Prosecution Insights
Last updated: October 02, 2026
Application No. 18/189,056

COMBINATORIAL PLATFORM FOR HIGH-THROUGHPUT POLYNUCLEOTIDE-ENCODED CATALYST DISCOVERY

Final Rejection §103
Filed
Mar 23, 2023
Priority
Mar 23, 2022 — provisional 63/322,948
Examiner
GROSS, CHRISTOPHER M
Art Unit
1684
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Wisconsin Alumni Research Foundation
OA Round
2 (Final)
64%
Grant Probability
Moderate
3-4
OA Rounds
8m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 64% of resolved cases
64%
Career Allowance Rate
425 granted / 669 resolved
+3.5% vs TC avg
Strong +40% interview lift
Without
With
+40.2%
Interview Lift
resolved cases with interview
Typical timeline
4y 2m
Avg Prosecution
26 currently pending
Career history
699
Total Applications
across all art units

Statute-Specific Performance

§101
3.9%
-36.1% vs TC avg
§103
32.1%
-7.9% vs TC avg
§102
29.3%
-10.7% vs TC avg
§112
24.6%
-15.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 669 resolved cases

Office Action

§103
Need to deal with claim 14 (which is probably ALW) (ribozyme or nanoscaffold) (5a) catalytic (5a) assemb( (20a) (continuous or contiguous) Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Responsive to claim set of 2FEB2026 Claims pending 1-20 Claims currently under consideration 1-20 Priority This application has a filing date of 03/23/2023 and has PRO63/322,948 filed 03/23/2022. Withdrawn Objection(s) and/or Rejection(s) The rejection of claims 14,6-7,20 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph is hereby withdrawn in view of Applicant's amendments to the claims. The rejection of claims 1-4,8-12,15-19 under 35 U.S.C. 102(a)(1 & 2) as being anticipated by Khvorova et al (US AppPub 20060121466) is hereby withdrawn upon further consideration. Maintained Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1-4,6-12,15-19 and 5,13 are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova et al (US AppPub 20060121466) in view of Rothschild et al (US 5948624). Khvorova et al teach throughout the document and especially the abstract non-natural trans-cleaving hammerhead (hairpin containing) ribozymes and methods therefor selecting. More particularly in figures 18 or 20, 21,16,19 & 42A plus paragraphs 0094 & 0024 describing figure 41A Khvorova et al suggest a nucleic acid necessarily barcoded building block oligomer system for preparing a catalyst library system, the polynucleotide system comprising well over 5 sets of single stranded polynucleotides, each set of single stranded polynucleotides characterized by a catalytic component selected from a panel of catalytic components linked to single stranded polynucleotides of the set, such that each single stranded polynucleotide of a set comprises a polynucleotide barcode indicative of the catalytic component selected from the panel of catalytic components linked to the single stranded polynucleotide, a domain complementary to a domain possessed by single stranded polynucleotides of various single stranded polynucleotide RNA target substrate sets, and further such that each single stranded polynucleotide of one set is capable of hybridizing with each single stranded polynucleotide of at least one other set to form a self-assembled polynucleotide nanoscaffold that comprises a catalytic active site including the catalytic components and a barcode signature indicative of the catalytic active site. Such ribozyme assemblies inherently have reporter sequences and/or functional groups that may be detected by that may be detected by sequencing, spectroscopy, etc. The foregoing read on claims 1,2,3,4,6 (when L and M are 1 to 5 at least), 7 (when N is zero at least) 8,9,10,11,12. And as in claims 15,16,17,18,19, the Khvorova method includes: exposing the catalyst system library to catalytic reaction conditions and identifying self-assembled polynucleotide nanoscaffolds that react under the catalytic reaction conditions; isolating self-assembled polynucleotide nanoscaffolds with catalytic activity indicated by the presence or absence of a reporter, amplifying a portion of the self-assembled polynucleotide nanoscaffolds comprising the barcode signature with PCR, and sequencing the portion of the self-assembled polynucleotide nanoscaffolds to determine the barcode signature. (See also paragraphs 0004,0101, figure 17 as described in paragraph 0127) Khvorova et al do not explicitly teach biotin as a reporter of claim 13, nor carboxylic acid-amine bioconjugation of claim 5. Per claims 5 and 13 and further suggesting claims 15-18, Rothschild et al teach throughout the document and especially the abstract, figure 1 top left and/or the paragraph spanning columns 5 to 6, linking biotin to nucleic acids as bioconjugates through amide bond formation (carboxylic acid-amine bioconjugation) It would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have bioconjugated the nucleic acids of Khvorova et al with the chemistry disclosed in Rothschild et al. One of ordinary skill in the art would have been motivated to bioconjugated the nucleic acids of Khvorova et al with the chemistry disclosed in Rothschild et a for the benefit of biotin allowing form facile purification by means including immobilization on a streptavidin surface or chromatography column, as noted by Rothschild et al in the paragraph spanning columns 18 to 19. One of ordinary skill in the art would have had a reasonable expectation of success in applying the biotinylation of Rothschild et al toward the nucleic acids of Khvorova et al since the technique is art-recognized as robust, having been used for decades. *** Please note that the above rejection has been updated from the original version to more clearly address applicants’ newly amended and/or added claims and/or arguments. Response to Arguments The remarks accompanying the present response argue not all elements are taught. Applicant’s arguments have been fully considered but they are not deemed persuasive for the following reasons. More particularly, pp 10 to 16 of the current remarks contends Khvorova et al do not disclose: (i) a panel of catalytic components; (ii) linking one of the catalytic components from the panel to an oligonucleotide; (iii) an oligonucleotide barcode specifically indicative of the catalytic component linked to the polynucleotide, rather the examiner is interpreting Khvorova figure 20A with impermissible hindsight and that “as described on p 19 [sic 21] lines 24-26 of the as-filed application ‘[t]he ligase present in the reaction mixture allows for the ligation of the unique polynucleotide barcode to each single stranded polynucleotide strand and is used to identify the catalytic component that is tethered to the single stranded (ss) polynucleotide prior to assembly of the nanoscaffolds containing multiple components’”.; (iv) a barcode signature; a nor catalytic site barcoded with 3 single stranded oligonucleotides as in present figure 2. The examiner respectfully disagrees for the following reasons that provide more complete detail of the teachings of Khvorova Khvorova reference generally concerns preparing trans-cleaving ribozymes from various naturally occurring contiguous cis-cleaving sequences found in various species, followed by evolution such as to select variants that have activity at physiological magnesium concentrations. Khvorova’s strategy for doing so is illustrated in figure 20 (or 18) followed by figure 16 wherein loop I or III is removed (and creating polynucleotide termini where the loop was) from a naturally occurring cis-cleaving “hammerhead” three helix stem ribozyme to create a type I/III trans-splicing two stranded complex (TCHR) that ultimately catalyzes cleavage into three strands. More particularly, using, for example, cis-cleaving ribozyme SEQ ID 58 from Schistosoma mansoni: ggcagguacauccagcugacgagucccaaauaggacgaaaugccuucgggcauc-cuggauuccacugcu a first TCHR may be constructed: 5’ggcagguacauccagcugacgagucccaaauaggacgaaaugcc3’ hybridized to 5’ggcauc-cuggauuccacugcu; or similarly using cis-cleaving ribozyme SEQ ID 59 from Dolichopoda baccettii guguguucccucugccccgcugaugaggucggggagaccgaaagggucaacucua-cggggcuauuacaugc a second TCHR may be constructed: 5’guguguucccucugccccgcugaugaggucggggagaccgaaaggg3’ hybridized to 5’cucua-cggggcuauuacaugc3’ (wherein catalytic core residues are indicated in bold; removed loop III is underlined and subsequent catalyzed cleavage site indicated as hyphen). Since a linkage to a barcode may simply represent a phosphodiester bond and a barcode may be any sequence, neither of which the present application defines otherwise, the foregoing first Schistosoma TCHR suggested by Khvorova et al is embedded with 5’ggcagguacauccag and 5’ggca that encode catalytic core residues cugacga and u respectively; and likewise, the foregoing second Dolichopoda TCHR has 5’guguguucccucugccccg that encodes catalytic core residues cugauga. Such TCHRs among a multitude of others suggested by the Khvorova reference are next randomized and those species that require less Mg++ for catalytic activity are selected for over cycles of incubation, RT-PCR and transcription (plus cloning & sequencing the TCHRs with a suitable primer in their entirety to establish a “barcode signature”), as detailed in the legend to figure 16 at paragraph 0042. The foregoing interpretation is, in fact consistent with: elements 121,141,162,142; and 261, 241 of present figure 1; the manner in which barcodes are embedded in helices of present figure 26; and/or a barcode signature simply constituting an entire primary sequence like the nanoscaffold illustrated in figure 8, which indeed has striking resemblance to Khvorova’s hammerhead in figure 17A. Regarding a ligase being used for attaching barcodes and/or catalytic active sites barcoded with 3 single stranded oligonucleotides as in present figure 2, in response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., a ligase or catalytic active sites barcoded with 3 single stranded oligonucleotides, much less three catalytic components each uniquely barcoded with three single stranded oligonucleotides) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). Indeed and in contrast with Applicant’s arguments, Khvorova et al indeed teaches or at least strongly suggests a panel of catalytic components linked to specific oligonucleotides that act as barcode for catalytic residue(s) and provide signatures of TCHR active sites. In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). Here, the fact that any oligonucleotide sequence may serve as a barcode for linked residues downstream (or upstream) has been appreciated in the art for decades and in fact forms the basis for a multitude of capture assays, microarrays, etc. Applicant’s arguments regarding Pley et al (1994 Nature 372: 68-74) and Shepotinovskaya et al (2008 Biochemistry 47: 7034-7042) are deemed immaterial, in so far as the rejection is based on Khvorova et al. New Claim Rejection(s) – 35 USC § 103 Claims 1-4,6-12,15-19 and 5,13 and 20 are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova et al (US AppPub 20060121466; of record) in view of Rothschild et al (US 5948624; of record) and further in view of Bendixsen et al (2020 RNA 26:1060-8) Khvorova et al in view of Rothschild et al is relied upon as above. Khvorova et al in view of Rothschild et al do not expressly teach next generation sequencing of claim 20. However, like claim 20, Bendixsen et al teach throughout the document and especially figure 1, a strategy for using Illumina high-throughput sequencing (next generation polynucleotide sequencing) for evaluating self-assembled polynucleotide nanoscaffolds (ribozymes). It would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have utilized Bendixsen’s sequencing strategy in evolving biotinylated ribozymes of Khvorova et al in view of Rothschild et al. One of ordinary skill in the art would have utilized Bendixsen’s sequencing strategy in evolving biotinylated ribozymes of Khvorova et al in view of Rothschild et al for the advantage of screening as many as 1014 different nucleotide sequences for beneficial combinations, powerful according to Bendixsen et al in the first sentence of the abstract and first sentence of p 1061, considerably more the handful evaluated by Khvorova – furthermore this would enable multiplexed experiments such as evolving TCHRs in all three forms I/II, I/III and II/III, etc One of ordinary skill in the art would have had a reasonable expectation of success in applying Illumina next generation sequencing like Bendixsen toward TCHRs of Khvorova in light of the considerable technical overlap between the references, each directly concerning selecting ribozymes with desirable cleavage properties. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTOPHER M GROSS whose telephone number is (571)272-4446. The examiner can normally be reached M-F 10-6. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Heather Calamita can be reached on (571)272-2876. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CHRISTOPHER M GROSS/ Primary Examiner, Art Unit 1684 2JUL2026 9:49 PM
Read full office action

Prosecution Timeline

Mar 23, 2023
Application Filed
Oct 02, 2025
Non-Final Rejection mailed — §103
Dec 23, 2025
Applicant Interview (Telephonic)
Feb 02, 2026
Response Filed
Jul 07, 2026
Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12742198
BIOCHIP AND MANUFACTURING METHOD THEREFOR
5y 5m to grant Granted Sep 22, 2026
Patent 12736540
METHODS FOR IDENTIFYING MODIFICATIONS OF A POLYPEPTIDE
1y 9m to grant Granted Sep 15, 2026
Patent 12723059
Multicyclic Peptides and Methods for Their Preparation
4y 11m to grant Granted Sep 01, 2026
Patent 12704509
SYSTEMS AND METHODS FOR BEAD-BASED ASSAYS IN FERROFLUIDS
4y 7m to grant Granted Aug 11, 2026
Patent 12699100
DEEP LEARNING SYSTEM FOR PREDICTING THE T CELL RECEPTOR BINDING SPECIFICITY OF NEOANTIGENS
3y 4m to grant Granted Aug 04, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
64%
Grant Probability
99%
With Interview (+40.2%)
4y 2m (~8m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 669 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month