applicant’s own work; of record in IDS), GenBank BC050327 (Homo sapiens LCA5, complete cDNA, 2007; of record), Neitz et al (U.S. 2012/0172419; of record), and Bennett et al (U.S. 2014/0087444; Applicant’s own work), as applied to Claims 17, 19-20 and 23 above, and in further view of Masuda et al (1996; of record), Mizuno et al (1998; of record), and Yoshida et al (2003; co-authors to Mizuno et al; of record).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Neither Acland et al, Lewis et al, Chung et al, Neitz et al, nor Bennett et al teach/disclose wherein the rAAV is formulated with a lipid delivery vehicle, more specifically, a liposome.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 21-22, Masuda et al is considered relevant prior art for having taught a method of gene delivery to mammalian retinal photoreceptors, the method comprising the step of subretinal injection of pharmaceutical composition comprising liposomes encapsulating the artisan’s gene of interest (e.g. Abstract, “Injection into the….subretinal space resulted in the expression of the gene in… retinal ganglion cells and retinal pigment epithelial cells”).
Mizuno et al is considered relevant prior art for having taught a pharmaceutical composition comprising rAAV virions encapsulated in liposomes (e.g. Title; pg 352, col. 2, liposomes containing 10^8 particles of rAAV).
Yoshida et al (is considered relevant prior art for having taught that using AAV virion-associated liposomes increased the transduction efficiency more than 6-fold compared to the AAV virion alone (pg 265, col. 1, citing Mizuno et al (1998)), as illustrated in Figure 4 (shown below).
PNG
media_image1.png
140
390
media_image1.png
Greyscale
Applicant previously disclosed wherein the therapeutic transgene is operably linked to a hybrid promoter, e.g. CBA promoter/CMV enhancer [0070, 73].
Masuda et al taught wherein the transgene is operably linked to a hybrid promoter, i.e. CMV promoter/immediate early enhancer (e.g. pg 1915, col. 1, Methods).
Mizuno et al taught wherein the transgene is operably linked to a CMV promoter (e.g. pg 352, col. 1, “CMV promoter”).
Neitz et al disclosed wherein the rAAV expresses the therapeutic transgene in a human photoreceptor cell (e.g. [0096], “primate retinal cone cell”; [0083], “primate, such as an adult human”; [0099], “more preferably in human retinal cone cells”).
Applicant previously disclosed wherein the rAAV expresses the therapeutic transgene in a human photoreceptor cell (e.g. [0067], “supports transgene expression in photoreceptors”; [0091], “preferably human, being treated”).
Masuda et al taught wherein the transgene is expressed in photoreceptor cells (e.g. Abstract, “Injection into the….subretinal space resulted in the expression of the gene in… retinal ganglion cells and retinal pigment epithelial cells”; Figure 4).
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first pharmaceutical composition comprising rAAV virus particles, as disclosed by Neitz et al and Drivas et al, with a second pharmaceutical composition comprising rAAV virus particles and liposomes, as taught by Mizuno et al and Yoshida et al with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first pharmaceutical composition comprising rAAV virus particles, with a second pharmaceutical composition comprising rAAV virus particles and liposomes because those of ordinary skill in the art had long-recognized, about 20 years(!) prior to the effective filing date of the instantly claimed invention, that:
i) pharmaceutical formulations of a liposome composition can be administered to the eye of a subject via subretinal injection, thereby effectively delivering the artisan’s gene of interest to retinal photoreceptor cells (Masuda et al); and
ii) pharmaceutical compositions comprising liposomes encapsulating rAAV virus particles improves rAAV transduction (Mizuno et al, Yoshida et al).
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claims 19-20, Neitz et al disclosed a pharmaceutical composition comprising a carrier and a rAAV (Example 1, [0140], [0143], subretinal injections).
Applicant previously disclosed a pharmaceutical composition comprising a carrier and a rAAV (e.g. Example 14, [0158]).
Mizuno et al taught a pharmaceutical composition comprising a carrier and a rAAV (entire paper).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant does not contest the teachings of Masuda et al, Mizuno et al, and Yoshida et al as applied to the obviousness to substitute a first pharmaceutical composition comprising rAAV virus particles, as disclosed by Neitz et al and Drivas et al, with a second pharmaceutical composition comprising rAAV virus particles and liposomes, as taught by Mizuno et al and Yoshida et al with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first pharmaceutical composition comprising rAAV virus particles, with a second pharmaceutical composition comprising rAAV virus particles and liposomes because those of ordinary skill in the art had long-recognized, about 20 years(!) prior to the effective filing date of the instantly claimed invention, that:
i) pharmaceutical formulations of a liposome composition can be administered to the eye of a subject via subretinal injection, thereby effectively delivering the artisan’s gene of interest to retinal photoreceptor cells (Masuda et al); and
ii) pharmaceutical compositions comprising liposomes encapsulating rAAV virus particles improves rAAV transduction (Mizuno et al, Yoshida et al).
11. Claims 24 and 26-28 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Acland et al (U.S. 2014/0377224; Applicant’s own work; of record) in view of Lewis et al (WO 16/019364; Applicant’s own work, published outside instant application’s grace period; of record in IDS), Chung et al (2013; of record in IDS), GenBank BC050327 (Homo sapiens LCA5, complete cDNA, 2007; of record), Neitz et al (U.S. 2012/0172419; of record) and Bennett et al (U.S. 2014/0087444; Applicant’s own work), as applied to Claims 17, 19-20, and 23 above.
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
With respect to Claim 24, Acland et al is considered relevant prior art for having disclosed rAAV expression vectors encoding a hybrid promoter (e.g. [0041]; claim 9) operably linked to LCA5 (e.g. [0031]), and a method of treating an ocular condition in a mammalian subject comprising the step of administering by intravitreal or subretinal injection said rAAV expression vector encoding a hybrid promoter operably linked to LCA5 (e.g. [0031]; claim 9).
Acland et al disclosed administering at least 1x10^9 genome copies of the rAAV viral vector per eye (e.g. claim 9).
Acland et al disclosed a hybrid promoter comprising a CBA promoter/CMV enhancer (e.g. [0041]; claim 9).
Similarly, Lewis et al is considered relevant prior art for having disclosed rAAV expression vectors encoding a hybrid promoter operably linked to LCA5, and a method of treating an ocular condition in a mammalian subject comprising the step of administering by intravitreal or subretinal injection said rAAV expression vector encoding a hybrid promoter operably linked to LCA5 (e.g. [00160]; claim 42).
Lewis et al disclosed administering at least 1x10^9 genome copies of the rAAV viral vector per eye (e.g. [00148, 153]).
Lewis et al disclosed an example of administering an AAV8 viral vector to the eye of a subject (e.g. [0044]; Figure 9B; [00139], AAV8 capsid; Example 6, “subretinal injections of…AAV serotype 8 vector”).
Lewis et al disclosed a hybrid promoter comprising a CBA promoter/CMV enhancer [0081], or a hybrid promoter comprising a CMV promoter, immediate early enhancer, and an operator [00233].
Similarly, Neitz et al is considered relevant prior art for having disclosed an rAAV virion comprising an AAV capsid (e.g. [0074], “packaging of the AAV virion, “cap from AAV…”), wherein said rAAV genome comprises a nucleic acid sequence encoding human Lebercillin (e.g. [0069], LCA5),
Neitz et al disclosed a method of treating an eye disease or disorder in a subject, the method comprising the step of administering the rAAV gene therapy vector to the subject’s eyes via subretinal injection (e.g. Example 1, [0140, 143], subretinal injections; [0188-189], “cones express the transgene”, “this is the first time that measurements from cones…have been achieved”).
While the Neitz et al working example successfully demonstrated the use of rAAV-L-opsin transgene, Neitz et al clearly disclosed LCA5 as an intended therapeutic transgene to be used in the therapeutic method (e.g. [0069], claims 1 and 10).
Neitz et al disclosed administering at least 1x10^9 genome copies of the rAAV viral vector/eye (e.g. [0076]; Example 1, [0140, 144]).)
The specification need not contain an example if the invention is otherwise disclosed in such manner that one skilled in the art will be able to practice it without an undue amount of experimentation. In re Borkowski, 422 F.2d 904, 908, 164 USPQ 642, 645 (CCPA 1970).
A reference contains an "enabling disclosure" if the public was in possession of the claimed invention before the date of invention. "Such possession is effected if one of ordinary skill in the art could have combined the publication's description of the invention with his [or her] own knowledge to make the claimed invention." In re Donohue, 766 F.2d 531, 226 USPQ 619 (Fed. Cir. 1985). No undue experimentation is required.
Bennett et al (Applicant’s own work) is considered relevant prior art for having disclosed an AAV expression vector (SEQ ID NO:2) which comprises:
i) a 5’ AAV ITR sequence;
ii) a CMV/CBA synthetic promoter (e.g. [0053]), having a nucleotide sequence that is 100% identical to instant SEQ ID NO:10, operably linked to;
iii) the artisan’s transgene of interest, including genes that are mutated in inherited forms of blindness such as Leber Congenital Amaurosis (e.g. [0064]); and
iv) a 3’ AAV ITR sequence.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first LCA5 nucleotide sequence, as disclosed by Acland et al and/or Lewis et al, with a second LCA5 nucleotide sequence comprising at least 90%, 95%, and/or 100% identity to SEQ ID NO:2, as taught/disclosed by GenBank and Neitz et al, in a rAAV expression vector comprising a hybrid promoter comprising a CBA promoter and a CMV enhancer comprising SEQ ID NO:10 operably linked to a LCA5 transgene, and used in a method of treating an eye disease or disorder in a subject, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first LCA5 nucleotide sequence with a second LCA5 nucleotide sequence comprising at least 90%, 95%, and/or 100% identity to SEQ ID NO:2 in a rAAV expression vector comprising a hybrid promoter comprising a CBA promoter and a CMV enhancer comprising SEQ ID NO:10 operably linked to a LCA5 transgene, and used in a method of treating an eye disease or disorder in a subject because those of ordinary skill in the art had long-recognized that the wildtype human LCA5 cDNA naturally comprises a nucleotide sequence that is at least 99.7% to 99.8% identical to instant SEQ ID NO:2 (Genbank; Neitz et al).
Applicant themselves (Lewis et al) previously successfully demonstrated the ability to administer an AAV8 viral vector to the eye of a subject (e.g. [0044]; Figure 9B; [00139], AAV8 capsid; Example 6, “subretinal injections of…AAV serotype 8 vector”).
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claims 24 and 26-28, Acland et al disclosed administering at least 1x10^9 (e.g. claim 9) to 2x10^11 (e.g. claim 18) genome copies of the rAAV viral vector per eye, and about 4x10^10 viral vectors per eye (e.g. Example 3; Table 1).
Lewis et al disclosed administering at least 5x10^9 to 5x10^12 genome copies of the rAAV viral vector per eye (e.g. [00148]; Example 1, [00221], “1x10^9 vg/retina”; Example 7, [00292], “subretinal injections of AAV vectors…at a dose of 1x10^10 vg [per eye]”).
Neitz et al disclosed administering at least 1x10^10, 5x10^10, 5x10^11, 1x10^12 viral particles per eye (e.g. [0076]).
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant application fails to disclose an element of criticality for the broadly recited range, and Applicant themselves previously demonstrated the ability of the ordinary artisan to vary the AAV dosage administered to the subject’s eye.
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant iterates prior arguments.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner has rebutted prior arguments above and in prior Office Actions.
Applicant argues secondary considerations that, per Uyhazi et al (2020) and Aleman et al (2025), the AAV gene therapy is well-tolerated, demonstrates preliminary safety, demonstrates clear signs of biological activity through 90 days and improvements in cone-mediated vision in a group of patients.
Applicant’s argument(s) has been fully considered, but is not persuasive.
As a first matter, Claim 24 recites the subject at a high level of generality, whereby the specification disclose said subject includes, but is not limited to, mammalian subjects (e.g. pg 3, line 21), such as mice or humans (e.g. pg 34, lines 4-12; pg 38, lines 14-18).
Those of ordinary skill in the art would immediately recognize that instant independent Claim 24 is not commensurate in scope to Uyhazi et al (mouse subjects) and Aleman et al (human subjects).
As a second matter, Uyhazi et al states that functional gene augmentation therapy did not work in mouse subjects when 1x10^9 AAV8 vector genomes/eye, wherein said AAV8 vector comprises the CMV/CBA hybrid promoter operably linked to the LCA5 transgene (e.g. pg 2, col. 1), was administered 30 days after birth (P30) (e.g. Abstract Results, “but not at P30”; pg 7, col. 1). Rather, only when the vector was administered at early-onset (P5) or mid-onset (P15) did it achieve structural and functional rescue.
Those of ordinary skill in the art would immediately recognize that instant independent Claim 24 is not commensurate in scope to Uyhazi et al (mouse subjects; early-onset and/or mid-onset; CMV/CBA hybrid promoter).
As a third matter, Aleman et al taught the administration of at least 1x10^10 AAV8 vector genomes/eye to the 3 human subjects, wherein said AAV8 vector comprises the CMV/CBA hybrid promoter operably linked to the LCA5 transgene (e.g. pg 4785, OPGx-001 vector).
Those of ordinary skill in the art would immediately recognize that instant independent Claim 24 is not commensurate in scope to Aleman et al (human subjects; at least 1x10^10 AAV8 vector genomes/eye; CMV/CBA hybrid promoter).
As a fourth matter, Applicant had previously successfully demonstrated that LCA5 gene augmentation therapy can improve retinal function in mouse subjects (e.g. Chung et al (2013)), thus it is unclear how the asserted secondary considerations such as demonstrates clear signs of biological activity and visual improvements are to be considered surprising and unexpected.
As a fifth matter, the Examiner provides the following references to rebut applicant’s arguments regarding the state of the prior art regarding safety and efficacy of retinal gene therapy. Note: the references are not considered a part of the 103 rejection but are solely provided to rebut applicant’s argument(s).
Applicant’s own work, Pierce et al (The Status of RPE65 Gene Therapy Trials: Safety and Efficacy, Cold Spring Harbor Laboratory Press, 17 pages, doi: 10.1101/cshperspect.a017285; available online January 29, 2015; Applicant’s own work not cited in an IDS) is considered relevant prior art for having taught that “[I]n all of the studies reported to date, this approach (rAAV retinal gene therapy in humans) has been shown to be both safe and effective. The successful clinical trials of gene augmentation therapy for retinal degeneration caused by mutations in the RPE65 gene sets the stage for broad application of gene therapy to treat retinal degenerative disorders.”
Pursuant to the Paperwork Reduction Act of 1995 (44 U.S.C. 3501 et seq.), a copy of the Applicant's own publication(s) are not provided with the instant Office Action because it is presumed that Applicant has a copy of their own publications, as such is routine practice in the art, and that Applicant has provided their representative with a copy of said publications to establish a prosecution record. However, if Applicant’s representative insists upon receiving a copy of the entire references, then the Examiner will make attempts to provide it in the next Office Action.
Similarly, Fischer et al (Successful delivery of rAAV8.CNGA3 in a patient with CNGA3 achromatopsia Invest. Opthalmol. & Vis. Sci. 57(12): Abstract, September 2016) successfully demonstrated subretinal injection to human subjects (clinical phase I/II trial) of 1x10^10, 5x10^10, or 1x10^11 vector genomes/eye of an AAV8 viral vector for retinal gene therapy clinical trial. Fischer et al taught the rAAV8 retinal gene therapy vector was well-tolerated (syn. safe to use).
Thus, here too, it is unclear how the asserted secondary considerations such as AAV gene therapy vectors, including AAV8 gene therapy vectors, is well-tolerated, demonstrates preliminary safety, and/or demonstrates clear signs of biological activity and visual improvements are to be considered surprising and unexpected results.
Citation of Relevant Prior Art
12. The prior art made of record and not relied upon is considered pertinent to applicant's disclosure.
Davis et al (U.S. 2010/0077495) is considered relevant prior art for having disclosed an expression vector (SEQ ID NO:18) which comprises a CMV/CBA synthetic promoter, having a nucleotide sequence that is 100% identical to instant SEQ ID NO:10, operably linked to the artisan’s transgene of interest.
Boye et al (U.S. 2013/0210895) is considered relevant prior art for having claimed a recombinant AAV expression vector which comprises a CMV/CBA synthetic promoter (e.g. claim 1) operably linked to the artisan’s transgene of interest, and a pharmaceutical composition thereof (e.g. claim 31), said rAAV used in a method of delivering the artisan’s transgene of interest to human retinal cells (e.g. claim 57), thereby treating a retinal disorder, e.g. Leber congenital amaurosis (e.g. claim 60).
Pang et al (Long-term Retinal Function and Structure Rescue Using Capsid Mutant AAV8 Vector in the rd10 Mouse, a Model of Recessive Retinitis Pigmentosa, Molecular Therapy 19(2): 234-242, 2011; of record) successfully demonstrated subretinal injection to a mouse subject of at least 1x10^10 vector genomes/eye of an AAV8 viral vector for retinal gene therapy (e.g. pg 240, col. 1, Methods, Subretinal injections).
Reichel et al (Humoral immune response to subretinal AAV8 in non-human primates, Invest. Opthalmol. & Vis. Sci. 57(12): Abstract 778, September 2016) successfully demonstrated subretinal injection to a non-human primate subject of at least 1x10^11 or 1x10^12 vector genomes/eye of an AAV8 viral vector for retinal gene therapy.
Thus, prior to the effective filing date of the instantly claimed invention, those of ordinary skill in the art previously recognized and successfully reduced to practice the scientific and technical concepts of successfully administering by subretinal injection rAAV8 viral vectors for retinal gene therapy, whereby said rAAV8 viral vectors are administered to the subject at a dose ranging from 1x10^10, 5x10^10, 1x10^11, or 1x10^12 vector genomes/eye.
Maguire et al (Microvesicle-associated AAV Vector as a Novel Gene Delivery System, Molecular Therapy 20(5): 960-971, 2012; of record) is considered relevant prior art for having taught that AAV virus producer cells naturally release mature AAV virions into the cell culture media both as free virus particles, as well as encapsulated within exosomes (entire paper; e.g. Figure 7a).
Thus, the presence of at least some amount lipid delivery vehicles in the production of recombinant AAV virions is considered to be an inherent property that naturally flows from the preparation of rAAV from producer cells routinely practice in the art.
Conclusion
13. No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEVIN K. HILL whose telephone number is (571)272-8036. The examiner can normally be reached 12pm-8pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Tracy Vivlemore can be reached at 571-272-2914. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
KEVIN K. HILL
Examiner
Art Unit 1638
/KEVIN K HILL/Primary Examiner, Art Unit 1638