Prosecution Insights
Last updated: April 19, 2026
Application No. 18/061,633

GENE THERAPY FOR OCULAR DISORDERS

Final Rejection §103§112
Filed
Dec 05, 2022
Examiner
HILL, KEVIN KAI
Art Unit
1638
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Trustees of the University of Pennsylvania
OA Round
4 (Final)
36%
Grant Probability
At Risk
5-6
OA Rounds
3y 7m
To Grant
70%
With Interview

Examiner Intelligence

Grants only 36% of cases
36%
Career Allow Rate
304 granted / 845 resolved
-24.0% vs TC avg
Strong +34% interview lift
Without
With
+33.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
75 currently pending
Career history
920
Total Applications
across all art units

Statute-Specific Performance

§101
5.8%
-34.2% vs TC avg
§103
33.6%
-6.4% vs TC avg
§102
20.1%
-19.9% vs TC avg
§112
29.8%
-10.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 845 resolved cases

Office Action

§103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Detailed Action This action is in response to the papers filed October 1, 2025. Amendments Applicant's response and amendments, filed April 21, 2025, is acknowledged. Applicant has cancelled Claims 1-16, 18, and 25, amended Claims 17, 24, and 26-28, and added new claims, Claims 29-30. Claims 17, 19-24, and 26-30 are pending. Priority This application is a continuation of application 16/489,770 filed August 29, 2019, now U.S. Patent 11,564,996, which is a 371 of PCT/US2018/020470 filed on March 1, 2018. Applicant’s claim for the benefit of a prior-filed application provisional application 62/469,642 filed on March 10, 2017 and 62/465,649 filed on March 1, 2017 under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365(c) is acknowledged. Information Disclosure Statement Applicant has filed an Information Disclosure Statement on October 1, 2025 that has been considered. The signed and initialed PTO Forms 1449 are mailed with this action. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. 1. Claim 24 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. See Office Action mailed May 25, 2022 in parent application 16/489,770. Applicant has amended the claim to recite “at least about 1x10^9 vector genomes”. The metes and bounds of the term “at least about" are unclear because there are two limitations in this phrase: "at least" and "about". The limitation "about" is broad, but not indefinite. Similarly, the limitation "at least" is broad, but not indefinite. However, "at least about" is indefinite because the metes and bounds of limitation "at least about" can not be determined. “About” indicates values below 1x10^9, which necessarily fails to meet the "at least" requirement. The Examiner suggests amending the claim to recite either “at least” or “about”, but not both. Choose one. 2. Claims 29-30 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 29-30 recite the limitation “the expression control sequence” in reference to Claim 17. There is insufficient antecedent basis for this limitation in the claim because it is unclear if Applicant is referring back to the “hybrid promoter” of Claim 17, or to some other element not positively recited in the AAV vector of Claim 17. To the extent Applicant intends to refer back to the hybrid promoter, then Claims 29-30 should replace the phrase “expression control sequence” with “hybrid promoter”. Appropriate correction is required. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. 3. The prior rejection of Claims 2-3, 5-6, 11-14, 17-20, 23, and 26-28 under AIA 35 U.S.C. 103 as being unpatentable over Neitz et al (U.S. 2012/0172419; of record) in view of Drivas et al (U.S. 2016/0185832; Applicant’s own work; of record) and Chung et al (AAV Mediated Gene Transfer Restores Retinal and Visual Function in Lebercilin-/-(LCA5) Mice, Invest. Ophthalmol. & Vis. Science 54: pg 2710, ARVO Annual Meeting Abstract, June 2013; Applicant’s own work; of record in IDS) is withdrawn in light of Applicant’s amendments to the claim set as a whole, necessitating new grounds of rejection. 4. The prior rejection of Claims 5, 13-16, and 19-22 under AIA 35 U.S.C. 103 as being unpatentable over Neitz et al (U.S. 2012/0172419; of record) in view of Drivas et al (U.S. 2016/0185832; Applicant’s own work; of record), and Chung et al (2013; Applicant’s own work; of record in IDS), as applied to Claims 2-3, 5-6, 11-14, 17-20, 23, and 26-28 above, and in further view of Masuda et al (Gene Transfer With Liposomes to the Intraocular Tissues by Different Routes of Administration, Invest. Opthalmol. Vis. Sci. 37: 1914-1920, 1996; of record), Mizuno et al (Improvement of Transduction Efficiency of Recombinant Adeno-associated Virus Vector by Entrapment in Multilamellar Liposomes, Jpn. J. Cancer Res. 89: 352-354, 1998; of record), and Yoshida et al (Clinical gene therapy for brain tumors. Liposomal delivery of anticancer molecule to glioma, J. Neuro-Oncology 65: 261-267, 2003; co-authors to Mizuno et al; of record) is withdrawn for reasons discussed above. 5. The prior rejection of Claims 2-3, 5-6, 11-14, 17-20, 23, and 26-28 under AIA 35 U.S.C. 103 as being unpatentable over Acland et al (U.S. 2014/0377224; Applicant’s own work; of record) in view of Lewis et al (WO 16/019364; Applicant’s own work, published outside instant application’s grace period; of record in IDS), Chung et al (AAV Mediated Gene Transfer Restores Retinal and Visual Function in Lebercilin-/-(LCA5) Mice, Invest. Ophthalmol. & Vis. Science 54: pg 2710, ARVO Annual Meeting Abstract, June 2013; Applicant’s own work; of record in IDS), GenBank BC050327 (Homo sapiens LCA5, complete cDNA, 2007; of record), and Neitz et al (U.S. 2012/0172419; of record) is withdrawn for reasons discussed above. 6. The prior rejection of Claims 5, 13-16, and 19-22 under AIA 35 U.S.C. 103 as being unpatentable over Acland et al (U.S. 2014/0377224; Applicant’s own work; of record) in view of Lewis et al (WO 16/019364; Applicant’s own work, published outside instant application’s grace period; of record in IDS), Chung et al (2013; Applicant’s own work; of record in IDS), GenBank BC050327 (Homo sapiens LCA5, complete cDNA, 2007; of record), and Neitz et al (U.S. 2012/0172419; of record), as applied to Claims 2-3, 5-6, 11-14, 17-20, 23, and 26-28 above, and in further view of Masuda et al (Gene Transfer With Liposomes to the Intraocular Tissues by Different Routes of Administration, Invest. Opthalmol. Vis. Sci. 37: 1914-1920, 1996; of record), Mizuno et al (Improvement of Transduction Efficiency of Recombinant Adeno-associated Virus Vector by Entrapment in Multilamellar Liposomes, Jpn. J. Cancer Res. 89: 352-354, 1998; of record), and Yoshida et al (Clinical gene therapy for brain tumors. Liposomal delivery of anticancer molecule to glioma, J. Neuro-Oncology 65: 261-267, 2003; co-authors to Mizuno et al; of record) is withdrawn for reasons discussed above. 7. The prior rejection of Claim 24 under AIA 35 U.S.C. 103 as being unpatentable over Acland et al (U.S. 2014/0377224; Applicant’s own work; of record) in view of Lewis et al (WO 16/019364; Applicant’s own work, published outside instant application’s grace period; of record in IDS), Chung et al (2013; of record in IDS), GenBank BC050327 (Homo sapiens LCA5, complete cDNA, 2007; of record), and Neitz et al (U.S. 2012/0172419; of record), as applied to Claims 2-3, 5-6, 11-14, 17-20, 23, and 26-28 above is withdrawn for reasons discussed above. 8. Claims 17, 19-20, and 23 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Neitz et al (U.S. 2012/0172419; of record) in view of Drivas et al (U.S. 2016/0185832; Applicant’s own work; of record) and Chung et al (June 2013; Applicant’s own work; of record in IDS). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. With respect to Claim 17, Neitz et al is considered relevant prior art for having disclosed an rAAV virion comprising an AAV capsid (e.g. [0074], “packaging of the AAV virion, “cap from AAV…”), wherein said rAAV genome comprises a nucleic acid sequence encoding human Lebercillin (e.g. [0069], LCA5), wherein said nucleic acid sequence (SEQ ID NO:48; lower line) is at least 99.8% identical (2 mismatches) to instant SEQ ID NO:2 (upper line), as shown below: ATGGGGGAAAGAGCAGGAAGTCCAGGTACTGACCAAGAAAGAAAGGCAGGCAAACACCAT 60 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ATGGGGGAAAGAGCAGGAAGTCCAGGTACTGATCAAGAAAGAAAGGCAGGCAAACACCAT MGERAGSPGTDQERKAGKHH MGERAGSPGTDQERKAGKHH CATCACCAAGCCCCTCGGAAACCAAGCCCCAAGGGTCTACCAAACAGAAAGGGAGTCCGA 240 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| CATCACCAAGCCCCTCGGAAACCAAGCCCTAAGGGTCTACCAAACAGAAAGGGAGTCCGA HHQAPRKPSPKGLPNRKGVR HHQAPRKPSPKGLPNRKGVR As shown above, the sequences encode the identical amino acid sequences, respectively. The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id. Those of ordinary skill in the art would reasonably interpret the 2 dispersed, mismatches to merely represent sequencing errors or stochastic mutation during cloning and replication of the LCA5 coding sequence, and that they are not material to the functionality of the thus-encoded LCA5 protein. There is no objective evidence of record that the two, dispersed, nucleotide differences between the prior art LCA5 sequence and instant SEQ ID NO:2 are material to patentability determination. The instant specification fails to disclose a step of intentionally manipulating the prior art-recognized LCA5 nucleic acid to comprise the instant T>C changes shown in SEQ ID NO:2. The instant specification fails to disclose an element of criticality of the two Cytosine nucleotides, as opposed to the two Thymidine nucleotides. Neither the prior art nor the instant specification teach/disclose that LCA5 activities are predicated upon and absolutely require the two specific Cytosine nucleotide differences present in SEQ ID NO:2. Thus, it appears that Applicant’s instant SEQ ID NO:2 is merely a laboratory-specific artefact arrived at via a sequencing error or mere natural background mutation during cloning and propagating the LCA5 encoding nucleic acid molecule in Applicant’s laboratory. Neitz et al do not disclose wherein the expression control sequence is a hybrid promoter comprising a CMV enhancer and a CBA promoter. However, prior to the effective filing date of the instantly claimed invention, Drivas et al (Applicant’s own work) is considered relevant prior art for having disclosed a rAAV whose genome comprises a therapeutic gene for the treatment of an eye disease or disorder, e.g. Lebercillin (e.g. [0013], rAAV CEP290; [0032], “useful for the treatment of…LCA”), wherein the therapeutic transgene is operably linked to either a CMV promoter [0073], a rhodopsin kinase promoter [0082], or a hybrid promoter, e.g. CBA promoter with CMV enhancer [0073]. Furthermore, Applicant’s own prior art (Chung et al, 2013) previously successfully demonstrated that AAV-mediated gene transfer of an AAV expression vector encoding a CBA promoter driving expression of lebercillin (syn. LCA5), successfully restores retinal and visual function in LCA5 mutant mice. Neitz et al disclosed wherein the rAAV expresses the therapeutic transgene in a human photoreceptor cell (e.g. [0096], “primate retinal cone cell”; [0083], “primate, such as an adult human”; [0099], “more preferably in human retinal cone cells”). Applicant (Drivas et al) previously disclosed wherein the rAAV expresses the therapeutic transgene in a human photoreceptor cell (e.g. [0067], “supports transgene expression in photoreceptors”; [0091], “preferably human, being treated”). Neitz et al disclosed the rAAV vector comprises 5’ and 3’ ITRs (e.g. [0074], “the gene delivery vector is bounded on the 5’ and 3’ end by functional AAV ITRs”). Applicant (Drivas et al) previously disclosed wherein the rAAV comprises 5’ and 3’ ITRs [0062]. Neitz et al disclosed wherein the AAV capsid may be an AAV2, AAV5, or AAV8 capsid (e.g. [0074], cap from AAV2, AAV5, AAV7, AAV8). Applicant (Drivas et al) previously disclosed wherein rAAV has an AAV5, AAV7, or AAV8 capsid (e.g. [0055-57, 157]). Resolving the level of ordinary skill in the pertinent art. People of the ordinary skill in the art will be highly educated individuals such as medical doctors, scientists, or engineers possessing advanced degrees, including M.D.'s and Ph.D.'s. Thus, these people most likely will be knowledgeable and well-read in the relevant literature and have the practical experience in molecular biology, cloning, gene therapy vectors, and gene therapy methods of treating retinal disorders. Therefore, the level of ordinary skill in this art is high. "A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at ___, 82 USPQ2d at 1396. Considering objective evidence present in the application indicating obviousness or nonobviousness. The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144. Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first promoter operably linked to a LCA5 transgene, as disclosed by Neitz et al, with a second promoter operably linked to a LCA5 transgene, i.e. a CMV promoter, a rhodopsin kinase promoter, or a hybrid CBA promoter with CMV enhancer, as disclosed by Drivas et al, in a rAAV expression vector, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first promoter operably linked to a LCA5 transgene, with a second promoter operably linked to a LCA5 transgene, i.e. a CMV promoter, a rhodopsin kinase promoter, or a hybrid CBA promoter with CMV enhancer, in a rAAV expression vector because Applicant themselves (Drivas et al) previously disclosed the use of a CMV promoter, a rhodopsin kinase promoter, or a hybrid CBA promoter to drive expression of the artisan’s therapeutic transgene of interest in photoreceptor cells, and Applicant themselves (Chung et al) previously successfully demonstrated the use of a hybrid CBA promoter to drive expression of a lebercillin transgene in photoreceptor cells via an AAV vector. It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). With respect to Claims 19-20, Neitz et al disclosed a pharmaceutical composition comprising a carrier and a rAAV (Example 1, [0140], [0143], subretinal injections). Applicant (Drivas et al) previously disclosed a pharmaceutical composition comprising a carrier and a rAAV (e.g. Example 14, [0158]). With respect to Claim 23, Netiz et al disclosed wherein subject to be treated includes human subjects (e.g. [0078], “methods…restore visual capacity in the primate”, “more preferably is a human”). Applicant (Drivas et al) previously disclosed wherein subject to be treated includes human subjects (e.g. [0091], “preferably human, being treated”). The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious. Response to Arguments Applicant argues that Neitz et al neither teaches nor suggests instant SEQ ID NO:2. Applicant’s argument(s) has been fully considered, but is not persuasive. Neitz et al disclosed the Lebercillin (LCA5) nucleic acid sequence (SEQ ID NO:48; lower line) is at least 99.8% identical (2 mismatches) to instant SEQ ID NO:2 (upper line), as shown below: ATGGGGGAAAGAGCAGGAAGTCCAGGTACTGACCAAGAAAGAAAGGCAGGCAAACACCAT 60 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ATGGGGGAAAGAGCAGGAAGTCCAGGTACTGATCAAGAAAGAAAGGCAGGCAAACACCAT MGERAGSPGTDQERKAGKHH MGERAGSPGTDQERKAGKHH CATCACCAAGCCCCTCGGAAACCAAGCCCCAAGGGTCTACCAAACAGAAAGGGAGTCCGA 240 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| CATCACCAAGCCCCTCGGAAACCAAGCCCTAAGGGTCTACCAAACAGAAAGGGAGTCCGA HHQAPRKPSPKGLPNRKGVR HHQAPRKPSPKGLPNRKGVR As shown above, the sequences encode the identical amino acid sequences, respectively. The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id. Those of ordinary skill in the art would reasonably interpret the 2 dispersed, mismatches to merely represent sequencing errors or stochastic mutation during cloning and replication of the LCA5 coding sequence, and that they are not material to the functionality of the thus-encoded LCA5 protein. There is no objective evidence of record that the two, dispersed, nucleotide differences between the prior art LCA5 sequence and instant SEQ ID NO:2 are material to patentability determination. The instant specification fails to disclose a step of intentionally manipulating the prior art-recognized LCA5 nucleic acid to comprise the instant T>C changes shown in SEQ ID NO:2. The instant specification fails to disclose an element of criticality of the two Cytosine nucleotides, as opposed to the two Thymidine nucleotides. Neither the prior art nor the instant specification teach/disclose that LCA5 activities are predicated upon and absolutely require the two specific Cytosine nucleotide differences present in SEQ ID NO:2. Thus, it appears that Applicant’s instant SEQ ID NO:2 is merely a laboratory-specific artefact arrived at via a sequencing error or mere natural background mutation during cloning and propagating the LCA5 encoding nucleic acid molecule in Applicant’s laboratory. Applicant argues that Neitz et al is directed to opsin promoters to direct expression of the transgene in retinal cone cells. Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner must determine what is "analogous prior art" for the purpose of analyzing the obviousness of the subject matter at issue. **>"Under the correct analysis, any need or problem known in the field of endeavor at the time of the invention and addressed by the patent [or application at issue] can provide a reason for combining the elements in the manner claimed. " KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). Thus a reference in a field different from that of applicant's endeavor may be reasonably pertinent if it is one which, because of the matter with which it deals, logically would have commended itself to an inventor's attention in considering his or her invention as a whole.< Neitz et al is considered relevant prior art for having disclosed an AAV vector whose genome comprises the Lebercillin (LCA5) nucleic acid sequence (SEQ ID NO:48; lower line) that is at least 99.8% identical (2 mismatches) to instant SEQ ID NO:2 (upper line), as discussed above. Neitz et al disclosed wherein the rAAV expresses the therapeutic transgene in a human photoreceptor cell (e.g. [0096], “primate retinal cone cell”; [0083], “primate, such as an adult human”; [0099], “more preferably in human retinal cone cells”). Applicant argues that Drivas et al is directed to expressing a CEP290 transgene from recombinant vectors. Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner must determine what is "analogous prior art" for the purpose of analyzing the obviousness of the subject matter at issue. **>"Under the correct analysis, any need or problem known in the field of endeavor at the time of the invention and addressed by the patent [or application at issue] can provide a reason for combining the elements in the manner claimed. " KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). Thus a reference in a field different from that of applicant's endeavor may be reasonably pertinent if it is one which, because of the matter with which it deals, logically would have commended itself to an inventor's attention in considering his or her invention as a whole.< Drivas et al (Applicant’s own work) is considered relevant prior art for having disclosed a rAAV whose genome comprises a therapeutic gene for the treatment of an eye disease or disorder, e.g. Lebercillin (e.g. [0013], rAAV CEP290; [0032], “useful for the treatment of…LCA”), wherein the therapeutic transgene is operably linked to either a CMV promoter [0073], a rhodopsin kinase promoter [0082], or a hybrid promoter, e.g. CBA promoter with CMV enhancer [0073]. Applicant (Drivas et al) previously disclosed wherein the rAAV expresses the therapeutic transgene in a human photoreceptor cell (e.g. [0067], “supports transgene expression in photoreceptors”; [0091], “preferably human, being treated”). Applicant argues that based on Neitz et al and Drivas et al, it would not have been obvious to substitute an opsin promoter of Neitz et al with a CMV/CBA promoter because such would destroy the intended function of Neitz et al. Applicant’s argument(s) has been fully considered, but is not persuasive. Neitz et al disclosed wherein the rAAV expresses the therapeutic transgene in a human photoreceptor cell (e.g. [0096], “primate retinal cone cell”; [0083], “primate, such as an adult human”; [0099], “more preferably in human retinal cone cells”). Applicant (Drivas et al) previously disclosed wherein the rAAV expresses the therapeutic transgene in a human photoreceptor cell (e.g. [0067], “supports transgene expression in photoreceptors”; [0091], “preferably human, being treated”). Furthermore, Applicant’s own prior art (Chung et al, 2013) previously successfully demonstrated that AAV-mediated gene transfer of an AAV expression vector encoding a CBA promoter driving expression of lebercillin (syn. LCA5), successfully restores retinal and visual function in LCA5 mutant mice. Thus, those of ordinary skill in the art previously recognized that the CBA promoter of Drivas et al would express the artisan’s transgene of interest in the human photoreceptor cell, whereby Applicant themselves previously successfully reduced to practice driving expression of LCA5 transgene using a CBA promoter in an AAV expression vector (Chung et al). Applicant argues that the interplay between AAV capsid serotype, promoter, and transgene, is highly context dependent especially for expression in vivo. Potency, cell specificity, epigenetic silencing, transcript processing, and dose-limiting toxicity vary with the combination of promoter architecture and specific coding sequences employed. Applicant’s argument(s) has been fully considered, but is not persuasive. In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., promoter, potency, cell specificity, epigenetic silencing, transcript processing, and dose-limiting toxicity) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). Instantly claimed rAAV vector is recited at a high level of generality, including the generically recited promoter. The cite prior art disclosed structural elements that reasonably fulfill the claimed structural elements. All that is required of the claimed rAAV vector is art-recognized routine molecular biology. Applicant argues secondary considerations from the results of post-filing Uyhazi et al (2020) and Aleman et al (2025). Applicant’s argument(s) has been fully considered, but is not persuasive. Applicant’s secondary considerations are directed to an AAV8 viral vector whose genome comprises a hybrid CMV/CBA promoter operably linked to a human LCA5 cDNA. Instant Claim 17 is far broader in scope than Applicant’s secondary considerations. Applicant argues that there is no motivation to combine the LCA5 transgene of Neitz et al with a CMV/CBA hybrid promoter of Drivas et al because Drivas et al only in the context of driving CEP290, not LCA5, whereby there was no reasonable expectation of success to use a CMV/CBA hybrid promoter to drive expression of LCA5 for the treatment of an ocular disease. Applicant’s argument(s) has been fully considered, but is not persuasive. Instant claims are directed to a rAAV vector, not a method of use (Claim 24). Those of ordinary skill in the art have long-practiced the scientific and technical concepts of substituting promoters in rAAV expression vectors, as evidenced at least by both Neitz et al (e.g. [0036], “any suitable promoter region can be used in the gene therapy vectors…”) and Applicant’s own work (Drivas et al, [0070], “suitable promoters for expression in photoreceptors may be selected from…”) and Applicant’s own work (Chung et al) successfully demonstrated using the CBA promoter to drive expression of lebercillin in an AAV expression vector. Thus, it is unclear how one of ordinary skill in the art would have absolutely no reasonable expectation of success with the combination of the prior art-recognized CMV/CBA hybrid promoter to drive expression of LCA5 transgene when Applicant themselves previously published successful demonstration. 9. Claims 19-22 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Neitz et al (U.S. 2012/0172419; of record) in view of Drivas et al (U.S. 2016/0185832; Applicant’s own work; of record), and Chung et al (2013; Applicant’s own work; of record in IDS), as applied to Claims 17, 19-20, and 23 above, and in further view of Masuda et al (1996; of record), Mizuno et al (1998; of record), and Yoshida et al (2003; co-authors to Mizuno et al; of record). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. Neither Neitz et al, Drivas et al, nor Chung et al teach/disclose wherein the rAAV is formulated with a lipid delivery vehicle, more specifically, a liposome. However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 21-22, Masuda et al is considered relevant prior art for having taught a method of gene delivery to mammalian retinal photoreceptors, the method comprising the step of subretinal injection of pharmaceutical composition comprising liposomes encapsulating the artisan’s gene of interest (e.g. Abstract, “Injection into the….subretinal space resulted in the expression of the gene in… retinal ganglion cells and retinal pigment epithelial cells”). Mizuno et al is considered relevant prior art for having taught a pharmaceutical composition comprising rAAV virions encapsulated in liposomes (e.g. Title; pg 352, col. 2, liposomes containing 10^8 particles of rAAV). Yoshida et al (is considered relevant prior art for having taught that using AAV virion-associated liposomes increased the transduction efficiency more than 6-fold compared to the AAV virion alone (pg 265, col. 1, citing Mizuno et al (1998)), as illustrated in Figure 4 (shown below). PNG media_image1.png 140 390 media_image1.png Greyscale Applicant previously disclosed wherein the therapeutic transgene is operably linked to a hybrid promoter, e.g. CBA promoter/CMV enhancer [0070, 73]. Masuda et al taught wherein the transgene is operably linked to a hybrid promoter, i.e. CMV promoter/immediate early enhancer (e.g. pg 1915, col. 1, Methods). Mizuno et al taught wherein the transgene is operably linked to a CMV promoter (e.g. pg 352, col. 1, “CMV promoter”). Neitz et al disclosed wherein the rAAV expresses the therapeutic transgene in a human photoreceptor cell (e.g. [0096], “primate retinal cone cell”; [0083], “primate, such as an adult human”; [0099], “more preferably in human retinal cone cells”). Applicant previously disclosed wherein the rAAV expresses the therapeutic transgene in a human photoreceptor cell (e.g. [0067], “supports transgene expression in photoreceptors”; [0091], “preferably human, being treated”). Masuda et al taught wherein the transgene is expressed in photoreceptor cells (e.g. Abstract, “Injection into the….subretinal space resulted in the expression of the gene in… retinal ganglion cells and retinal pigment epithelial cells”; Figure 4). Considering objective evidence present in the application indicating obviousness or nonobviousness. The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144. Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first pharmaceutical composition comprising rAAV virus particles, as disclosed by Neitz et al and Drivas et al, with a second pharmaceutical composition comprising rAAV virus particles and liposomes, as taught by Mizuno et al and Yoshida et al with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first pharmaceutical composition comprising rAAV virus particles, with a second pharmaceutical composition comprising rAAV virus particles and liposomes because those of ordinary skill in the art had long-recognized, about 20 years(!) prior to the effective filing date of the instantly claimed invention, that: i) pharmaceutical formulations of a liposome composition can be administered to the eye of a subject via subretinal injection, thereby effectively delivering the artisan’s gene of interest to retinal photoreceptor cells (Masuda et al); and ii) pharmaceutical compositions comprising liposomes encapsulating rAAV virus particles improves rAAV transduction (Mizuno et al, Yoshida et al). It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). With respect to Claims 19-20, Neitz et al disclosed a pharmaceutical composition comprising a carrier and a rAAV (Example 1, [0140], [0143], subretinal injections). Applicant (Drivas et al) previously disclosed a pharmaceutical composition comprising a carrier and a rAAV (e.g. Example 14, [0158]). Mizuno et al taught a pharmaceutical composition comprising a carrier and a rAAV (entire paper). The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious. Response to Arguments Applicant argues that Masuda et al, Mizuno et al, and Yoshida et al do not cure the defect of Neitz et al and Drivas et al. Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Neitz et al and Drivas et al are discussed above and incorporated herein. Applicant does not contest the teachings of Masuda et al, Mizuno et al, and Yoshida et al as applied to the obviousness to substitute a first pharmaceutical composition comprising rAAV virus particles, as disclosed by Neitz et al and Drivas et al, with a second pharmaceutical composition comprising rAAV virus particles and liposomes, as taught by Mizuno et al and Yoshida et al with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first pharmaceutical composition comprising rAAV virus particles, with a second pharmaceutical composition comprising rAAV virus particles and liposomes because those of ordinary skill in the art had long-recognized, about 20 years(!) prior to the effective filing date of the instantly claimed invention, that: i) pharmaceutical formulations of a liposome composition can be administered to the eye of a subject via subretinal injection, thereby effectively delivering the artisan’s gene of interest to retinal photoreceptor cells (Masuda et al); and ii) pharmaceutical compositions comprising liposomes encapsulating rAAV virus particles improves rAAV transduction (Mizuno et al, Yoshida et al). 10. Claims 29-30 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Neitz et al (U.S. 2012/0172419; of record) in view of Drivas et al (U.S. 2016/0185832; Applicant’s own work; of record), and Chung et al (2013; Applicant’s own work; of record in IDS), as applied to Claims 17, 19-20, and 23 above, and in further view of Bennett et al (U.S. 2014/0087444; Applicant’s own work). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. Drivas et al (Applicant’s own work) disclosed a rAAV whose genome comprises a therapeutic gene for the treatment of an eye disease or disorder, e.g. Lebercillin (e.g. [0013], rAAV CEP290; [0032], “useful for the treatment of…LCA”), wherein the therapeutic transgene is operably linked to either a CMV promoter [0073], a rhodopsin kinase promoter [0082], or a hybrid promoter, e.g. CBA promoter with CMV enhancer [0073]. Chung et al (Applicant’s own work) previously successfully demonstrated that AAV-mediated gene transfer of an AAV expression vector encoding a CBA promoter driving expression of lebercillin (syn. LCA5), successfully restores retinal and visual function in LCA5 mutant mice. Neither Neitz et al, Drivas et al, nor Chung et al teach/disclose wherein the hybrid promoter comprises SEQ ID NO:10. However, prior to the effective filing date of the instantly claimed invention, Applicant themselves (Bennett et al) previously disclosed rAAV vectors whose genomes comprise a CMV/CBA hybrid promoter whose nucleotide sequence (SEQ ID NO:2) is 100% identical to instant SEQ ID NO:10 operably linked to the artisan’s transgene of interest, including gene therapy vector for the treatment of retinal disease (e.g. [0064]; Example 3). Considering objective evidence present in the application indicating obviousness or nonobviousness. The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144. Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first CBA promoter with a second CBA promoter comprising SEQ ID NO:10 in a rAAV expression vector with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a a first CBA promoter with a second CBA promoter comprising SEQ ID NO:10 in a rAAV expression vector because Applicant themselves previously disclosed the use of a CBA promoter comprising SEQ ID NO:10 in a rAAV expression vector to drive expression of the artisan’s transgene of interest, including transgenes useful for the treatment of a retinal disease/disorder. It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). 11. Claims 17, 19-20 and 23 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Acland et al (U.S. 2014/0377224; Applicant’s own work; of record) in view of Lewis et al (WO 16/019364; Applicant’s own work, published outside instant application’s grace period; of record in IDS), Chung et al (June 2013; Applicant’s own work; of record in IDS), GenBank BC050327 (Homo sapiens LCA5, complete cDNA, 2007; of record), and Neitz et al (U.S. 2012/0172419; of record). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. With respect to Claim 17, Acland et al is considered relevant prior art for having disclosed rAAV expression vectors encoding a hybrid promoter (e.g. [0041]; claim 9) operably linked to LCA5 (e.g. [0031]), and a method of treating an ocular condition in a mammalian subject comprising the step of administering by intravitreal or subretinal injection said rAAV expression vector encoding a hybrid promoter operably linked to LCA5 (e.g. [0031]; claim 9). Acland et al disclosed administering at least 1x10^9 genome copies of the rAAV viral vector (e.g. claim 9). Acland et al disclosed a hybrid promoter comprising a CBA promoter/CMV enhancer (e.g. [0041]; claim 9). Similarly, Lewis et al is considered relevant prior art for having disclosed rAAV expression vectors encoding a hybrid promoter operably linked to LCA5, and a method of treating an ocular condition in a mammalian subject comprising the step of administering by intravitreal or subretinal injection said rAAV expression vector encoding a hybrid promoter operably linked to LCA5 (e.g. [00160]; claim 42). Lewis et al disclosed administering at least 1x10^9 genome copies of the rAAV viral vector (e.g. [00148, 153]). Lewis et al disclosed a hybrid promoter comprising a CBA promoter/CMV enhancer [0081], or a hybrid promoter comprising a CMV promoter, immediate early enhancer, and an operator [00233]. Applicant’s own prior art (Chung et al, 2013) previously successfully demonstrated that AAV-mediated gene transfer of an AAV expression vector encoding a CBA promoter driving expression of lebercillin (syn. LCA5), successfully restores retinal and visual function in LCA5 mutant mice. Neither Acland et al nor Lewis et al disclosed wherein the LCA5 transgene comprises a nucleotide sequence that is at least 90% identical to SEQ ID NO:2. However, prior to the effective filing date of the instantly claimed invention, and with respect to Claims 17-19, GenBank et al taught the nucleotide sequence of human LCA5 cDNA, wherein said nucleotide sequence is at least 99.7% identical to instant SEQ ID NO:2 (six mismatches). Similarly, Neitz et al is considered relevant prior art for having disclosed an rAAV virion comprising an AAV capsid (e.g. [0074], “packaging of the AAV virion, “cap from AAV…”), wherein said rAAV genome comprises a nucleic acid sequence encoding human Lebercillin (e.g. [0069], LCA5), wherein said nucleic acid sequence (SEQ ID NO:48; lower line) is at least 99.8% identical (2 mismatches) to
Read full office action

Prosecution Timeline

Dec 05, 2022
Application Filed
Oct 01, 2024
Non-Final Rejection — §103, §112
Jan 02, 2025
Response Filed
Jan 27, 2025
Final Rejection — §103, §112
Apr 21, 2025
Request for Continued Examination
Apr 23, 2025
Response after Non-Final Action
Jun 30, 2025
Non-Final Rejection — §103, §112
Oct 01, 2025
Response Filed
Nov 03, 2025
Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12589168
COMPOSITIONS AND METHODS FOR TREATING SENSORINEURAL HEARING LOSS USING OTOFERLIN DUAL VECTOR SYSTEMS
2y 5m to grant Granted Mar 31, 2026
Patent 12576135
Compositions and Methods for Anti-TnMUC1 Gold CAR T-cells
2y 5m to grant Granted Mar 17, 2026
Patent 12559717
GENE THERAPY FOR RECESSIVE DYSTROPHIC EPIDERMOLYSIS BULLOSA USING GENETICALLY CORRECTED AUTOLOGOUS KERATINOCYTES
2y 5m to grant Granted Feb 24, 2026
Patent 12544461
ISOLATED NUCLEIC ACID MOLECULE AND APPLICATION THEREOF
2y 5m to grant Granted Feb 10, 2026
Patent 12522636
COMPOSITIONS AND METHODS FOR DELIVERING CFTR POLYPEPTIDES
2y 5m to grant Granted Jan 13, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

5-6
Expected OA Rounds
36%
Grant Probability
70%
With Interview (+33.7%)
3y 7m
Median Time to Grant
High
PTA Risk
Based on 845 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month