Prosecution Insights
Last updated: July 17, 2026
Application No. 18/236,437

PRION PROTEIN (PRNP) IRNA COMPOSITIONS AND METHODS OF USE THEREOF

Non-Final OA §103§DP
Filed
Aug 22, 2023
Priority
Feb 25, 2021 — provisional 63/153,411 +1 more
Examiner
YU, DELPHINUS DOU YI
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Alnylam Pharmaceuticals Inc.
OA Round
1 (Non-Final)
50%
Grant Probability
Moderate
1-2
OA Rounds
0m
Est. Remaining
50%
With Interview

Examiner Intelligence

Grants 50% of resolved cases
50%
Career Allowance Rate
2 granted / 4 resolved
-10.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 4m
Avg Prosecution
35 currently pending
Career history
25
Total Applications
across all art units

Statute-Specific Performance

§103
35.5%
-4.5% vs TC avg
§102
1.6%
-38.4% vs TC avg
§112
24.2%
-15.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 4 resolved cases

Office Action

§103 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status This action is written in response to applicant’s correspondence received on 04/23/2026. Claims 1, 7, 21, 26, 29, 39, 46, 48, 49, 51, 63, 69, 73, 74, 80, 90, 92, 103, & 108-111 are pending. Claims 80, 90, 92, 103, & 108 have been withdrawn as being directed to a non-elected invention. Accordingly, claims 1, 7, 21, 26, 29, 39, 46, 48, 49, 51, 63, 69, 73, 74, 109-111 are examined herein. Election/Restrictions Applicant's election without traverse is acknowledged. The restriction requirement mailed on 02/23/2026 is still deemed proper. Applicant's elected Group I (claims 1, 7, 21, 26, 29, 32, 38-39, 46, 48-49, 51, 63, 69, 73-74) without traverse in the reply filed on 04/23/2026. Applicant further elects, without traverse and for search purposes only, the following species: Duplex AD-1070516 comprising the sequences of 5'-CACGACUGCGUCAAUAUCACA-3' of SEQ ID NO:97 and 5'- UGUGAUAUUGACGCAGUCGUGCA-3' of SEQ ID NO:98 as the single dsRNA sequence; and position 6 on the sense strand, counting from the 5'-end as the single position of a lipophilic moiety; and a 2'-O-methyl nucleotide modification as the single nucleotide modification. Claims 1, 7, 21, 26, 29, 39, 46, 48, 49, 51, 63, 69, 73, 74, and 109-111 encompass the elected species. Since that the election of species requirement regarding Species Group B: nucleotide chemical modifications is that “The applicant is further required to make a species selection for a single nucleotide modification scheme upon election of single dsRNA sequence with a single configuration of lipophilic moiety or moieties for examination”, the stated election of “a 2'-O-methyl nucleotide modification as the single nucleotide modification” for Species Group B is interpreted to indicate that all nucleotides of both the sense and anti-sense strands of the elected AD-1070516 duplex comprise a 2’-O-methyl nucleotide modification. Information Disclosure Statement The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Priority Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e), PRO 63/153,411 filed on 02/25/2021, is acknowledged. This application is a CON of PCT/US2022/017690 filed on 02/24/2022. Drawings The drawing is objected to because 37 CFR 1.84 (u)(1) states “View numbers must be preceded by the abbreviation "FIG.”. In the current case, the view number for Figure 1 is preceded by the word "Figure" instead of the abbreviation "FIG.". Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Specification The use of the terms: Mermade, BioAutomation, Thermo Fisher, Chemgenes, GE Healthcare, Agilent, Tecan, ATCC, Opti-MEM, RNAiMAX, Invitrogen, DYNABEADS, Bio-Tek, ABI, Applied Biosystems, TagMan, Lighcycler, Roche, on pages 138-140, which are trade names or marks used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Objections Claim 1 is objected to because of the following informalities: The recited “is” in “both the sense strand and the antisense strand is conjugated to…” should be “are”. Appropriate correction is required. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1, 7, 21, 26, 29, 39, 46, 48, 49, 51, 63, 69, 73, 74, 109 are rejected under 35 U.S.C. 103 as being unpatentable over Freier (US 12281305 B2, date of patent on 04/22/2025, filed on 11/21/2019; PCT Publication WO 2020/106966, published on 05/28/2020; Listed on IDS submitted on 04/23/2026), in view of Nair (WO 2019/217459 A1, published on 11/14/2019, filed on 05/07/2019; Listed on IDS submitted on 04/23/2026), further in view of Reynolds (Rational siRNA design for RNA interference. Nat Biotechnol. 2004 Mar;22(3):326-30; Listed on IDS submitted on 04/23/2026), Hsieh (A library of siRNA duplexes targeting the phosphoinositide 3‐kinase pathway: determinants of gene silencing for use in cell‐based screens. Nucleic Acids Research, 32, 3, 2004, Pages 893–901), and Khvorova (US 2021/0317460 A1, published on 10/14/2021, filed on 02/26/2021, with priority of Provisional application No. 62/982,941, filed on 02/28/2020) or, alternatively, Naito (US 2011/0054005 A1, published on 03/03/2011, filed on 05/11/2010). Freier (PCT Pub 2020) teaches “compounds, methods, and pharmaceutical compositions for reducing the amount of prion RNA (PRNP RNA) in a cell or animal, and in certain instances reducing the amount of prion protein (PrP protein) in a cell or animal” (Page 1, lines 9-10) via “reduction or blockade of the transcriptional expression” (Page 1, lines 1-2), wherein “compounds include, but are not limited to double-stranded siRNA…” (Page 7, lines 5-6). Freier further teaches that "siRNA" “refers to a ribonucleic acid molecule having a duplex structure including two antiparallel and substantially complementary nucleic acid strands” (Page 7, lines 11-12). The phrases “compound” and “agent” are interchangeable in the art, as well as the phrases “reducing” and “inhibiting”. Persons with ordinary skill in the art (PHOSITAs) would have recognized that the recited “two antiparallel and substantially complementary nucleic acid strands” in Freier (2020) are commonly known as a sense strand and an antisense strand, and that “substantially complementary” indicates that these two strands are capable of forming a double stranded region. Hence, Freier teaches a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of prion protein (PRNP) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region. Freier further teaches the sequences of human PRNP mRNA (GENBANK Accession NO: NM_000311.4; Page 72, lines 3-7; SEQ ID NOs: 1). Freier does not teach the following 3 specific limitations: L1: “wherein all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a nucleotide modification”, L2: “wherein the sense strand, the antisense strand, or both the sense strand and the antisense strand is conjugated to one or more lipophilic moieties”, L3: “wherein antisense strand comprises at least 17 contiguous nucleotides from the nucleotide sequence 5'- UGUGAUAUUGACGCAGUCGUGCA-3' of SEQ ID NO:98”, Regarding L1 and L2, however, Nair (2019) teaches a dsRNA siRNA or iRNA molecule “In some embodiments, 100%, … of the iRNA agent of the invention is modified” (Page 84, ¶[0377]); “100%” indicates “all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a nucleotide modification”; and “A double-stranded iRNA agent comprising: an antisense strand …; a sense strand …; and one or more lipophilic moieties conjugated to one or more internal positions…” (Page 244, claim 1). Therefore, Nair (2019) teaches both the L1 and L2 limitations regarding a dsRNA siRNA agent. Nair (2019) does not teach the limitation L3 regarding a dsRNA siRNA agent design “wherein antisense strand comprises at least 17 contiguous nucleotides from the nucleotide sequence 5'- UGUGA UAUUGACGCAGUCGUGCA-3' of SEQ ID NO:98”. However, Reynolds (2004) teaches a rational systematic siRNA design strategy by targeting every other position along the target mRNA sequence (Page 326, Abstract, lines 11-12; First ¶, lines 2-3). Reynolds further teaches that intermittent tiling (e.g. every other nucleotide) of the siRNA sequence designs significantly reduces the number of sequence design candidates for evaluation yet achieve reasonable expectation of success in siRNA silencing of the target mRNA with more than 60% of knockdown efficiency (Page 328, Fig. 2j). PHOSITAs could have been motivated to further reduce the total number of tiling/walk candidates by designing siRNA antisense sequences from every 2, 5, 10, or 20 nucleotides for rough tilling first to identify a “hot zone” where one or more antisense strands are proven highly efficient to knockdown target mRNA expression, then resort to refined tiling to design antisense sequences starting at every nucleotide in the “hot zone” or use every other intermittent tiling targeting a much reduced stretch of nucleotide sequences within the target mRNA. These are routine and conventional laboratory optimization strategies that PHOSITAs could adopt to reduce the burden of initial siRNA sequence screening and increase reasonable expectation of success, while using an “obvious-to-try” rationale to systematically evaluate a finite and predictable number of solutions to solve a known problem using well understood techniques with substantial guidance from the prior art. Hsieh (2004) teaches a high-throughput, cell-based siRNA screening strategy that uses 96 well plates to efficiently identify potent siRNA duplex designs using limited resources and time (Page 900, Figure 6). The combined teachings, strategies, and motivations of Reynolds (2004) and Hsieh (2004) for identifying the most effective siRNA designs would have provided a routine laboratory optimization workflow that is scalable, high-throughput, and efficient if the sequences of a target mRNA are known. Since the target PRNP mRNA sequences are known in the art and Freier (2020) both lists the mRNA sequences as SEQ ID NO: 1 (GENBANK Accession NO: NM_000311.4; 2808nt). Given that Nair further teaches that the preferred embodiment of siRNA strands featuring: “The double-stranded iRNA agent …, wherein the sense strand is 21-nucleotides in length, and the antisense strands are 23-nucleotides in length, wherein the strands form a double-stranded region of 21 consecutive base pairs having a 2-nucleotide long single-stranded overhangs at the 3 '-end” (Page 245, claim 18), PHOSITAs would have been motivated to apply the methods of Reynolds and Hsieh by screening 2796 (2808-23+1) 23nt antisense strand oligo nucleotides based on the known PRNP mRNA sequences (2808nt long) provided by Freier in search of effective siRNA duplexes that are not claimed by Freier, which would require at least 88 96-well plates for triplicate experimental screening to evaluate the knockdown efficiency of each 20nt antisense strand design of the siRNA duplexes in triplicate because 2796 x 3 = 8388, and 88 plates x 96 wells/plate = 8448 wells in total. While feasible and reasonable to overcome unmet medical needs in the population, it would have been even more efficient if the target sequences of PRNP could be narrowed down to “hot zones” that are proven successful for siRNA antisense designs, thereby dramatically reduce the experimental burden while enhancing the reasonable expectation of success. While PHOSITAs could adopt the strategy of Reynolds by selectively test antisense oligo strand candidates by intermittent designs, e.g. design 23nt antisense strands every other nucleotide, every 10 nucleotides, or every 20 nucleotides along the PRNP mRNA sequences, which would have reduced the total required experimental 96-well plates from 88 to 44, 9, or 5 plates respectively. However, the tradeoff is potentially missing out high-performing candidates that fall between those limited candidates intermittently selected for screening. Neither Reynolds nor Hsieh teaches proven “hot zones” along the PRNP mRNA. However, either Khvorova (2020; full citation above) or, alternatively, Naito (2011; full citation see above) teaches these “hot zones” separately. Khvorova (2020) teaches novel PRNP targeting sequences and novel PRNP targeting oligonucleotides (Abstract). Some of the disclosed PRNP targeting sequences, SEQ ID NOs: 7, 77, 86, all 45nt long, are fragments of human PRNP mRNA (NM_000311.4), see alignments below: SEQ ID NOs: 7, 77, 86 of Khvorova (2020) Query 1 ACCAGAACAACTTTGTGCACGACTGCGTCAATATCACAATCAAGC 45 ||||||||||||||||||||||||||||||||||||||||||||| Sbjct 941 ACCAGAACAACTTTGTGCACGACTGCGTCAATATCACAATCAAGC 985 NM_000311.4 Instant SEQ ID NO: 98 in reverse 3’-acgtgctgacgcagttatagtgt-5’ Reverse Complement: 5’-TGCACGACTGCGTCAATATCACA-3’ 23 ||||||||||||||||||||||| Sbjct 16 ACCAGAACAACTTTGTGCACGACTGCGTCAATATCACAATCAAGC 45 SEQ ID NOs: 7, 77, 86 of Khvorova (2020) Among these “hot zones”, Khvorova identifies several target sequences that are cross-species and teaches that “the cross - species targets are found in both the human and mouse PRNP mRNA and may be useful in comparative in vivo studies” (Page 54, ¶[0635]), and lists 4 PRNP target sequences (SEQ ID NOs: 6-9) as cross-species. Based on Nair (2019)’s teaching of a preferred embodiment of 23 nucleotides for antisense strand designs (Page 245, claim 18), and applying the methods of Reynolds and Hsieh, it would have required screening for 23 antisense strand that are 23nt long (45-23+1=23), and to target each of the 4 cross-species target sequences of the 45nt “hot zones”, the total would have been 23 x 4=92. At least one of the embodiments would have comprised the instant SEQ ID NO: 98 (23nt), which is part of the SEQ ID NO: 7 of Khvorova (2020) and would have comprised at least 17 contiguous nucleotides from the nucleotide sequence 5'- UGUGAUAUUGACGCAGUCGUGCA-3' of SEQ ID NO:98 because 23 encompasses 17. And using Hsieh’s method, only (92 x 3)/96 well = 2.875, i.e. 3x 96 well plates would have been required for triplicate experimentation, and PHOSITAs could have arrived at the claimed antisense strand design (SEQ ID NO: 98) that meet the L3 limitation. Alternatively, without requiring the teachings of Khvorova (2020), Naito (2011) independently teaches 10x siRNA antisense strand sequences in the publicly available sequence listing file nearly a decade earlier (https://seqdata.uspto.gov/docdetail?docId=US20110054005A1) with annotations of the target mRNA identifications. The relevant listings for PRNP mRNA targets from the sequence listing are: <210> 304773 <211> 19 <212> DNA <213> Homo sapiens <220> <223> siRNA target sequence for PRNP (NM_000311.2,532-550). <400> 304773 ctatgaggac cgttactat 19 <210> 304774 <211> 19 <212> DNA <213> Homo sapiens <220> <223> siRNA target sequence for PRNP (NM_000311.2,542-560). <400> 304774 cgttactatc gtgaaaaca 19 <210> 304775 <211> 19 <212> DNA <213> Homo sapiens <220> <223> siRNA target sequence for PRNP (NM_000311.2,543-561). <400> 304775 gttactatcg tgaaaacat 19 <210> 304776 <211> 19 <212> DNA <213> Homo sapiens <220> <223> siRNA target sequence for PRNP (NM_000311.2,567-585). <400> 304776 gttaccccaa ccaagtgta 19 <210> 304777 <211> 19 <212> DNA <213> Homo sapiens <220> <223> siRNA target sequence for PRNP (NM_000311.2,626-644). <400> 304777 gtgcacgact gcgtcaata 19 <210> 304778 <211> 19 <212> DNA <213> Homo sapiens <220> <223> siRNA target sequence for PRNP (NM_000311.2,631-649). <400> 304778 cgactgcgtc aatatcaca 19 <210> 304779 <211> 19 <212> DNA <213> Homo sapiens <220> <223> siRNA target sequence for PRNP (NM_000311.2,632-650). <400> 304779 gactgcgtca atatcacaa 19 <210> 304780 <211> 19 <212> DNA <213> Homo sapiens <220> <223> siRNA target sequence for PRNP (NM_000311.2,636-654). <400> 304780 gcgtcaatat cacaatcaa 19 <210> 304781 <211> 19 <212> DNA <213> Homo sapiens <220> <223> siRNA target sequence for PRNP (NM_000311.2,696-714). <400> 304781 ccgagaccga cgttaagat 19 <210> 304782 <211> 19 <212> DNA <213> Homo sapiens <220> <223> siRNA target sequence for PRNP (NM_000311.2,728-746). <400> 304782 gttgagcaga tgtgtatca 19 Among the above 10, SEQ ID NO: 304777 and 304778 both align as complementary to the instant SEQ ID NO: 98, and both map to overlapping 19nt fragments of PRNP mRNA (NM_000311.4), see alignments below: SEQ ID NO: 304777 of Naito (2011) SEQ ID NO: 304777 of Naito (2011) Query 2 TGCACGACTGCGTCAATA 19 Query 1 GTGCACGACTGCGTCAATA 19 ||||||||||||||||||| ||||||||||||||||||| Sbjct 23 TGCACGACTGCGTCAATA 6 Sbjct 955 GTGCACGACTGCGTCAATA 973 Instant SEQ ID NO: 98 NM_000311.4 SEQ ID NO: 304778 of Naito (2011) SEQ ID NO: 304778 of Naito (2011) Query 1 CGACTGCGTCAATATCACA 19 Query 1 CGACTGCGTCAATATCACA 19 ||||||||||||||||||| ||||||||||||||||||| Sbjct 19 CGACTGCGTCAATATCACA 1 Sbjct 960 CGACTGCGTCAATATCACA 978 Instant SEQ ID NO: 98 NM_000311.4 Naito (2011) discloses that all mRNA target sequences chosen for siRNA designs are shared by humans and mice (Page 1, ¶[0009]; Figure 1), which would enable preclinical experiments to test siRNA candidates using both human and murine tissue or cells. Since both SEQ ID NO: 304777 and 304778 (there are 14 nucleotide overlap between the two) already comprise at least 18 nucleotide of the instant SEQ ID NO: 98, siRNA duplex antisense strand designed to target the 10 disclosed cross-species PRNP mRNA target sequences would have offered a limited “hot zones” for PHOSITAs to apply the methods of Reynolds and Hsieh by designing antisense strand sequences that are 23nt long according to Nair (2019; Page 245, claim 18). Using the 10 disclosed cross-species PRNP mRNA target sequences (19nt long) as design “hot zones”, there are 5x 23nt designs to encompass each of the 10x 19nt “hot zones” i.e. those disclosed target sequences, i.e. there would have been 50 total siRNA duplex antisense strand sequence designs. It would require 2x 96-well plates to run triplicate experimental to screening these 50 candidate sequences and at least some embodiments of these 50 designs would have comprised at least 17 contiguous nucleotides from the sequence 5'- UGUGAUAUUGACGCAGUCGUGCA-3' of SEQ ID NO: 98. It would have been obvious for PHOSITAs before the effective filing date of the instant application to have modified the siRNA duplexes taught by Freier (2020) using nucleotide modification and lipophilic moiety conjugation schemes taught by Nair (2019) and could have used the PRNP target sequences disclosed by Freier by applying the tiling/walk strategy of Reynolds (2004) and the high-throughput screening strategies of Hsieh (2004), while also could have incorporated the further narrowed down target sequences taught by Khvorova (2020), alternatively, could have incorporated the limited cross-species target sequences taught by Naito (2011) without relying on the teachings of Khorova (2020), thereby could have expanded the 19nt target sequences based on the preferred siRNA strand length of 23nt from the more recent teachings of Nair (2019), and would have arrived at the claimed invention. The teachings, strategies, and motivations from Freier, Nair, Reynolds, Hsieh, and either Khvorova or Naito combine to offer a rich repertoire of strategies and solutions well known in the art to cumulatively provide finite number of solutions to address a well-understood problem in the art, forming an “obvious to try” rationale with reasonable expectation for success. In the process, the guidance in the art is abundant and further enhance the level of expectation for success while enabling PHOSITAs to arrive at the claimed inventions. Regarding claim 1, the combined teachings, strategies, and motivations from Freier, Nair, Reynolds, Hsieh, and either Khvorova or Naito to guide PHOSITAs to arrive at the claimed inventions with an “obvious-to-try” rationale with reasonable expectation for success. Regarding claim 7, Nair further teaches “wherein one or more lipophilic moieties are conjugated to one or more positions in the double stranded region on at least one strand” because Nair teaches that “one or more lipophilic moieties are conjugated to one or more of the following internal positions: positions 4-8 and 13-18 on the sense strand, and positions 6-10 and 15-18 on the antisense strand, counting from the 5' end of each strand” (Page 245, claim 13) and “wherein said sense and antisense strands are each 21 to 23 nucleotides in length”(Page 245, claims 17, and 17 depends from 13), and that “a sense strand which is complementary to said antisense strand” (Page 244, claim 1, from which both claims 13 & 17 depend from). In the preferred embodiment, the internal positions can only be the double-stranded region because the terminal 2 positions cover the only single-stranded overhangs. The combination of these limitations indicates that “the one or more lipophilic moieties are conjugated to one or more internal positions in the double stranded region of the dsRNA”. Regarding claim 21, Nair further teaches that “the one or more lipophilic moieties are conjugated to one or more of the internal positions selected from the group consisting of positions 4-8 and 13-18 on the sense strand, and positions 6-10 and 15-18 on the antisense strand, counting from the 5' end of each strand” (Page 245, claim 13). Regarding claim 26, Nair further teaches that “The double stranded RNAi agent …, wherein the lipophilic moiety is an aliphatic, alicyclic, or polyalicyclic compound” (Page 246, claim 19). Regarding claim 29, Nair further teaches that “In certain embodiments, the lipophilic moiety contains a saturated or unsaturated C6-C18 hydrocarbon chain” (Page 246, claim 22). Regarding claim 39, Nair further teaches that “at least 50% of the nucleotides of the double-stranded dsRNA agent is independently modified with 2' - O-methyl, 2' -O-allyl, 2' -deoxy, or 2' -fluoro. …” (Page 8, ¶[0053]). Regarding claim 46, Nair further teaches that “The iRNA agent of the invention may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage.” (Page 84, ¶[0382], first 2 lines). Regarding claim 48, Nair further teaches that “the double stranded RNAi agent… wherein said sense and antisense strands are each 19 to 25 nucleotides in length” (Page 245, claim 16), and “19-25” is within the recited “17-25” range. Regarding claim 49, Nair further teaches “having a 20nucleotide long single-stranded overhangs at the 3’-end” (Page 245, claim 18) and “The double-stranded iRNA agent of any one of claims 1-26, wherein said iRNA agent comprises a single-stranded overhang on at least one of the termini” (Page 247, claim 27). Regarding claim 51, Nair further teaches “…wherein the strands form a double-stranded region of 21 consecutive base pairs…” (Page 245, claim 18), and 21 is within the recited range of “17-25”. Regarding claim 63, Nair further teaches “double stranded RNAi agent …, wherein the 3' end of the sense strand is protected via an end cap which is a cyclic group having an amine, said cyclic group being selected from the group consisting of pyrrolidinyl, …” (Page 248, claim 40). Regarding claim 69, Nair further teaches “double stranded iRNA agent …, comprising a phosphate or phosphate mimic at the 5' -end of the antisense strand” (Page 247, claim 30). Regarding claim 73, since the composition of claim 1 is intended to “inhibiting expression of prion protein (PRNP) in a cell”, contacting an appropriate cell to observe the inhibitory effect of the claimed agent/compound/composition is a routine laboratory procedure. In addition, Nair further teaches “A method of reducing the expression a target gene in a cell, the method comprising: contacting said cell with a double-stranded iRNA agent” (Page 248, claim 41), and Hsieh’s high-through put screening strategy requires a cell (Page 893, Title “cell-based), it would have been obvious to PHOSITAs before the effective filing date of the instant application to have contacted a cell with the PRNP siRNA candidates prepared based on the combined teachings of Freier, Nair, Reynolds, Hsieh, and Khvorova or Naito, to evaluate the screening outcome and RNAi knockdown efficiency of candidates, and could have arrived at the claimed invention of a cell containing the PRNP siRNA compound/agent. Regarding claim 74, Nair further teaches “a pharmaceutical composition that includes an siRNA compound, e.g. a double-stranded siRNA compound…” (Page 166, ¶[0684], first line). Regarding claim 109, some embodiments of the PRNP siRNA candidates prepared based on the combined teachings of Freier, Nair, Reynolds, Hsieh, and either Khvorova or Naito would have comprised at least 19 contiguous nucleotides from the nucleotide sequence 5'- UGUGAUAUUGACGCA GUCGUGCA-3' of SEQ ID NO:98. Regarding claim 110, one embodiment of the PRNP siRNA candidates prepared based on the combined teachings of Freier, Nair, Reynolds, Hsieh, and either Khvorova or Naito, as discussed above, would have comprised all 23 contiguous nucleotides from the nucleotide sequence 5'- UGUGAUAUUGA CGCAGUCGUGCA-3' of SEQ ID NO:98. Claim 111 and the elected species are rejected under 35 U.S.C. 103 as being unpatentable over Freier (2020), in view of Nair (2019), Reynolds (2004), Hsieh (2004), and either Khvorova (2020) or Naito (2011), further in view of Sano (Effect of asymmetric terminal structures of short RNA duplexes on the RNA interference activity and strand selection. Nucleic Acids Res. 2008 Oct;36(18): 5812-21), Kraynack (Small interfering RNAs containing full 2'-O-methylribonucleotide-modified sense strands display Argonaute2/eIF2C2-dependent activity.RNA. 2006 Jan;12(1):163-76), and Salim (Effective carrier-free gene-silencing activity of cholesterol-modified siRNAs. RSC Adv. 2018 Jun 22;8(41):22963-22966). The teachings of Freier, Nair, Reynolds, Hsieh, and either Khvorova or Naito have been discussed above. None of Freier, Nair, Reynolds, Hsieh, and either Khvorova or Naito teaches specifically limitation L4: the sense strand sequence in view of the antisense strand sequence once it is determined by the screening methods discussed above; nor does any of Freier, Nair, Reynolds, Hsieh, and either Khvorova or Naito teach the limitation L5: the specific nucleotide modification scheme across the dsRNA compound/agent; nor does any of Freier, Nair, Reynolds, Hsieh, and either Khvorova or PNG media_image1.png 500 345 media_image1.png Greyscale Naito teach the limitation L6: the internal position of lipophilic moiety conjugation to enhance delivery. However, Sano (2008) teaches the limitation L4 in that “siRNAs with unilateral 2-nt 3’-overhang on the antisense strand were more effective than those with 3’-overhangs or unilateral 2-nt 3’-overhang on the sense strand” (Page 5813, left column, 3rd ¶, lines 4-7; Figure 1, o-b design), and demonstrates that such a design(o-b) enhance RNAi when compared with other designs (b-b, o-o, b-o) in Figure 1 (Page 5813). This would have motivated PHOSITAs to design PRNP siRNA duplexes using the o-b scheme as shown in Figure 1 above, especially in view of the preferred embodiment disclosed by Nair (2019) “The double-stranded iRNA agent …, wherein the sense strand is 21-nucleotides in length, and the antisense strands are 23-nucleotides in length, wherein the strands form a double-stranded region of 21 consecutive base pairs having a 2-nucleotide long single-stranded overhangs at the 3 '-end” (Page 245, claim 18), as Sano’s teaching provides strong motivation for PHOSITAs to at least choose this particular design to start with. It would have been obvious to PHOSITAs before the effective filing date of the instant application to have designed PRNP siRNA duplexes with at least some embodiments wherein the sense strand comprises the nucleotide sequence 5'-CACGACUGCGUCAAUAUCACA-3' of SEQ ID NO:97 and the antisense strand comprises the nucleotide sequence 5'- UGUGAUAUUGACGCAGUCGU GCA-3' of SEQ ID NO:98, motivated by the improved knockdown efficiency of the o-b design (Figure 1 above) when combined with the teachings, strategies, and motivations of Freier, Nair, Reynolds, Hsieh, Sano, and Khvorova or Naito, with reasonable expectation of success in achieving optimal RNAi potency. Regarding claim 111, the following o-b design based on a 23nt long candidate designed based on the obvious-to-try rationale combining Freier, Nair, Reynolds, Hsieh, Sano, and Khvorova or Naito, would have arrived at the claimed dsRNA agent design: SEQ ID NO: 97 1 CACGACTGCGTCAATATCACA 21 ||||||||||||||||||||| Reverse Complement 23 UGCACGACTGCGTCAATATCACA 1 Of SEQ ID NO: 98 23 ACGUGCUGACGCAGUUAUAGUGU 1 Regarding the elected species: Duplex AD-1070516 comprising the sequences of 5'-CACGACUGCGUCAAUAUCACA-3' of SEQ ID NO:97 and 5'- UGUGAUAUUGACGCAGUCGUGCA-3' of SEQ ID NO:98 as the single dsRNA sequence; and position 6 on the sense strand, counting from the 5'-end as the single position of a lipophilic moiety; and a 2'-O-methyl nucleotide modification as the single nucleotide modification, the latter was interpreted to indicate every nucleotide of the sense and antisense strand is modified with 2'-O-methyl modification. None of Freier, Nair, Reynolds, Hsieh, Sano, and Khvorova or Naito teaches limitations L5 or L6, the specific nucleotide modification scheme with 2’-OMe or a position 6 conjugation of lipophilic moiety on the sense strand. However, Kraynack (2006) teaches L5, in that chemical modifications of siRNA nucleotides are “development of siRNAs with improved pharmacokinetic and pharmacodynamic properties for in vivo applications” (Page 163, Introduction, lines 13-15), and that “as observed with the full 2’-OMe sense strand, the full 2’-OMe anti-sense strand is not effectively loaded and/or is not as tightly associated with the HA-hAgo2/RISC complex. In other words, the bulky methyl group may interfere with loading or binding to hAgo2” (Page 171, first 5 lines), which indicates that full 2’-OMe modifications abolish the RNAi potency of siRNA duplexes under investigation. It would have served as a strong negative control for additional nucleotide modification schemes that may enhance, not abolish, the RNAi potency of siRNAs, and PHOSITAs could have at least attempted to generate such a modification scheme to evaluate its potential to serve as a baseline negative control in order to identify functional improvements of other modification schemes, and would have arrived at the full 2’-OMe modification scheme and the limitation L5 of the claimed invention. None of Freier, Nair, Reynolds, Hsieh, Sano, Kraynack, and either Khvorova or Naito teaches L6, the specific position 6 of the sense strand for the conjugation of lipophilic moieties. However, Salim (2018) teaches the limitation L6 by developing the concept of exploring the potential benefits of lipophilic moiety linkage in the internal nucleotide positions using triazole-linked cholesterol as opposed to the conventional 5’ or 3’ terminus conjugation schemes using the Chol-TEG moiety, which contains the commercially-available 3’-end triethylene glycol cholesterol derivative. Salim teaches that adding lipophilic moiety at the central region of the siRNA sense strand enhances gene silencing without any carrier and the traditional Chol-TEG 3’ conjugation performed poorly (Page 22963; right column, 2nd ¶; Page 22964, right column, 2nd and 3rd ¶; Figure 2). Although the study did not use the standard 2’-ribose nucleotide modification, and only explored 2 of the central positions (Page 22964, Table 1), the evidence of improved gene silencing without carrier would have strongly motivated PHOSITAs to explore potential benefits of lipophilic moiety conjugations on other internal nucleotide positions by systematically compare the RNAi potency of one or more lipophilic moieties conjugated to each sense and antisense strand nucleotide using the standard conjugation modifications prevalent in commercial pharmaceutical development, taught by Nair (2019; Page 202-203, Scheme 9 & 10). Since there are only 44 total nucleotides in a preferred embodiment of dsRNA siRNA/RNAi compound of a 23nt antisense-21nt sense strand duplex, as taught by Nair (2019; Page 245, claim 18), combining the 96-well plate screening strategies by Hsieh would have provided efficient readout for each lipophilic moiety conjugation position, forming a finite number of solutions to a known problem in the art following detailed guidance from the prior arts. In addition, Nair further teaches that “the one or more lipophilic moieties are conjugated to one or more of the internal positions selected from the group consisting of positions 4-8 and 13-18 on the sense strand, and positions 6-10 and 15-18 on the antisense strand, counting from the 5' end of each strand” (Page 245, claim 13). Furthermore, since Salim only demonstrated success in placing the Chol-TEG lipophilic moiety in the central region of the sense strand, PHOSITAs would have been motivated to focus on the sense strand positions 4-8 and 13-18 on the sense strand. The combined teachings of Nair, Salim, and Hsieh further reduce the priority nucleotide positions to only 11 nucleotide positions on the sense strand and the RNAi efficiency of all lipophilic moiety conjugation candidates on these 11 nucleotide positions can be screened using just a single 96 well plate because a triplicate experiment for candidate of a known base sequence of siRNA duplex with 11 distinct lipophilic moiety conjugation schemes would only require 33 wells in a multi-well plate. The success demonstrated by the prior arts provide strong motivation and reasonable expectation for success. At least one embodiment would have included a lipophilic moiety modification at position 6 of the sense strand, meeting the limitation L6’s requirement, and PHOSITAs would have arrived at the claimed invention through this routine optimization process. It would have been obvious to PHOSITAs before the effective filing date of the instant application to have modified the siRNA duplexes of Freier, based on discussions above to incorporate the teachings, strategies, and motivations from Nair, Reynolds, Hsieh, Sano, Kraynack, Salim, and either Khvorova or Naito and would have explored a variety of nucleotide modification schemes or lipophilic moiety conjugation positions on the sense strand for the purpose of identifying the optimal RNAi agent. Using simple combination and “obvious to try” rationales, PHOSITAs could have attempted to create a base sequence compound with full 2’-OMe modification for all nucleotides in both the sense and antisense strands to serve as a negative control in order to identify the winning schemes. PHOSITAs would have also been motivated to adopt an “obvious to try” rationale in exploring the optimal conjugation sites within the internal positions of the siRNA duplex strands in order to replicate or exceed the success observed by Salim, and would have arrived at the claimed inventions with full 2’OMe modification and a position 6 lipophilic moiety conjugation on the sense strand with reasonable expectation of success given that the screening technology by Hsieh has offered greater efficiency to screen a finite number of experiments in a compact and efficient manner. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. US Patents: US 9029525 B2, US 8796436 B2, US 8546143 B2, US 8344125 B2, US 8299042 B2, US 8101742 B2, US 8003619 B2, US 7994309 B2, US 7928217 B2, US 7851615 B2, US 7829693 B2, US 7786290 B2, US 7763590 B2 (Hereinafter, USPATs) Claims 1, 7, 21, 26, 29, 39, 46, 48, 49, 51, 63, 69, 73, 74, 109-111 are rejected on the ground of nonstatutory double patenting as being unpatentable over all claims of USPATs in view of NCBI (NCBI_2021_Homo_sapiens_prion_protein__PRNP___transcript_variant_1__mRNA.pdf attached and listed in PTO-892), further in view of Nair (2019), Reynolds (2004), Hsieh (2004), either Khvorova (2020) or Naito (2011), Sano (2008), Kraynack (2006), and Salim (2008). Although the claims at issue are not identical, they are not patentably distinct from each other. USPATs teach general designs of double stranded siRNA/RNAi/iRNA agents with nucleotide modifications and teach embodiments targeting PRNP or a prion protein in the specification or in claims. USPATs do not teach specific sequences for the double stranded agent, nor do USPATs teach the elected species and specific nucleotide modification schemes or specific lipophilic moiety conjugation positions. However, the combined teachings of Nair (2019), Reynolds (2004), Hsieh (2004), either Khvorova (2020) or Naito (2011), Sano (2008), Kraynack (2006), and Salim (2008) would have provided guidance for PHOSITAs to have met siRNA compound/agent designs that meet the claimed limitations L1-L6 as discussed above. It would have been obvious for PHOSITAs before the effective filing date of the instant application to have modified the dsRNA/siRNA/iRNA/RNAi agents of USPATs based on the teachings, strategies, and motivations provided by USPATs, Nair (2019), Reynolds (2004), Hsieh (2004), either Khvorova (2020) or Naito (2011), Sano (2008), Kraynack (2006), and Salim (2008) to design the agent against the PRNP mRNA sequences provided by NCBI (2021) with simple combination and “obvious-to-try” rationales with reasonable expectations for success, and would have arrived at the claimed inventions. US Applications: US20250304957A1, US20250270562A1, US20250243490A1, US20250171777A1, US20250075217A1, US20240343746A1, US20240336914A1, US20240254487A1, US20240209374A1, US20240209339A1, US20240175028A1, US20240117349A1, US20230272382A1, US20230257745A1, US20230203486A1, US20230193268A1, US20230016929A1, US20220307024A1, US20220125823A1, US20200339991A1, US20140154783A1, US20140099666A1, US20140024699A1, US20140004565A1, US20130123332A1, US20120107272A1, US20120035115A1, US20110251259A1, US20110245329A1, US20110218334A1, US20110166198A1, US20100267941A1, US20100076056A1, US20090247614A1 (Hereinafter, USAPPs) Claims 1, 7, 21, 26, 29, 39, 46, 48, 49, 51, 63, 69, 73, 74, 109-111 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over all claims of copending USAPPs in view of NCBI (NCBI_2021_Homo_sapiens_prion_protein__PRNP___transcript_variant_1__mRNA.pdf attached and listed in PTO-892), further in view of Nair (2019), Reynolds (2004), Hsieh (2004), either Khvorova (2020) or Naito (2011), Sano (2008), Kraynack (2006), and Salim (2008). Although the claims at issue are not identical, they are not patentably distinct from each other. USAPPs teach general designs of double stranded siRNA/RNAi/iRNA agents with nucleotide modifications and teach embodiments targeting PRNP or a prion protein in the specification or in claims. USAPPs do not teach specific sequences for the double stranded agent, nor do USAPPs teach the elected species and specific nucleotide modification schemes or specific lipophilic moiety conjugation positions. However, the combined teachings of Nair (2019), Reynolds (2004), Hsieh (2004), either Khvorova (2020) or Naito (2011), Sano (2008), Kraynack (2006), and Salim (2008) would have provided guidance for PHOSITAs to have met siRNA compound/agent designs that meet the claimed limitations L1-L6 as discussed above. It would have been obvious for PHOSITAs before the effective filing date of the instant application to have modified the dsRNA/siRNA/iRNA/RNAi agents of USAPPs based on the teachings, strategies, and motivations provided by USAPPs, Nair (2019), Reynolds (2004), Hsieh (2004), either Khvorova (2020) or Naito (2011), Sano (2008), Kraynack (2006), and Salim (2008) to design the agent against the PRNP mRNA sequences provided by NCBI (2021) with simple combination and “obvious-to-try” rationales with reasonable expectations for success, and would have arrived at the claimed inventions. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Conclusion No claims are allowable. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /DELPHINUS DOU YI YU/Examiner, Art Unit 1636 /NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Aug 22, 2023
Application Filed
Jun 09, 2026
Non-Final Rejection mailed — §103, §DP (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
50%
Grant Probability
50%
With Interview (+0.0%)
2y 4m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 4 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month