augustDETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status and Withdrawn Rejections
Applicant’s amendment filed August 17, 2026 amending claims 1-2, 4, 6, 8, 10, 12, 14, 21, and 45-46 and canceling claim 20 is acknowledged. Claims 1-2, 4-6, 8, 10, 12, 14, 17-18, 21, 42-48, 86-88 are pending. Claims 8, 10 and 12 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim.
Claims 1-2, 4-6, 14, 17-18, 20-21, 42-48, 86-88 are under examination along with elected species (A) a guide RNA with SEQ ID NO 2678 having direct repeat of SEQ ID NO 10, (B) a second guide RNA having sequence that is 90% identical to SEQ ID NO 2677, and (C) a Cas12i polypeptide with SEQ ID NO 2642 or 2634.
Applicant’s amendments overcome the §112(b), §101 and §102 rejections over Cowan. Those rejections are withdrawn. The inclusion of functional language and the sequence identity overcomes the §103 rejections over claim 1 and dependent claims. As such, all §103 rejections below are new and necessitated by amendment. Response to Applicant’s arguments as the apply to the new §103 rejections follow the §103 rejections. The claims in copending application 17/91670 were amended to remove references to guide RNA sequences and methods. The provisional nonstatutory double patenting rejection over the ‘670 copending application is withdrawn.
Any other rejections or objections not reiterated herein have been overcome by amendment. Applicant's amendments and arguments have been thoroughly reviewed but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Priority
As indicated in the previous office action, provisional Application Nos. 63/108110 fail(s) to provide support for the claims under examination, since there is no disclosure therein of Cas12i2 proteins with SEQ ID NO 2641, 2642, 2643, 2644 or 2645. The first evidence of support for Cas12i2 polypeptides with 100% identity to the above SEQ ID NOs is the provisional application 63/252832 (filed October 6, 2021). As such, the effective filing date for claim 18 is October 6, 2021. The effective filing date for the remaining examined claims is October 30, 2020.
Claim Interpretation
Claim 1 recites a composition comprising an RNA guide…, wherein the RNA guide and a Cas12i polypeptide form a ribonucleoprotein complex.” The last wherein clause is interpreted as purely a functional limitation since only the RNA guide was recited after “comprising”. None of the compositions actually require a Cas12i protein except for claim 44. Claim 21 recites “the composition complex binds a target nucleic acid”, which is also interpreted as functional limitations for the RNA guide once it forms a complex with the Cas12i.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 2, 4-6, 14, 17-18, 21, 42-48 and 86 are rejected under 35 U.S.C. 103 as being unpatentable over Cowan (US 20200330609 A1, published October 22, 2020, filed October 17, 2018) as evidenced by Chang (Chang et al., Molecular Therapy (2017), 4: 137-148), and in view of Cheng (US 20200063126 A1, published February 27, 2020). This is a new rejection necessitated by amendment. This rejection is also directed to the elected species of crRNA having SEQ ID NO 2678.
Regarding claim 1, Cowan teaches “SEQ ID NOs: 36,732-71,947 are 22 bp spacer sequences for targeting within or near a BCL11A gene or other DNA sequence that encodes a regulatory element of the BCL11A gene with an… Cpf1 endonuclease” (i.e., a Cas12 protein) ([0157]). Cowan teaches SEQ ID NO 44,195 has the sequence ctggagcctgtgataaaagcaa (see sequence listing incorporated by reference [0003]). Cowan teaches Cpf1 is a type V CRISPR system that uses crRNAs (i.e., RNA guides) that start with 19 nucleotides of a direct repeat followed by nucleotides of a spacer sequence ([0256]). Therefore, Cowan teaches an RNA guide that comprises (i) a spacer sequence that targets a BCL11A gene and (ii) a direct repeat sequence. Cowan is silent as to the target sequence of SEQ ID NO 44195 and whether the sequence is at least 90% complementary to a target sequence that is adjacent to a PAM sequence with 5’NTTN-3’.
Chang teaches the sequence of a GATAA enhancer region in the third intron of the BCL11A gene (Figure 1). Chang teaches the sequence of the region comprises the sequence:
AAACCCTTCCTGGAGCCTGTGATAAAAGCAACTGTTAGCTTGCACTAGA
TTTGGGAAGGACCTCGGACACTATTTTCGTTGACAATCGAACGTGATCT (Figure 1C).
The target sequence corresponding to Cowan’s crRNA with SEQ ID NO 44195 is underlined. The PAM sequence is the three nucleotides 5’ of the target sequence is bolded. Because the first nucleotide in the claimed PAM sequence “NTTN” is 5’ of the targeted sequence, any nucleotide reads on the first PAM nucleotide. Thus, the BCL11A target site targeted by an RNA guide with a direct repeat and a spacer sequence with SEQ ID NO 44195 taught in Cowan is inherently 1) complementary to the bottom strand of the BCL11A enhancer region and 2) targets a sequence that is adjacent to a PAM sequence with 5’-NTTN.
Cowan does not teach type V CRISPR systems that comprise Cas12i or their guide RNAs with the direct repeat sequences.
Cheng teaches Cas12i CRISPR systems comprising Cas12i polypeptides and crRNAs comprising direct repeats (FIGs 1-3 and 11). Cheng teaches the Cas12i forms a ribonucleoprotein complex with its crRNA, which then binds to the target sequence ([0040]). Regarding claim 6, Cheng teaches a Cas12i2 crRNA sequence having a direct repeat sequence of AGAAAUCCGUCUUUCAUUGACGG (i.e., 100% identical to SEQ ID NO 10). Cheng teaches the PAM requirement for Cas12i2 is 5’-TTN (FIG. 41B). Regarding claim 17, Cheng teaches combining a Cas12i2 polypeptide and the crRNA having the direct repeat and spacers with lengths or 17, 20, 23 and 31 nucleotides (FIG 41A, [0169], [0343]). Regarding claim 18, Cheng teaches the amino acid sequence of Cas12i2 is SEQ ID NO 5 ([0016], page 60), which is 100% identical to SEQ ID NO 2624, and 99.74% identical to SEQ ID NO 2642 of the examined application (see OA Appendix in previous office action). Regarding claim 21, Cheng teaches Cas12i2 and guide RNAs delivered to 293T cells targeted to the VEGFA locus resulting in indel formation (i.e., the Cas12i2/crRNA forming an RNP in a cell) ([0169]; FIG 41A). Regarding claim 44, Cheng teaches delivery methods for CRISPR systems are well known in the art and include delivering the Cas effector and the crRNA to cells encoded as a plasmid or a viral vector (i.e., a vector system comprising one or more vectors encoding the crRNA and Cas12i2) ([0045]-[0046], [0311]). Regarding claim 48, Cheng teaches optimizing the coding sequence of Cas12i2 for use in mammalian cells (Table 10). Cheng teaches therapeutic applications of the Cas12i technology ([0304]-[0306]), including editing cells ex vivo for treating sickle cell disease by disruption of the BCL11A erythroid enhancer ([0306]). Cheng teaches the Cas12i have advantages of a smaller size for greater versatility in delivery strategies ([0010]).
Regarding claims 1, 6, 17-18, 21, 44 and 48, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have designed the Cas12i2 crRNA with the BCL11A spacer sequence taught in Cowan and combined with the Cas12i2 effector taught in Cheng for the purpose of editing the GATAA motif in the erythroid enhancer sequence of the BCL11A gene. It would have amounted to the simple combination of known prior art elements by known means to yield predictable results. The skilled artisan would have predicted that the Cas12i2 crRNA with direct repeat of SEQ ID NO 10 could be designed to target the BCL11A gene because Cowan teaches using type V CRISPR effectors for editing and Cheng teaches the Cas12i2 technology can be used to edit the BCL11A enhancer. The skilled artisan would have been motivated to have used a Cas12i system for the purpose of treating sickle cell disease because 1) it was suggested by Cheng and 2) the Cas12i systems are smaller than Cpf1 systems thereby providing versatility in delivery strategies.
Regarding claim 2, as evidenced by Chang (Figure 1), the targeted sequence of Cowan’s RNA guide inherently targets a sequence in an enhancer region.
Regarding claims 4-5, Cowan’s spacer sequence with SEQ ID NO 44195 comprises a sequence that is 100% identical to nucleotides 1-22 of SEQ ID NO 1332 as shown below:
SEQ ID NO 1332: cuggagccugugauaaaagcaacuguuagc
Cowan’s SEQ 44195: ctggagcctgtgataaaagcaa
Regarding claim 14, as indicated above for claim 1, Cowan’s RNA guide with a direct repeat and a spacer sequence with SEQ ID NO 44195 inherently targets a sequence that is adjacent to (b) a PAM sequence of 5’-CTTC and is immediately adjacent to the PAM sequence.
Regarding claims 42 and 43, Cowan teaches delivering RNA guides as a nucleic acid encoding the guide RNA, wherein the nucleic acid is in a plasmid (i.e., a vector) (Fig 1, [0422]-[0425]). Cheng teaches delivering Cas12i as a plasmid (FIG. 40; [0168]).
Regarding claims 45-46, Cowan teaches delivering nucleic acids encoding the RNA guides to cells for expression in cells and for methods of editing the BCL11A gene in human cells ([0434]-[0437], [0531]). Cheng teaches delivering Cas12i and guide RNAs to cells (FIGs 40-41).
Regarding claim 47, the specification does not provide a special definition for the term "kit”, thus "kit" is interpreted as merely the sum of its contents. The teachings of Cowan, Chang and Cheng, are recited above as for claim 1.
Regarding claim 86, as indicated above for claim 1, Cowan’s crRNA with spacer having SEQ ID NO 44195 targets a GATAA motif of an enhancer region of the BCL11A gene. Cheng teaches Cas12i2 efficiently cleaves the target DNA (FIG 411). Thus, it was entirely predictable that Cheng’s Cas12i2 directed the GATAA enhancer region of the BCL11A gene would cleave (i.e., disrupt) the GATAA motif.
Claims 87-88 are rejected under 35 U.S.C. 103 as being unpatentable over Cowan (US 20200330609 A1, published October 22, 2020, filed October 17, 2018) as evidenced by Chang (Chang et al., Molecular Therapy (2017), 4: 137-148) and in view of Cheng (US 20200063126 A1, published February 27, 2020), as applied to claims 1, 2, 4-6, 14, 17-18, 21, 42-48 and 86 above, further in view of Genbank (NG_011968.1, Homo sapiens BAF chromatin remodeling complex subunit BCL11A (BCL11A), RefSeqGene on chromosome 2, https://www.ncbi.nlm.nih.gov/nuccore/228008311, available October 1, 2019, [retrieved April 13, 2016]). This is a new rejection necessitated by amendment to claim 1. This rejection is also directed to the elected species of two crRNA having SEQ ID NO 2678 and 2677.
The teachings of Cowan, Chang and Cheng, are recited above as for claims 1, 2, 4-6, 14, 17-18, 21, 42-48 and 86 and are incorporated here. Cheng also teaches using genome editing to generate two double strand breaks (DSBs) within 50 bases of each other that results in indel formation at both sites and/or a deletion between the DSBs ([0093], [0266]). As indicated above for claim 1, Cowan teaches SEQ ID NOs: 36,732-71,947 sequences for targeting within or near a BCL11A gene with a Type V CRISPR endonuclease ([0157]). Cowan teaches SEQ ID NO 64021 is gaagcuagucuagugcaagcua, which comprises the spacer sequence of SEQ ID NO: 2677 as follows:
SEQ ID NO 2677: agaaauccgucuuucauugacgggaagcuagucuagugcaagc
Cowan SEQ 64021: gaagcuagucuagugcaagcua
Cowan also teaches editing the BCL11A gene, including in a regulatory element, that results in a permanent deletion of a transcription control sequence of the BCL11A gene, including in the +58 DNA hypersensitive site ([0010]). Cowan also teaches that using a Cas nickase (i.e., only cleaving one strand of the DNA) and two separate guides RNAs, one for each nickase, to enable a DSB to form in the target, which reduces the likelihood of DSB occurring at off-target locations ([0275]).
Cowan, Chang and Cheng do not teach the entire sequence of the BCL11A erythroid enhancer sequence.
Genbank teaches the sequence of the BCL11A gene. Genbank teaches the sequence that flanks the sequence taught in Cheng as the BCL11A enhancer as follows. The underlined sequence is Cheng’s enhancer sequence. Bolded nucleotides are spacer sequences, SEQ ID NOs 44195 and 64021 taught in Cowan. Capitalized nucleotides are known 5’-TTN Cpf1 and Cas12i2 PAMs. The vertical lines indicate the position of cleavage by Cas12i2 taught in Cheng.
5’-aaaccCTTCctggagcctgtgataaaagcaact|gttagcttgcactagactagcttcaaagttg
tttgggaaggtcctcggacactattttcgttga|caatcgaacgtgatctgatcgaagTTTCaac -5’
It would have been obvious to one skilled in the art to have combined the crRNA comprising SEQ ID NO 2378 rendered obvious above with a crRNA comprising the Cas12i2 direct repeat taught in Cheng and a spacer sequence targeted BCL11A taught in Cowan to arrive at a crRNA comprising SEQ ID NO 2677. It would have amounted to the simple combination of prior art elements by known means to yield predictable results. Regarding a crRNA comprising SEQ ID NO 2677, the skilled artisan would have predicted that the Cas12i2 crRNA with direct repeat of SEQ ID NO 10 could be designed to target the BCL11A gene because Cowan teaches using type V CRISPR effectors for editing and Cheng teaches the Cas12i2 technology can be used to edit the BCL11A enhancer, which is targeted Cowan’s spacer with SEQ ID NO 64021 as evidenced by Genbank. It was also predictable that the obvious crRNA could be used to target the specific BCL11A sequence because GenBank teaches the spacer sequence of Cowan is adjacent to a 5’ TTN PAM sequence, which Cheng teaches is also the PAM requirement of Cas12i2. Regarding combining two BCL11A enhancer-targeting crRNAs, the skilled artisan would have predicted the two obvious crRNAs could be combined because 1) Cheng teaches combining two crRNAs for the purpose of creating two single-strand breaks with a nickase or two DSBs with nucleases for creating indels or deletions at the targeted site, and 2) Cowan teaches using two guide RNAs to create a single DSB to reduce off-target editing. The skilled artisan would have been motivated to have done so for the purpose of treating sickle cell disease as suggested by Cheng.
Response to Arguments - §103
Applicant summarized the previous §103 rejection over Cowan in view of Cheng (Remarks, page 24, ¶4). Applicant then argues that Cowan does not provide any working examples where a type V CRISPR system is used to modify BCL11A, while Chang emphasizes that Cas9 systems have been used to modify BCL11A. Thus, Applicant would not have been motivated to use Cheng’s Cas12i2 system. Applicant then asserts that their working examples resulted in robust indel activity at the BCLA11 locus to disrupt the enhancer (Remarks, page 25, ¶1-2). These arguments have been fully considered but are not persuasive. Cheng specifically teaches that the Cas12i2 system can be used for therapeutic applications including editing cells ex vivo for treating sickle cell disease by disruption of the BCL11A erythroid enhancer. As such, the skilled artisan would have been motivated to use Cheng’s Cas12i2 with the spacer sequence taught in Cowan. Additionally, by the effective filing date of the claimed invention it was well known that type II (i.e., Cas9) and type V (i.e., Cas12) CRISPR effectors could both be used for gene editing and the skilled artisan could choose what effector was best amenable to their application based on available PAM sequences near the intended target and size of the effector for delivery purposes.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-2, 4-6, 14, 17-18, 21, 42-48, 86-88 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2, 5, 7, 9, 12, 18, 23, 26-29, 34-37, 39-43 and 47 of copending Application No. 18000218 in view of Cowan (US 20200330609 A1, published October 22, 2020, filed October 17, 2018), Chang (Chang et al., Molecular Therapy (2017), 4: 137-148), Cheng (US 20200063126 A1, published February 27, 2020) and of Genbank (NG_011968.1, Homo sapiens BAF chromatin remodeling complex subunit BCL11A (BCL11A), RefSeqGene on chromosome 2, https://www.ncbi.nlm.nih.gov/nuccore/228008311, available October 1, 2019, [retrieved April 13, 2016]).
Copending claim 1 recites A composition comprising:(a) an RNA guide or a nucleic acid encoding the RNA guide, wherein the RNA guide comprises a direct repeat sequence and a spacer sequence; and(b) a Cas12i2 polypeptide or a nucleic acid encoding the Casl2i2 polypeptide, wherein the RNA guide forms a complex with the Cas 12i2 polypeptide, and wherein the spacer sequence is capable of hybridizing to a target nucleic acid in a eukaryotic cell that is adjacent to a protospacer adjacent motif (PAM) sequence comprising 4 nucleotides including NTTY (i.e., NTTN). Copending claim 2 recites wherein the PAM sequence comprises the sequence: 5'-CTTT-3'. Copending claim 5 recites wherein the spacer sequence comprises between 10 and 50 nucleotides in length. Copending claim 12 recites wherein the direct repeat sequence comprises SEQ ID NO: 17, which is 100% identical to SEQ ID NO 10 and the direct repeat portion of SEQ ID NOs 2677 and 2678. Copending claim 23 recites wherein the Cas12i2 polypeptide comprises:(a) an amino acid sequence with at least 95% identity to SEQ ID NO: 2, which is 100% identical to SEQ ID NO 2634 of the examined application. Copending claim 26 recites wherein the target sequence is present in a cell. Copending claim 28 recites wherein the Cas12i2 polypeptide and the RNA guide are encoded in a vector or one or more expression vectors. Copending claim 36 recites A vector comprising a sequence encoding the Cas12i2 polypeptide and RNA guide of the composition of claim 1. Copending claim 37 recites A cell comprising the composition of claim 1. Copending claim 42 recite A method of targeting a sequence adjacent to a PAM sequence comprising four nucleotides, the method comprising contacting the sequence with a composition of claim 1. Copending claim 47 recites A kit or system comprising a composition of claim 1,a cell comprising the composition, or a vector encoding the Cas12i2 polypeptide and RNA guide of the composition.
The copending claims do not recite a specific spacer sequence for the guide RNA.
The teachings of Cowan, Chang, Cheng and GenBank are recited above in paragraphs 11-13, 15, 17-23, and 27 and incorporated here. Briefly, Cowan teaches type V CRISPR crRNA spacer sequences for targeting the enhancer region of BCL11A region include crRNAs comprising the spacer sequences of SEQ ID NOs 2678 and 2677. Chang and GenBank teach the nucleotide sequence of the BCL11A enhancer region. Cheng teaches Cas12i2 polypeptides use crRNAs with direct repeats have SEQ ID NO 10 (i.e., the same as the DR repeat in the copending claims) and that Cas12i2 requires a 5’-TTN PAM, which is the same as a 5’-NTTN PAM.
It would have been obvious to one skilled in the art to have used the copending Cas12i2 polypeptide and crRNA with direct repeat of SEQ ID NO 10 to target the BCL11A enhancer by designing the crRNA with a spacer sequence to arrive at crRNAs with SEQ ID NO 2677 and 2678. It would have amounted to the simple combination of prior art elements by known means to yield predictable results. Regarding a crRNA comprising SEQ ID NO 2677 and 2678, the skilled artisan would have predicted that the Cas12i2 crRNA with direct repeat of SEQ ID NO 10 could be designed to target the BCL11A gene because Cowan teaches using type V CRISPR effectors for editing and Cheng teaches the Cas12i2 technology can be used to edit the BCL11A enhancer, which is targeted Cowan’s spacer with SEQ ID NO 44195 and 64021 as evidenced by Genbank. It was also predictable that the obvious crRNA could be used to target the specific BCL11A sequence because GenBank teaches the spacer sequence of Cowan is adjacent to a 5’ TTN PAM sequence, which Cheng teaches is also the PAM requirement of Cas12i2. Regarding combining two BCL11A enhancer-targeting crRNAs, the skilled artisan would have predicted the two obvious variants of the copending crRNAs could be combined because 1) Cheng teaches combining two crRNAs for the purpose of creating two single-strand breaks with a nickase or two DSBs with nucleases for creating indels or deletions at the targeted site, and 2) Cowan teaches using two guide RNAs to create a single DSB to reduce off-target editing. The skilled artisan would have been motivated to have done so for the purpose of treating sickle cell disease as suggested by Cheng.
This is a provisional nonstatutory double patenting rejection.
Claims 1-2, 4-6, 14, 17-18, 20-21, 42-48, 86-88 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-14 of copending Application No. 18063607 in view of Cowan (US 20200330609 A1, published October 22, 2020, filed October 17, 2018), Chang (Chang et al., Molecular Therapy (2017), 4: 137-148), Cheng (US 20200063126 A1, published February 27, 2020) and of Genbank (NG_011968.1, Homo sapiens BAF chromatin remodeling complex subunit BCL11A (BCL11A), RefSeqGene on chromosome 2, https://www.ncbi.nlm.nih.gov/nuccore/228008311, available October 1, 2019, [retrieved April 13, 2016]).
Copending claim 1 recites variant Cas12i2 polypeptide comprising the sequence set forth in SEQ ID NO: 4, which is at least 99% identical to SEQ ID NOs 2634 and 2642-2645. Copending claim 3 recites A composition comprising a variant Cas12i2 polypeptide of claim 1, wherein the composition further comprises an RNA guide or a nucleic acid encoding the RNA guide, wherein the RNA guide comprises a direct repeat sequence and a spacer sequence. Copending claim 4 recites wherein the direct repeat sequence comprises a nucleotide sequence with at least 95% sequence identity to any one of SEQ ID NO: 492, with is 100% identical to SEQ ID NO 10 and the direct repeat portion of SEQ ID NOs 2677 and 2678 of the examined application. Copending claim 7 recites A nucleic acid molecule encoding a variant Cas12i2 polypeptide of claim 1. Copending claims 9-10 recite A cell comprising the variant Cas12i2 polypeptide of claim 1, including a human cell. Copending claim 11 recites A method of complexing a variant Cas12i2 polypeptide with an RNA guide (i.e., forming a ribonucleocomplex) wherein the variant Cas12i2 polypeptide comprises a variant Cas12i2 polypeptide of claim 1 and the RNA guide comprises a direct repeat sequence and a spacer sequence. Copending claim 14 recites A method of introducing a deletion or insertion in a cell (i.e., editing a genomic sequence), wherein the method comprises contacting the cell with a composition of claim 3.
The copending claims do not recite a specific spacer sequence for the guide RNA.
The teachings of Cowan, Chang, Cheng and GenBank are recited above in paragraphs 11-13, 15, 17-23, and 27 and incorporated here. Briefly, Cowan teaches type V CRISPR crRNA spacer sequences for targeting the enhancer region of BCL11A region include crRNAs comprising the spacer sequences of SEQ ID NOs 2678 and 2677. Chang and GenBank teach the nucleotide sequence of the BCL11A enhancer region. Cheng teaches Cas12i2 polypeptides use crRNAs with direct repeats have SEQ ID NO 10 (i.e., the same as the DR repeat in the copending claims) and that Cas12i2 requires a 5’-TTN PAM, which is the same as a 5’-NTTN PAM.
The obviousness of having used the copending Cas12i2 polypeptide and crRNA with direct repeat of SEQ ID NO 10 to target the BCL11A enhancer by designing the crRNA with a spacer sequence to arrive at crRNAs with SEQ ID NO 2677 and 2678 is recite above in paragraph 38 and incorporated here.
This is a provisional nonstatutory double patenting rejection
Conclusion
No claims are allowable.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Prosecution Insights