Prosecution Insights
Last updated: April 19, 2026
Application No. 18/125,167

DIPEPTIDYL PEPTIDASE 4 (DPP4) IRNA COMPOSITIONS AND METHODS OF USE THEREOF

Non-Final OA §103§112
Filed
Mar 23, 2023
Examiner
POLIAKOVA-GEORGAN, EKATERINA
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Alnylam Pharmaceuticals, Inc.
OA Round
1 (Non-Final)
65%
Grant Probability
Favorable
1-2
OA Rounds
2y 8m
To Grant
81%
With Interview

Examiner Intelligence

Grants 65% — above average
65%
Career Allow Rate
434 granted / 668 resolved
+5.0% vs TC avg
Strong +16% interview lift
Without
With
+16.2%
Interview Lift
resolved cases with interview
Typical timeline
2y 8m
Avg Prosecution
55 currently pending
Career history
723
Total Applications
across all art units

Statute-Specific Performance

§101
5.4%
-34.6% vs TC avg
§103
28.6%
-11.4% vs TC avg
§102
22.8%
-17.2% vs TC avg
§112
24.2%
-15.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 668 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of Group I, claims 1, 4, 17, 20, 24, 26, 38, 48, 58, 75, 79, 80 in the reply filed on 12/12/2025 is acknowledged. Election of species of SEQ ID NOs: 1887-1891, 1893-1896, 1903 is acknowledged. Claims 84, 88-90, 98, 102 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Group, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 12/12/2025. Priority Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows: The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994). The disclosure of the prior-filed applications, Application No. 63/082,566 and 63/152,900, fail to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application. Disclosures of ‘566 and ‘900 do not recite double stranded nucleic acids targeting instant SEQ ID NO: 6. Therefore, the effective filing date of instant claims is the filing date of PCT/US2021/051663, which is 09/23/2021. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 38, 48 and 58 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 38 recites the limitation "one or more lipophilic moieties" in first and second lines. There is insufficient antecedent basis for this limitation in the claim. Claim 48 is rejected based on dependency on claim 38. For the purpose of examination it will be considered that claim 38 depends on claim 17, but appropriate correction is required. Claim 58 recites the limitation "the lipophilic moiety" in first and second lines. There is insufficient antecedent basis for this limitation in the claim. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1, 4, 17, 20, 24, 26, 38, 48, 58, 75, 79-80 is/are rejected under 35 U.S.C. 103 as being unpatentable over Naito et al (US 2008/0113351, May 2008) and in further view of Nair et al (WO 2019/217469, November 2019, cited from IDS). Naito teach double stranded ribonucleic acids, siRNAs, comprising sense and antisense strands complementary to each other (see paragraphs [0002, 0004, 0062]). One of such siRNAs, of SEQ ID NO: 183391, targets DPP4 (see paragraph [0061], sequence listing and search result below): PNG media_image1.png 731 1350 media_image1.png Greyscale SEQ ID NO: 183391 is 19 nucleotides long and is fully complementary to nucleotides 3-21 of instant SEQ ID NO: 1887 and identical to nucleotides 1206-1224 of instant SEQ ID NO: 6: SEQ ID NO: 1887 1 TAAACTTTACAGTTGGATTCACAG 23 ||||||||||||||||||| SEQ ID NO: 183391 19 TGAAATGTCAACCTAAGTG 1 Complementary sequence to SEQ ID NO: 183391 comprises nucleotides 3-21 of instant SEQ ID NO: 1887. Further Naito teach that nucleotides of siRNAs can be modified and can comprise deoxy nucleotides (see paragraph [0106]), siRNAs can be a part of pharmaceutical composition (see paragraph [0006]) and can be introduced in a cell (see paragraph [0126]). Naito do not teach that both strands of the siRNA are fully modified, or sense strand is conjugated at internal positions 4-8 or 13-18 of sense strand to lipophilic moiety containing C4-C30 hydrocarbon chain, or siRNA comprises phosphorothioate internucleotide linkages or phosphate at 5’ end of antisense strand. Nair teach improvements in delivery of siRNAs in vivo (see paragraph [0005]) by siRNA modifications such as fully modified siRNA (see paragraph [0377]) and by conjugation of lipophilic moieties to internal positions at positions 4-8 and 13-18 on the sense strand (see paragraph [0182]), such lipophilic moiety can be C4-C30 hydrocarbon chain (see paragraph [0371]). Nair teach that siRNA can comprise phosphorothioate internucleotide linkages (see paragraph [0047]) and phosphate at 5’ end of antisense strand (see paragraph [0471]). It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to include modifications taught by Nair into siRNA taught by Naito, arriving at instant invention. One of the ordinary skill in the art would be motivated to do so in order to improve in vivo delivery of siRNA taught by Naito as taught by Nair. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to EKATERINA POLIAKOVA whose telephone number is (571)270-5257. The examiner can normally be reached Mon-Fri 8-5. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571)272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /EKATERINA POLIAKOVA-GEORGANTAS/Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Mar 23, 2023
Application Filed
Jan 30, 2026
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600964
Compound for treatment of heart failure
2y 5m to grant Granted Apr 14, 2026
Patent 12595477
COMPLEMENT FACTOR B-MODULATING COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Apr 07, 2026
Patent 12584130
ANGIOTENSINOGEN (AGT) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Mar 24, 2026
Patent 12576030
COMPOSITIONS FOR DELIVERY OF CODON-OPTIMIZED MRNA
2y 5m to grant Granted Mar 17, 2026
Patent 12570977
NOVEL MRNA COMPOSITION AND PRODUCTION METHOD FOR USE IN ANTI-VIRAL AND ANTI-CANCER VACCINES
2y 5m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
65%
Grant Probability
81%
With Interview (+16.2%)
2y 8m
Median Time to Grant
Low
PTA Risk
Based on 668 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month