DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Nucleotide and/or Amino Acid Sequence Disclosures
Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings.
Regarding Fig. 1 and Fig. 2, nucleotides are present in the drawings but are not identified by sequence in the figure or in the brief description in the specification on page 5.
Required response – Applicant must provide:
Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-20 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claims contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventors, at the time the application was filed, had possession of the claimed invention.
MPEP 2163.I.A recites, “[I]ssues of adequate written description may arise even for original claims, for example, when an aspect of the claimed invention has not been described with sufficient particularity such that one skilled in the art would recognize that the inventor had possession of the claimed invention at the time of filing”.
Claims 1 and 2 are rejected under 35 USC 112(a) for written description because the instant specification does not provide support for an miRNA or SEQ ID NO: 1 derivative comprising “a nucleic acid obtained by modifying, substituting, deleting or adding at least one base to the nucleic acid sequence” of SEQ ID NO: 1, 2 or 3 because the specification does not describe a representative number of species for the genus, which includes an unlimited number of modifications to SEQ ID NO: 1, 2 or 3, such that one skilled in the art would recognize the inventor had possession of the claimed invention.
Claim Interpretation
Regarding Claim 1, Claim 1 recites “a miRNA”, which is interpreted to be a functional limitation as a polynucleotide capable of activating RNA interference against a targeted RNA molecule. Claim 1 also recites, “modifying, substituting, deleting or adding at least one base to the nucleic acid sequence as shown in SEQ ID NO. 1”, which is interpreted to include an unlimited number of modifications, substitutions, deletions, or additions to the original sequence as it has no upper bound. Claim 1 does not recite a common structure, as SEQ ID NO: 1 is not required to be present in the modified miRNA. Therefore, the genus of Claim 1 includes any miRNA sequence.
Regarding Claim 2, Claim 2 recites “a derivative of the miRNA according to Claim 1, comprising a nucleic acid sequence as shown in any one of SEQ ID NO. 2 and SEQ ID NO. 3”. A derivative is a product made from another product and provides no structural limitation. Claim 2 also recites, “modifying, substituting, deleting or adding at least one base to the nucleic acid sequence as shown in any one of SEQ ID NO. 2 and SEQ ID NO. 3”, which is interpreted to include an unlimited number of modifications, substitutions, deletions, or additions to the original sequence as it has no upper bound. Claim 2 does not recite a common structure as SEQ ID NO. 2 and 3 are not required to be part of the modified nucleic acid. Therefore, the genus of Claim 2 includes any nucleic acid.
Guidance Provided by the Specification
The instant specification teaches, “The miRNA (Gma-miR482a) [SEQ ID NO: 1] derived from the Glycine max and the derivatives sRNA482a-228 [SEQ ID NO: 2] and sRNA482a-542 [SEQ ID NO: 3] of the Gma-miR482a have an inhibiting effect on the growth of the rice pest - brown planthopper” (p. 4, lines 11-13). Figure 8 provides evidence that SEQ ID NO: 1, 2, and 3 reduce the survival rate of brown planthoppers. The instant specification does not provide guidance for the base modifications to SEQ ID NO: 1, 2, or 3.
Guidance Provided by the Art
The following art is cited below: Ebhardt, H., et. al., Silence, Vol. 1, No. 12, p. 1-6, June 9, 2010., Hammond, S., Advanced Drug Delivery Reviews, Vol. 87, p. 3-14, June 29, 2015, Kozomara, A. et. al., Nucleic Acids Research, Vol. 47, No. D1, p. D155-D162, published online Nov. 13, 2018, and Zhai, J., et. al., Genes & Development, Vol. 25, p. 2540-2553, Dec. 1, 2011.
Ebhardt teaches that miRNA range from “16 to 35 nucleotides” in length (p. 1, Abstract). Therefore, Claim 1 is limited to a RNA nucleotide molecule of 16 to 35 nucleotides.
Hammond teaches that miRNA are incorporated in the RISC complex and “seeks target mRNAs that have complementarity to the miRNA” (p. 4, col. 2). Kozomara teaches that miRbase, a data base of miRNA, has 48860 identified mature miRNA (p. D155, Abstract). Therefore, not every combination of 16 to 35 nucleotide RNA molecules act as miRNA, and the genus is highly variable.
Zhai teaches that miR482 (SEQ ID NO: 1) as a regulator of the plant NB-LRR defense gene family (p. 2546, col. 2).
A prior art search for SEQ ID NO: 2 and 3 failed to reveal any prior art.
Conclusion
MPEP 2163.II.3.(a).ii recites, “The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the inventor was in possession of the claimed genus … A "representative number of species" means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus.”
Regarding Claim 1, Claim 1 is interpreted to the broad genus of any miRNA. The instant specification provides support for only one miRNA, SEQ ID NO: 1. Ebhardt, and Hammond together teach that miRNA are a broad genus of RNA molecules 16 to 35 nucleotides in length that must be incorporated in the RISC complex and be complementary to a target mRNA molecule. Kozomara teaches that a limited number of RNA molecules have been identified as miRNA, and therefore, the genus of miRNA is highly variable. One skilled in the art would not recognize that the inventor had possession of every miRNA as only one miRNA molecule is described amongst a broad genus, and the instant specification does not teach a representative number of combination of modifications, additions, subtractions or substitutions would produce a miRNA. Therefore, Claim 1 is rejected under 112(a) for written description.
Regarding Claim 2, Claim 2 is interpreted to be any nucleic acid. The instant specification provides support for SEQ ID NO: 2 and 3, but it does not describe modifications to SEQ ID NO: 2 and 3. Nucleic acids are a broad class of molecules that include DNA and RNA. One skilled in the art would not recognize that the inventor had possession of every nucleic acid as only three RNA molecules are described amongst a broad genus, and the instant specification does not teach a representative number of modifications, additions, subtractions or substitutions . Therefore, Claim 2 is rejected under 112(a) for written description.
Dependent Claims 3, 4, 6-9 and 13-15, depending on Claim 1, fail to limit the claim to overcome this rejection and are also rejected under 35 USC 112(a).
Dependent Claims 3, 5, 10-12, and 16-18, depending no Claim 2, fail limit the claim to overcome this rejection and are also rejected under 35 USC 112(a).
Claims 4 and 5 are rejected under 35 USC 112(a) for written description because the instant specification does not provide support for a precursor or simulant of SEQ ID NO: 1, 2, or 3.
Regarding Claims 4 and 5, the instant specification does not recite any description of possible precursors or simulants for SEQ ID NO: 1, 2 or 3. Both precursors and simulants are not defined within the specification, and a BRI of precursors could encompass a large class of molecules. A prior art search for SEQ ID NO: 1, miR482a, did not reveal any precursors or simulants. A prior art search for SEQ ID NO: 2 and 3 failed to reveal any relevant art. Therefore, one skilled in the art would not recognize the inventor had possession of the claimed invention and a prior art search failed to uncover any teachings that would help one skilled in the art make precursors or simulants for SEQ ID NO: 1, 2 or 3, and Claims 4 and 5 are rejected under 35 USC 112(a).
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 2, 4 and 5 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 2 recites a derivative of Claim 1 comprising a nucleic acid sequence comprising “a nucleic acid obtained by modifying, substituting, deleting or adding at least one base to the nucleic acid sequence as shown in any one of SEQ ID NO: 2 and 3”. The phrase “at least one base” is interpreted as allowing any number of changes, including modifying SEQ ID NO: 2 and 3 to have 100% identity to SEQ ID NO: 1. Therefore, Claim 2 fails to further limit Claim 1 is rejected under 35 USC 112(d).
Claim 4 recites a “biological material associated with the miRNA according to claim 1” wherein the biological material is “stimulant of the miRNA”. This is improper because a stimulant of the miRNA does not include the structural limitations of the miRNA; the stimulant does not contain the sequence of the miRNA of Claim 2.
Claim 5 recites a “biological material associated with the derivative of the miRNA according to claim 2” wherein the biological material is “stimulant of the miRNA”. This is improper because a stimulant of the miRNA does not include the structural limitations of the miRNA; the stimulant does not contain the sequence of the miRNA of Claim 2.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1, 2, 4 and 5 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a product of nature without significantly more.
Claims 1 and 2
Step 1:
Claim 1 recites, “A miRNA comprising a nucleic acid sequence as shown in SEQ ID NO. 1”. Claim 2 is rejected under 112(d) for failing to limit further limit Claim 1, and therefore encompasses the same claimed invention. Claims 1 and 2 are both compositions of matter.
Step 2A:
The following art is cited below: Zhai, J., et. al., Genes & Development, Vol. 25, p. 2540-2553, Dec. 1, 2011.
Regarding Claims 1 and 2, Zhai teaches miR482a is expressed in soybeans: “In soybeans, the miR2118 family is slightly more complicated, because this miRNA is multicopy and is the star sequence to miR482” (p. 2546, col. 2). A NCBI nucleotide blast search shows 100% identity with NR_048614.1, the gene for miR482a:
Query 1 GGAATGGGCTGATTGGGAAGCA 22
||||||||||||||||||||||
Sbjct 13 GGAATGGGCTGATTGGGAAGCA 34
Therefore, Claims 1 and 2 are directed to a product of nature.
A judicial exception is not integrated into a practical application because the additional elements are separated by an “or” and no further application is described in Claims 1 or 2.
Step 2B:
Claims 1 and 2 do not recite additional elements that amount to significantly more than the judicial exception. Claim 1 claims miR482a as SEQ ID NO: 1 without any additional elements. Claim 2 does not further limit Claim 1 and also claims miR482a as SEQ ID NO: 1 without any additional elements.
Therefore, Claims 1 and 2 are rejected under 35 USC 101 for claiming a product of nature.
Claims 4 and 5
Step 1:
Claim 4 recites, “A biological material associated with the miRNA according to claim 1”. As Claim 2 is rejected under 112(d) for failing to further limit Claim 1, Claim 5 is interpreted to be “A biological material associated with the miRNA according” to Claim 1. Therefore, Claims 4 and 5 are compositions of matter.
Step 2A:
The following art is cited below: Zhai, J., et. al., Genes & Development, Vol. 25, p. 2540-2553, Dec. 1, 2011.
Regarding Claims 4 and 5, the naturally occurring miR482 is encoded in soybean DNA as Gene ID: 100886208. A DNA molecule encoding miR482 or a precursor to miR482 is naturally occurring soybean DNA. Therefore, Claims 4 and 5 are directed to a product of nature.
A judicial exception is not integrated into a practical application because the additional elements are separated by an “or” and no further application is described in Claims 4 or 5.
Step 2B:
Claims 4 and 5 do not recite additional elements that amount to significantly more than the judicial exception. Claims 4 and 5 claim a DNA molecule encoding SEQ ID NO: 1 or a precursor to SEQ ID NO: 1 without any additional elements.
Therefore, Claims 4 and 5 are rejected under 35 USC 101 for claiming a product of nature.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1, 2, 4 and 5 are rejected under 35 U.S.C. 102(a) as being anticipated by Zhai, J., et. al., Genes & Development, Vol. 25, p. 2540-2553, Dec. 1, 2011.
Regarding Claim 1, Zhai teaches SEQ ID NO: 1, miR482a, is expressed in soybeans: “In soybeans, the miR2118 family is slightly more complicated, because this miRNA is multicopy and is the star sequence to miR482” (p. 2546, col. 2). A NCBI nucleotide blast search shows 100% identity with NR_048614.1, the gene for miR482a:
Query 1 GGAATGGGCTGATTGGGAAGCA 22
||||||||||||||||||||||
Sbjct 13 GGAATGGGCTGATTGGGAAGCA 34
Therefore, Claim 1 is anticipated by Zhai.
Regarding Claim 2, Claim 2 is rejected under 112(d) for failing to further limit Claim 1, and therefore encompasses SEQ ID NO: 1. Zhai teaches SEQ ID NO: 1 as miR482a. Therefore, Claim 2 is anticipated by Claim 2.
Regarding Claim 4, Zhai teaches that miR482a is encoded in soybeans, and therefore soybeans contain a DNA molecule encoding the miRNA or the precursor of the miRNA in the gene NR_048614.1. Therefore, Claim 4 is anticipated by Zhai.
Regarding Claim 5, Claim 2 is rejected under 112(d) for failing to further limit Claim 1, and therefore encompasses SEQ ID NO: 1. Zhai teaches SEQ ID NO: 1 as miR482a. Zhai also teaches that miR482a is encoded in soybeans, and therefore soybeans contain a DNA molecule encoding the miRNA or the precursor of the miRNA in the gene NR_048614.1. Therefore, Claim 5 is anticipated by Zhai.
Claims 1, 2, 4 and 5 are rejected under 35 U.S.C. 102(a) as being anticipated by Kozomara, A. et. al., Nucleic Acids Research, Vol. 47, No. D1, p. D155-D162, published online Nov. 13, 2018.
Regarding Claim 1, Claim 1 is interpreted to be any miRNA sequence. Kozomara teaches a database of miRNA sequences from 271 organisms including 48860 miRNA sequences in the miRbase catalog accessible online at mirbase.org (p. D155, Abstract). Therefore, Claim 1 is anticipated by Kozomara.
Regarding Claim 2, Claim 2 is rejected under 112(d) for failing to further limit Claim 1, and therefore encompasses any miRNA sequence. Kozomara teaches 48860 miRNA sequences, and therefore Claim 2 is anticipated by Kozomara.
Regarding Claim 4, Claim 1 is interpreted to be any miRNA sequence, and therefore, Claim 5 is interpreted to be any miRNA precursor. Kozomara teaches 38589 hairpin precursors to miRNA (p. D155, Abstract). Therefore, Claim 4 is anticipated by Kozomara.
Regarding Claim 5, Claim 2 is rejected under 112(d) for failing to further limit Claim 1, and therefore Claim 5 is interpreted to any miRNA sequence precursor. Kozomara teaches 38589 hairpin precursors to miRNA. Therefore, Claim 5 is anticipated by Kozomara.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Krishna Nuggehalli Ravindra whose telephone number is (571)272-2758. The examiner can normally be reached M-Th, alternate F, 8a-5p est.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/K.N.R./ Examiner, Art Unit 1636
/NEIL P HAMMELL/ Supervisory Patent Examiner, Art Unit 1636