DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions and Status of Claims
Applicant’s election without traverse of Group I encompassing claims 1-2, 4-6, 8-12, 25-26, 49-52, 55, and 62, drawn to a protecting oligonucleotide in the reply filed on 3/23/2026 was previously acknowledged.
Applicant’s further election of
Group A: a crRNA sequence and modification pattern of
mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#fNfNrN#mNmGrU#rU#rU#f
UfAmGmAmGmCmUmAmU#mG#mC#mU (SEQ ID NO:3) (crRNA 20)
as recited in claim 51 and
Group B: a protecting oligonucleotide modification pattern of
mUmAmAmAmAmCmNmNmNmNmNmNmNmN (RC09)
as recited in claim 52 (now claim 73)
for further prosecution in the same reply filed on 3/23/2026 is also acknowledged.
Previously, Applicants:
cancelled non-elected claims 58-59 in the reply filed on 3/23/2026, making the election requirement moot.
Added new claims 64- 68, which were added to elected Group I.
No claims are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim.
Claim Amendments and Arguments
This action is in response to papers filed on 8/20/2026 in response to the Non-final Office Action dated 5/18/2026. All of the amendments have been thoroughly reviewed and entered.
Applicant has:
added claims 69-73.
cancelled claims 8-11 and 52,
and amended claims 1, 2, 25, 26, 55, 65, 67, and 68
The amendments are entered. Amendments have overcome:
the 35 USC § 112 rejections; the previous 112(a, b and d) rejections are withdrawn. However, new 35 USC § 112a rejection is presented.
the 35 USC § 102 and 103 rejections. However, new 35 USC § 103 rejections are presented.
Any rejection or objection not reiterated herein has been overcome by amendment. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Applicant's arguments are directed to the previous rejections of the previous claims.
The amendments made to the claims have overcome these previous rejections. However, the current rejections are applicable to the current claims. Applicant's remarks have been fully considered but are moot because they do not specifically address the current rejections of the current claims.
Accordingly, claims 1, 2, 4-6, 12, 25, 26, 49-51, 55, 62, and 64-73 are under consideration.
Applicant is reminded that upon the cancellation of claims to a non-elected invention, the inventorship must be corrected in compliance with 37 CFR 1.48(a) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. A request to correct inventorship under 37 CFR 1.48(a) must be accompanied by an application data sheet in accordance with 37 CFR 1.76 that identifies each inventor by his or her legal name and by the processing fee required under 37 CFR 1.17(i).
Priority
This application claims priority to provisional applications 63/336,340 and 63/438,842. Therefore, it is entitled to the 29th April 2022 priority date of the earliest provisional application.
New Claim Rejections - 35 USC § 112a necessitated by amendment
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim 55 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 55 recites a large genera of: Cas9 nucleases.
Claim 55 depends on claim 49 which depends on claim 25, which is directed to a system of altering expression of any target gene in any target cell with a large genera of chemically modified protecting RNAs duplexed with chemically modified guide RNAs that are directed to any target polynucleotide sequence in any organism and wherein both the chemically modified protecting RNAs and guide RNAs comprise a large genera of chemical modification patterns, with the caveat of a sequence of CAAA (in the protecting oligonucleotide) capable of binding the 5' end of the repeat sequence of the crRNA.
Knowledge in the Prior Art:
crRNAs:
1. the scaffold: Jiang et al. (Science, Vol. 348, Published 16 June 2015, pages 1477-1481) teach the target choice for CRISPR system relies on base pairing between the DNA and the 20nt guide RNA sequence, as well as the presence of a protospacer adjacent motif (PAM) proximal to the target site, and the target complementarity of a “seed” sequence within the protecting segment of crRNAs is critical for DNA recognition and cleavage (Left column, page 1477). Continuous with the 20nt guide sequence is: the repeat of the crRNA that forms a hairpin with the anti-repeat sequence of the tracrRNA, which together act as a scaffold for Cas nuclease (Fig. 1).
2. the sequences of scaffolds: Jiang further teach the sequence of the SpCas9 scaffold: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGTTCG, seen in Fig. 1 and taken from supplementary material. Doudna (US 20140068797 A1) teach various regions of the scaffold. In [0039] Doudna referring to FIGS. 7A-B provide alignments of naturally occurring duplex-forming segments of crRNA ("targeter-RNA") sequences; i.e., repeat regions, from various species. Reproduced below, especially see C.jejuni vs. S.pyogenes:
PNG
media_image1.png
152
400
media_image1.png
Greyscale
It can be seen from the figures that not all sequences of the repeat region that will bind to Cas9 are of the form GTTT, such that they will bind to a sequence of CAAA of the protecting oligonucleotide.
Oligonucleotides in a duplex:
Liu (US 20150071901). Liu teaches that protecting a functional single-stranded nucleic acid (guide sequence) by hybridizing it to a complementary strand (protecting oligonucleotide), inhibits its function. For e.g., Liu found that mRNA-sensing guide RNAs are inactive when their targeting portion is double stranded in a stem loop and become active when mRNA-binding destroys the double-stranded stem thereby liberating the targeting portion (whole document, particularly Fig. 2C).
When claim 55 is analyzed in light of the specification, the instant invention encompasses a large genera of Cas9, thus requiring protecting RNAs to have different sequences that will bind the repeat region so that the protecting sequences may hybridize to a large genera of crRNA sequences, as well as encompassing a large genera of types of chemical modifications and arrangement of modifications in the protecting RNA. The instant specification discloses, and the claims recite a number of Cas9 nucleases that may be utilized in instant system. See disclosure for e.g.:
[0044] In an embodiment, the guide RNA binds to a Cas9
nuclease selected from the group consisting of S. pyogenes
Cas9 (SpCas9), S. aureus Cas9 (SaCas9), N. meningitidis
Cas9 (NmCas9), C. jejuni Cas9 (CjCas9), and Geobacillus
Cas9 (GeoCas9).
In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. In the instant case, the specification discloses names of proteins, as seen in the para replicated above. However, many of the protecting oligonucleotides and crRNA sequences encompass a large number of species of protecting oligonucleotides that will bind the gRNA and the repeat region, with the caveat that the repeat region binding portion of the protecting oligonucleotide is CAAA.
Protecting oligonucleotides: Exemplary sequences, RC01 – RC07 in Table 1, all include at least 4 nucleotides as “N” which is complementary to the guide region of the crRNA for targeting the specific gene, and therefore encompasses millions of species of target sequences targeting any target region of any gene of any organism. Table 3 pages 40-42 disclose specific sequences, SEQ ID NOs:135-151 that duplex with the corresponding to the crRNAs described below. CAAA is seen in RC01 – RC10 (Fig. 2A).
crRNAs: Exemplary sequences, SEQ ID NOs:5-126 in Table 2, all include the first 20 nucleotides as “N” which is the guide region of the crRNA for targeting the specific gene, and therefore encompasses millions of species of target sequences targeting any target region of any gene of any organism. Table 4 pages 42-43 disclose specific sequences (SEQ ID NO: 152-155) for targeting specific regions of specific genes including MCV1 and GFP. However, this is not a representative number of species of the large genus of chemically modified protecting RNA having CAAA and complementary to crRNA capable of hybridizing to any target polynucleotide sequence.
Therefore, the specification does not describe the essential structure of a representative number of species of the large genus of chemically modified protecting RNAs wherein the repeat region binding portion of the protecting oligonucleotide has CAAA, that encompasses targeting a large genus of genes and comprising a large genus of chemical modification patterns.
Next, then, it is determined whether a representative number of species have been sufficiently described by other relevant identifying characteristics, (i.e., other than name), specific features and functional attributes that would distinguish different members of the claimed genus. In the instant case, there are no other features or functional attributes that would distinguish the different members of the genus claimed.
Applicant’s attention is directed to the guidelines for the Examination of Patent Applications Under the 35 U.S.C. 112(a) or Pre-AIA 35 U.S.C. 112, first paragraph, "Written Description" Requirement (MPEP 2163).
Page 35 of the instant specification discloses high affinity interaction (of guide with target) may be enhanced by increasing the GC nucleotide content in the duplex repeat nucleotide sequence and the anti-repeat nucleotide sequence of crRNA and tracrRNA to increase binding affinity between the repeat and anti-repeat nucleotide sequences, and that modifications such as 2’-Fluoro and 2’-O-methyl modifications can be introduced which increase the melting temperature of the duplex.
The teachings in the specification are not representative of genus of nucleases to which the protecting oligonucleotides must bind. The specification fails to reconcile the binding of various Cas9 molecules that do not have GTTT sequences in their repeat region with CAAA of the protecting oligonucleotide as instantly claimed, and further whereby off target activity is reduced and/or on target activity is increased relative to an unprotected guide RNA.
Since the disclosure fails to describe the common attributes and characteristics concisely identifying members of the proposed genus of nucleases to which the CAAA containing the protecting oligonucleotides can bind, and because the claimed genus is highly variant, the description provided is insufficient, one of skill in the art would reasonably conclude that the disclosure fails to provide a representative number of species to describe the protecting oligonucleotides with CAAA that will bind the vast listing of Cas9, as instantly claimed.
In conclusion, Applicant’s disclosure of names of various Cas9 molecules that may be utilized in instant system is not deemed sufficient to reasonably convey to one skilled in the art that Applicant was in possession of the claimed broad genus at the time the application was filed. Thus, it is concluded that the written description requirement is not satisfied for the claimed genus.
New Claim Rejections - 35 USC § 103 necessitated by amendment
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1-2, 4-6, 25-26, 49-50, 55, 65-66, and 69-72 are rejected under 35 U.S.C. 103 as being unpatentable over Dong (US 2020/0056167 A1, previously cited) in view of Kennedy (US 20160040189 A1) (Claims 49-50 are evidenced by evidenced by Lam (Lam et al., Molecular Therapy Nucleic Acids, 2015, IDS) and evidenced by Jiang and Doudna (Jiang and Doudna, Annu. Rev. Biophys. 2017. 46:505–29), previously cited).
Claim Interpretation: a sequence as recited in line 2 of claim 1 is interpreted as a sequence of a minimum of 2 nucleotides.
Regarding claims 1 and 25, Dong teaches a system including compositions and method for use in a CRISPR genome editing system (abstract). The system includes a chemically modified nucleic acid (nucleic acid/oligonucleotide), comprising at least one chemically modified nucleotide, complementary to the guide RNA [0016] – [0017]. The crRNA or guide RNA consists of a 5'-handle and a guide segment. Cpf1 protein interacts with the pseudoknot structure formed by the 5'-handle of crRNA (or guide RNA). The guide segment possesses complementary binding with the target DNA sequences [0065]. Examples of crRNA comprising a 5' end and a 3' end, a guide sequence and a repeat sequence, wherein the repeat sequence forms a hairpin handle, are in fig. 3 (e.g., SEQ ID NO: 3, wild-type crRNA, Fig. 3). The oligonucleotides (nucleic acids) act as adjustable switches to fine-tune the Cpf1 activity (middle of [0140]). In Example 1, Dong teach, crRNA duplexes formed by introduction of oligonucleotides (10-43 nucleotides) complementary to various regions of crRNA were capable of regulating activity of the Cpf1 endonuclease [0138]. Dong teach an embodiment where the nucleic acid covers both the handle and the guide segment of crRNA, e.g., crRNA6 of Fig. 3A and crRNA15 and 18 of Fig. 3B, wherein such a design fully inhibited the Cpf1 function [0143]. Thus, Dong’s “nucleic acid” reads on instant protecting oligonucleotide . Further, as evidenced by Lam, it is a well- established observation that double-stranded RNAs are more resistant to nuclease degradation than single-stranded RNAs (Lam et al., Molecular Therapy Nucleic Acids, 2015, IDS). Thus, Dong’s “nucleic acid/oligonucleotide” reads on most limitations of instant protecting oligonucleotide and wherein the nucleic acid confers nuclease resistance to the crRNA when bound to the crRNA.
Dong does not teach wherein the nucleic acid comprises at least 80% chemically modified nucleotides (claims 1 and 25), or wherein the crRNA comprises at least 50% chemically modified nucleotides (claim 25), or wherein the modified nucleotides include CAAA capable of binding the 5' end of the repeat sequence of the crRNA.
However, before the effective filing date of instant invention, Kennedy had taught a system including compositions and methods for increasing specificity and efficiency of a CRISPR genome editing system (abstract). The system includes a blocking sequence, which is complementary to at least a portion of the guide sequence (claim 1; #314 in Fig. 3); the blocking sequence comprises modified nucleotides (claim 6), and is 5-20 nucleotides long (claim 4).
Regarding claims 1 and 25, Kennedy also teach the detailed structure of the crRNA with its 5’ end, a repeat and anti-repeat region forming a hairpin, and free 3’ region (Fig. 1). Kennedy teach the blocking sequence is designed to form base pairs with various portions of the 20-nt DNA-binding region (of the guide) such as such as the 5' region (Figure 3A) or 3' region (Figure 3B) or a middle region, to adjust the specificity of guide RNA binding and/or cleavage [0058]. Kennedy teach adjusting the length, composition and modifications, thus indicating that the number of modifications isn’t limiting [0059]. See also recitation from [0052]:
PNG
media_image2.png
200
400
media_image2.png
Greyscale
Kennedy teach that such a “cis-blocked guide RNA approach” minimizes any reduction in on-target cleavage activity, yielding better results than most Cas9:guide RNA designs [0063]. Thus, Kennedy’s blocking sequence reads on most limitations of instant protecting oligonucleotide (claim 1) and ds oligonucleotide (claim 25) and Kennedy’s teachings of non-limiting modifications reads on instant at least 80% chemically modified nucleotides, as required by claim 1, and instant at least 50% modified nucleotides of crRNA as required by claim 25.
It would have been obvious to one of ordinary skill, in the art at the time, to modify the nucleic acid of Dong as per the design taught by Kennedy and make a duplex with the guide to arrive at a protecting oligonucleotide in a duplex with the crRNA for the advantage of minimizing any reduction in on-target cleavage activity, yielding better results in vivo. One would be motivated and have had reasonable expectation of success in doing so because both Dong and Kennedy taught: 1. that modifications on designs for protected guides are possible and modifications, including hairpins, render an oligonucleotide nuclease resistant, 2. Both taught that oligo binding to the crRNA acts as a switch to modulate activity of the crRNA, and 3 Kennedy taught that altering modifications would alter the strength of binding (of the oligo with the crRNA), which consequently would alter the activity of the crRNA. See MPEP 2144 II.
Neither Dong nor Kennedy teach wherein the modified nucleotides include CAAA capable of binding the 5' end of the repeat sequence of the crRNA.
As evidenced by Fig. 1 of Jiang and Doudna, the Cas9 single guide RNA comprising a crRNA has a structure and sequence as follows:
PNG
media_image3.png
200
400
media_image3.png
Greyscale
The structure of SpCas9 crRNA (above), shows GUUU as part of the repeat region.
It would have been obvious to those of ordinary skill in the art at the time of the instant invention to modify the teachings of Dong of a nucleic acid/oligonucleotide inhibited crRNA wherein the nucleic acid/oligonucleotide spanned the region of the handle (repeat) and the guide sequence to mimic the blocked guide RNA approach of Kennedy to use with a Cas9 protein because this is no more than the use of a known technique (blocking Cpf1 nuclease) to improve a similar device (blocking Cas9) in the same way (provide a “protecting oligonucleotide” that would bind both the spacer and the repeat region). The MPEP states:
The key to supporting any rejection under 35 U.S.C. 103 is the clear articulation of the reason(s) why the claimed invention would have been obvious. The Supreme Court in KSR noted that the analysis supporting a rejection under 35 U.S.C. 103 should be made explicit. The Court quoting In re Kahn, 441 F.3d 977, 988, 78 USPQ2d 1329, 1336 (Fed. Cir. 2006), stated that "‘[R]ejections on obviousness cannot be sustained by mere conclusory statements; instead, there must be some articulated reasoning with some rational underpinning to support the legal conclusion of obviousness.’" KSR, 550 U.S. at 418, 82 USPQ2d at 1396. Exemplary rationales that may support a conclusion of obviousness include:
(C) Use of known technique to improve similar devices (methods, or products) in the same way;
It would have been further obvious to those of ordinary skill in the art before the instant invention to provide CAAA in the protecting oligonucleotide because this would allow the protecting oligonucleotide to effect a block of Cas9 as Cas9 crRNA is known to have a GUUU fairly close to the 5' end. That is, a non- CAAA will not effectively bind the repeat region. Further, a protecting oligonucleotide with a CAAA will allow the ordinary artisan to use such a protecting oligonucleotide juxtaposed to any other sequence programmed to be specific for the guide sequence, and therefore manipulations of Tm etc., will only need to be done on the guide sequence portion without preparing or wasting time in redesigning the entire 12-20 nucleotide protecting oligonucleotide sequence.
There would have been a reasonable expectation of success in making these combinations/modifications because both references are drawn to the same field of endeavor, effecting on-target gene modifications, and because Dong had already demonstrated modulating the coverage of the “switch” (the nucleic acid/oligonucleotide) in modulating nuclease activity and determination of an effective protecting oligonucleotide sequence would have been within the purview of those of ordinary skill in the biological or medical arts.
The protecting oligonucleotide of claim 1 and the double stranded oligonucleotide of claim 25 is made obvious by Dong in view of Kennedy above.
Regarding claims 2 and 26, Kennedy teaches various chemical modifications (chemical modifications known to raise or lower the Tm of base pairing, [0052]).
Regarding claims 4-6, Kennedy teaches in some embodiments the nucleic acid is RNA and the modifications comprise LNA (a modified ribose sugar comprising an additional covalent linkage between the 2' oxygen and 4' carbon which when incorporated into oligonucleotides can improve overall thermal stability and Selectivity, [0053]).
Regarding claims 49 and 50, Kennedy teaches a trans-activating crRNA (tracrRNA) as part of the genome editing system [0057]. Jiang and Doudna evidence that a fused guide RNA with tracrRNA comprise the following structure: 3' end of the crRNA further comprises a nucleotide loop linking the 3' end of the crRNA portion to 5' end of a trans-activating crRNA (tracrRNA) comprising an anti-repeat nucleotide sequence that is complementary to the repeat sequence portion of the crRNA. See Fig. 4B. Thus, the limitation of a trans-activating crRNA (tracrRNA) comprising a 5' end, a 3' end, and an anti-repeat nucleotide sequence that is complementary to the repeat sequence portion of the crRNA via a linker is met in Kennedy’s teachings.
Regarding claim 55, Kennedy teaches any suitable RNA-guided nuclease may be used; e.g., S. pyogenes Cas9 (SpCas9) ([0068]).
Regarding claim 65, specifically, Kennedy teaches 2' -O-methyl modified RNA (2' - O -methyl modified RNA and phosphorothioate linkages [0052].
Regarding claim 66, modifications alter the Tm of binding, and that modifications may be tailored to arrive at optimum Tm [0052]. Such optimizing may result in at least one unmodified nucleotide of the crRNA binding to the protecting oligonucleotide.
Regarding claims 69-70, neither Dong and Kennedy discuss the specific Tm of the duplex or even explicitly teach that Tm is greater or less than the Tm of the unmodified nucleic acid duplex. The Tm is a property attributed to the structure of the composition. As per MPEP 2112.01, Composition, Product, and Apparatus Claims [R-10.2019] title: I. PRODUCT AND APPARATUS CLAIMS — WHEN THE STRUCTURE RECITED IN THE REFERENCE IS SUBSTANTIALLY IDENTICAL TO THAT OF THE CLAIMS, CLAIMED PROPERTIES OR FUNCTIONS ARE PRESUMED TO BE INHERENT, and considering that the structure of the composition of matter made obvious in Dong and Kennedy is substantially identical to that of the instant application, the claimed property of the composition, namely the Tm, is inherent. Thus, the Tm of Dong and Kennedy’s duplex is as recited.
Regarding claim 71, Kennedy teach the gRNA is modified (claim 6) [0054]; adjusting the length, composition and modifications, thus indicating that the number of modifications isn’t limiting [0055]. Thus, Kennedy’s teachings of non-limiting modifications reads on instant 60-80% chemically modified nucleotides of crRNA, as required by claim 71.
Regarding claim 72, Kennedy teach dissociation of the protecting nucleotide: See recitation from [0060]: In the presence of a cognate DNA target, the cis-blocked stem 316 unwinds as the DNA target hybridizes with the guide sequence, leading to Cas9 cleavage. As shown in Figure 3D,a cognate DNA target site 318 (which is fully complementary to the 20-nt guide sequence) can hybridize to all 20 nt 306 of the guide sequence 304 while the cis-blocked guide RNA duplex is disfavored, thereby allowing binding of Cas9 320 and cleavage 326 of the targeted site.
Claim(s) 12, 51, and 62, 64, 67-68 are rejected under 35 U.S.C. 103 as being unpatentable over Dong (US 2020/0056167 A1, previously cited) in view of Kennedy (US 20160040189 A1) (Claims 49-50 are evidenced by evidenced by Lam (Lam et al., Molecular Therapy Nucleic Acids, 2015, IDS) and evidenced by Jiang and Doudna (Jiang and Doudna, Annu. Rev. Biophys. 2017. 46:505–29), previously cited) as applied to claims 1-2, 4-6, 25-26, 49-50, 55, 65-66, and 69-72 above and further in view of Sontheimer (WO 2019183000 A1, previously cited) and evidenced by ADC Review, (Journal of Antibody-drug Conjugates, April 3, 2015 downloaded from the internet on 12th April 2026 from < https://www.adcreview.com/stable-linker-technologies/peg-linkers/>, previously cited).
The protecting oligonucleotide of claim 1 and the double stranded oligonucleotide of claim 25 is made obvious by Dong in view of Kennedy above.
Neither Dong nor Kennedy teach a moiety attached to the 3’ end of the protecting oligonucleotide or wherein the crRNA comprises the modification pattern as recited.
However, before the effective filing date of instant invention, Sontheimer had taught several heavily modified versions of gRNA that are more potent than their unmodified counterparts (summary). In particular, Sontheimer had taught wherein the crRNA comprises at least 80% modified nucleotides. Sontheimer also taught various advantages of extensively modified RNAs such as: stability, improved potency, and/or reduced off-target effects [007].
Regarding claim 51, Sontheimer further teaches wherein the crRNA portion has the
mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#fNfNrN#m NmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#mG#mC#mU (crRNA 20) [0032], which is the same as the recited pattern:
mN#mN#mN#mNmNmNmNmNmNmNfNfNfNfNrN#rN#fNfNrN#m
NmGrU#rU#rU#fUfAmGmAmGmCmUmAmU#mG#mC#mU (SEQ ID NO:3) (crRNA 20).
Regarding claims 12, 62, and 64, Sontheimer taught moieties attached to terminal nucleotides of the guide RNA via a linker. Sontheimer taught moieties may be conjugated on the 5' end and/or the 3' end of a crRNA and/or a tracrRNA, as, for example, in FIGS. 14A-14D ([0197] Exemplary linkers include... are not limited to an ethylene glycol chain, an alkyl chain, a polypeptide, a polysaccharide, a block copolymer, and the like).
Sontheimer does not disclose that these are cleavable linkers. However, ADC Review, (Journal of Antibody-drug Conjugates, April 3, 2015 downloaded from the internet on 12th April 2026 from < https://www.adcreview.com/stable-linker-technologies/peg-linkers/>) evidence that at least ethylene glycol based linkers (e.g., PEG) are cleavable.
Regarding claim 67, Sontheimer taught wherein the at least one moiety is selected from the group consisting of fatty acids, steroids, secosteroids, lipids, gangliosides analogs, nucleoside analogs, endocannabinoids, vitamins, receptor ligands, peptides, aptamers, and alkyl chains [0194].
Regarding claim 68, Sontheimer taught wherein the at least one moiety is selected from the group consisting of cholesterol, cholesterol-triethylene glycol (TEGChol), docosahexaenoic acid (DHA), docosanoic acid (DCA), lithocholic acid (LA), GalNAc, amphiphilic block copolymer (ABC), hydrophilic block copolymer (HBC), poloxamer, Cy5, and Cy3 [0195].
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have adapted the various chemistries disclosed by Sontheimer with respect to guide RNAs on to the protecting oligonucleotides according to the teachings of Dong and Kennedy, i.e., the protecting oligonucleotide has ribose and phosphate modifications, as recited in claim 65. One would have been motivated to do so for the various advantages discussed by Sontheimer with respect to modified RNA would apply to any oligonucleotide irrespective of its function as a guide RNA or not, for e.g., various advantages of extensively modified RNAs such as: in vivo or ex vivo, including stability, improved potency, and/or reduced off target effects. Furthermore, in certain embodiments, the modified RNAs of the disclosure have reduced immunogenicity, e.g., a reduced ability to induce innate immune responses prevent. It would have been obvious to one of ordinary skill in the art to have arrived at such a protecting oligonucleotide in the process of optimizing the activity and stability of the duplex formed by binding of the protecting oligonucleotide with crRNA. One would have been motivated to do so in order to obtain a protecting oligonucleotide that was resistant to nuclease-mediated breakdown in vivo, and because Sontheimer demonstrated various positions of the crRNA that were amenable to modification without comprising activity. One would have had reasonable expectation of success in doing so because both Kennedy and Sontheimer taught that modifications on RNA are possible and modifications render a more nuclease resistant oligonucleotide. See MPEP 2144 II.
Thus, Dong and Kennedy in view of Sontheimer make obvious instant claim 12, 51, 62, 64, and 67- 68.
Claim(s) 73 is/are rejected under 35 U.S.C. 103 as being unpatentable over Dong (US 2020/0056167 A1, previously cited) in view of Kennedy (US 20160040189 A1) (Claims 49-50 are evidenced by evidenced by Lam (Lam et al., Molecular Therapy Nucleic Acids, 2015, IDS) and evidenced by Jiang and Doudna (Jiang and Doudna, Annu. Rev. Biophys. 2017. 46:505–29), previously cited) as applied to claims 1-2, 4-6, 25-26, 49-50, 55, 65-66, and 69-72 above and further in view of Hedgpeth (US 2004/0058322 A1, previously cited).
The protecting oligonucleotide claim 65 was made obvious by Dong in view of Kennedy.
Neither had taught the specific modifications.
However, before the effective filing date of instant invention, Hedgpeth had taught the same.
Regarding claim 73, Hedgpeth teaches various sequences that are conjugated to moieties. The table shows that conjugation of an oligonucleotide (ODN) dramatically increases the stability of the hybrid formed between the oligonucleotide and its target. Increased stability
(i.e., increased degree of hybridization) is indicated by a higher Tm. Hedgpeth shows that the sequences are complementary to M13mp19 (phage genome).
See below:
PNG
media_image4.png
200
400
media_image4.png
Greyscale
Hedgpeth then study 2'-O-Me-RNA modified duplexes. As seen from the table below conjugated 2'-O-Me-RNA modified backbone forms more stable duplexes with other conjugated 2'-O-Me-RNA modified backbone than with DNA.
PNG
media_image5.png
200
400
media_image5.png
Greyscale
The bolded nucleotides in the alignment below show the similarity of a DNA version of the recited RC09 with Hedgpeth’s sequence.
RESULT 44
US-10-127-936-2
(NOTE: this sequence has 3 duplicates in the database searched)
Sequence 2, US/10127936
Publication No. US20040058322A1
GENERAL INFORMATION
APPLICANT: Meyer, Rich
TITLE OF INVENTION: IMPROVED HYBRIDIZATION AND
TITLE OF INVENTION: MISMATCH DISCRIMINATION USING OLIGONUCLEOTIDES
TITLE OF INVENTION: CONJUGATED TO MINOR GROOVE BINDERS
CURRENT APPLICATION NUMBER: US/10/127,936
CURRENT FILING DATE: 22-Apr-2002
PRIOR APPLICATION NUMBER: US/09/640,953
PRIOR FILING DATE: 16-Aug-2000
PRIOR APPLICATION NUMBER: US/09/054,832
PRIOR FILING DATE: 03-APR-1998
PRIOR APPLICATION NUMBER: 08/415,370
PRIOR FILING DATE: 03-APR-1995
NUMBER OF SEQ ID NOS: 40
SEQ ID NO 2
LENGTH: 12
TYPE: DNA
Query Match 62.7%; Score 9.4; Length 12;
Best Local Similarity 90.9%;
Matches 10; Conservative 0; Mismatches 1; Indels 0; Gaps 0;
Qy 1 TAAAACCGAGG 11
|||||| ||||
Db 2 TAAAACAGAGG 12
Therefore, it would be prima facie obvious to modify Hedgpeth’s SEQ ID NO: 2 by modifying with 2'-O-Me-RNA as Hedgpeth provide the teachings and motivation to do so. Further, Hedgpeth had taught that short oligonucleotides are stabilized in duplexes when conjugated and further such modified RNA-RNA hybrids are more stable than DNA-RNA hybrids. One skilled in the art would have a reasonable expectation of success because the combination of modified sequences used in the method would be performing the same function in the protecting oligonucleotide as it was in the method of Hedgpeth. One of ordinary skill in the art would have performed length optimization of the known sequences and determine the right Tm as Tm determination is obvious and routine, and also demonstrated by Hedgpeth. While arriving at a particular SEQ ID NO may not be obvious, reaching any other sequence would have been obvious. If carrying out such optimization leads to anticipated success, it is likely the product not of innovation but of ordinary skill and common sense to provide routine optimization. See MPEP 2143(I) A, G, and MPEP 2144(II). One of ordinary skill in the art would have a reasonable expectation of success since both Hedgpeth and Kennedy teach stabilizing duplexes for further functional activity. Modifying length and 2'-O-Me-RNA modification of Hedgpeth’s SEQ ID NO: 2 shown in Table 6 would result in sequences sufficiently close to RC09.
Thus, Dong and Kennedy in view of Hedgpeth make obvious instant claim 73.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Response to Arguments
Applicant’s arguments, see Pgs. 1-12, filed 20th August 2026, with respect to objections and rejections under 35 USC § 112(a), (b) and (d) have been fully considered and are persuasive. Applicants assert that the amendments recite features not taught by the applied art. This is persuasive. The amendments have overcome previous objections and rejections; objections and rejections have been withdrawn. However, new rejections under 35 USC § 112a and 103, in view of amendments, have been presented above.
Conclusion
No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
SHABANA S. MEYERING, Ph.D.
Examiner
Art Unit 1635
/SHABANA S MEYERING/ Examiner, Art Unit 1635
/CATHERINE KONOPKA/ Primary Examiner, Art Unit 1635
